Starting /dee2/code/volunteer_pipeline.sh SRR7180104 current disk space = 3056953753600 free memory = 1445649776 SRR7180104 SRAfilesize 8c26ab090a384f495b5b08691473e93a SRR7180104.sra SRR7180104.sra file validated SRR7180104 is paired end SRR7180104 is conventional basespace SRR7180104 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180104_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.56175 32.0 18.0 33.0 18.0 33.0 2 29.89625 32.0 27.0 33.0 25.0 34.0 3 31.32275 33.0 31.0 33.0 28.0 33.0 4 32.1305 33.0 32.0 33.0 31.0 34.0 5 32.6105 33.0 33.0 33.0 32.0 34.0 6 36.63225 38.0 37.0 38.0 34.0 38.0 7 37.2695 38.0 38.0 38.0 36.0 38.0 8 37.43425 38.0 38.0 38.0 37.0 38.0 9 37.511 38.0 38.0 38.0 38.0 38.0 10-14 37.6245 38.0 38.0 38.0 38.0 38.0 15-19 37.623400000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.61285 38.0 38.0 38.0 38.0 38.0 25-29 37.6373 38.0 38.0 38.0 38.0 38.0 30-34 37.58925000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.5742 38.0 38.0 38.0 38.0 38.0 40-44 37.5274 38.0 38.0 38.0 38.0 38.0 45-49 37.5068 38.0 38.0 38.0 38.0 38.0 50-54 37.41405 38.0 38.0 38.0 37.4 38.0 55-59 37.352250000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.3567 38.0 38.0 38.0 37.0 38.0 65-69 37.012100000000004 38.0 38.0 38.0 36.4 38.0 70-74 36.903 38.0 38.0 38.0 36.0 38.0 75-79 37.0603 38.0 38.0 38.0 35.8 38.0 80-84 37.121300000000005 38.0 38.0 38.0 36.0 38.0 85-89 37.046 38.0 38.0 38.0 36.0 38.0 90-94 36.84415 38.0 38.0 38.0 35.2 38.0 95-99 36.7284 38.0 38.0 38.0 35.0 38.0 100-104 36.5655 38.0 38.0 38.0 34.2 38.0 105-109 36.4805 38.0 37.8 38.0 34.0 38.0 110-114 36.135450000000006 38.0 37.4 38.0 33.4 38.0 115-119 36.117149999999995 38.0 37.0 38.0 33.2 38.0 120-124 35.799299999999995 38.0 36.8 38.0 31.4 38.0 125-129 35.6612 38.0 36.2 38.0 31.0 38.0 130-134 35.36535 38.0 36.0 38.0 29.0 38.0 135-139 34.95835 38.0 35.0 38.0 28.0 38.0 140-144 34.44780000000001 38.0 34.6 38.0 25.8 38.0 145-149 33.224799999999995 38.0 33.8 38.0 19.0 38.0 150-151 28.45375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 3.0 21 2.0 22 6.0 23 7.0 24 7.0 25 4.0 26 16.0 27 6.0 28 16.0 29 26.0 30 35.0 31 49.0 32 84.0 33 111.0 34 151.0 35 344.0 36 874.0 37 2255.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.70817704426106 18.12953238309577 11.377844461115279 37.78444611152788 2 18.975 22.35 34.775 23.9 3 20.599999999999998 26.974999999999998 26.150000000000002 26.275 4 20.95 34.375 21.825 22.85 5 21.575 34.275 25.4 18.75 6 16.775000000000002 34.975 26.724999999999998 21.525 7 13.425 22.85 43.15 20.575 8 18.425 22.575 29.525000000000002 29.475 9 17.525 22.775000000000002 32.25 27.450000000000003 10-14 19.86 28.98 26.540000000000003 24.62 15-19 19.585 27.889999999999997 28.134999999999998 24.39 20-24 19.867980197029556 28.45926889033355 27.344101615242288 24.32864929739461 25-29 19.63 28.24 28.33 23.799999999999997 30-34 20.21 28.07 28.03 23.69 35-39 19.575 28.355000000000004 28.16 23.91 40-44 20.26 28.65 27.894999999999996 23.195 45-49 20.59 27.985 28.01 23.415 50-54 20.544999999999998 28.544999999999998 27.534999999999997 23.375 55-59 20.1 28.405 27.375 24.12 60-64 20.1600400100025 27.796949237309327 28.27706926731683 23.765941485371343 65-69 19.925380659473632 28.30493092669154 27.941917918725423 23.82777049510941 70-74 20.568233338370863 28.300841267442443 27.827313485466725 23.303611908719965 75-79 20.1 27.544999999999998 28.355000000000004 24.0 80-84 20.1 28.134999999999998 27.98 23.785 85-89 20.465 28.08 27.99 23.465 90-94 20.49 28.18 27.915 23.415 95-99 20.46 27.955000000000002 27.92 23.665 100-104 20.54527263631816 28.139069534767387 27.32366183091546 23.991995997999 105-109 20.7 27.939999999999998 27.735 23.625 110-114 20.905905905905904 27.967967967967965 27.58258258258258 23.543543543543542 115-119 20.815 28.21 27.58 23.395 120-124 20.66 27.529999999999998 28.005000000000003 23.805 125-129 20.327032703270326 27.77777777777778 27.972797279727974 23.92239223922392 130-134 20.45 27.810000000000002 27.744999999999997 23.995 135-139 20.49 27.72 27.950000000000003 23.84 140-144 21.065 27.765 27.639999999999997 23.53 145-149 20.65 28.28 27.175 23.895 150-151 20.325 27.800000000000004 26.687499999999996 25.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 3.5 25 4.0 26 2.0 27 3.0 28 8.0 29 11.5 30 12.0 31 20.0 32 30.0 33 38.0 34 51.0 35 68.0 36 86.5 37 97.5 38 121.0 39 159.5 40 194.5 41 228.0 42 260.0 43 277.0 44 306.0 45 316.5 46 285.0 47 251.5 48 222.5 49 206.0 50 175.5 51 137.5 52 107.5 53 83.5 54 56.0 55 33.5 56 29.0 57 28.5 58 22.5 59 14.0 60 10.0 61 8.0 62 5.0 63 4.0 64 4.0 65 2.0 66 1.5 67 1.0 68 2.0 69 2.0 70 1.5 71 2.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.025 65-69 0.83 70-74 0.745 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.0 110-114 0.1 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.025 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.075 0.025 0.0 0.0 0.0 84-85 0.075 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0 0.0 88-89 0.1 0.025 0.0 0.0 0.0 90-91 0.1 0.025 0.0 0.0 0.0 92-93 0.1375 0.025 0.0 0.0 0.0 94-95 0.2 0.025 0.0 0.0 0.0 96-97 0.2625 0.025 0.0 0.0 0.0 98-99 0.375 0.025 0.0 0.0 0.0 100-101 0.475 0.025 0.0 0.0 0.0 102-103 0.5625 0.025 0.0 0.0 0.0 104-105 0.6875 0.025 0.0 0.0 0.0 106-107 0.8125 0.025 0.0 0.0 0.0 108-109 0.875 0.025 0.0 0.0 0.0 110-111 0.9875 0.025 0.0 0.0 0.0 112-113 1.0375 0.025 0.0 0.0 0.0 114-115 1.1 0.025 0.0 0.0 0.0 116-117 1.2625 0.025 0.0 0.0 0.0 118-119 1.55 0.025 0.0 0.0 0.0 120-121 1.75 0.025 0.0 0.0 0.0 122-123 1.9375 0.025 0.0 0.0 0.0 124-125 2.35 0.025 0.0 0.0 0.0 126-127 2.6875 0.025 0.0 0.0 0.0 128-129 2.925 0.025 0.0 0.0 0.0 130-131 3.1500000000000004 0.025 0.0 0.0 0.0 132-133 3.6125 0.025 0.0 0.0 0.0 134-135 3.9375 0.025 0.0 0.0 0.0 136-137 4.3875 0.025 0.0 0.0 0.0 138-139 4.7375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCCTT 10 0.00686971 144.72499 145 TAAGCTC 10 0.00686971 144.72499 8 >>END_MODULE SRR7180104 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180104_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88675 34.0 33.0 34.0 32.0 34.0 2 32.91275 34.0 33.0 34.0 32.0 34.0 3 32.935 34.0 33.0 34.0 33.0 34.0 4 32.96325 34.0 33.0 34.0 33.0 34.0 5 32.99625 34.0 33.0 34.0 33.0 34.0 6 37.09825 38.0 38.0 38.0 37.0 38.0 7 37.0515 38.0 38.0 38.0 38.0 38.0 8 37.16675 38.0 38.0 38.0 38.0 38.0 9 36.934 38.0 38.0 38.0 37.0 38.0 10-14 36.95625 38.0 38.0 38.0 37.0 38.0 15-19 37.19355 38.0 38.0 38.0 37.2 38.0 20-24 37.17145 38.0 38.0 38.0 37.2 38.0 25-29 37.2133 38.0 38.0 38.0 37.6 38.0 30-34 37.232600000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.16845 38.0 38.0 38.0 37.2 38.0 40-44 37.10095 38.0 38.0 38.0 37.0 38.0 45-49 37.16315 38.0 38.0 38.0 37.0 38.0 50-54 37.11405 38.0 38.0 38.0 37.0 38.0 55-59 37.081250000000004 38.0 38.0 38.0 37.0 38.0 60-64 36.9548 38.0 38.0 38.0 36.4 38.0 65-69 36.895050000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.93915 38.0 38.0 38.0 36.0 38.0 75-79 36.86075 38.0 38.0 38.0 36.0 38.0 80-84 36.74645 38.0 38.0 38.0 35.8 38.0 85-89 36.67685 38.0 38.0 38.0 35.4 38.0 90-94 36.621750000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.40085 38.0 38.0 38.0 34.2 38.0 100-104 36.31115 38.0 38.0 38.0 34.0 38.0 105-109 36.25535 38.0 38.0 38.0 34.2 38.0 110-114 35.96565 38.0 37.8 38.0 33.2 38.0 115-119 35.852850000000004 38.0 37.0 38.0 32.6 38.0 120-124 35.694 38.0 36.8 38.0 32.2 38.0 125-129 35.3799 38.0 36.0 38.0 30.4 38.0 130-134 35.2265 38.0 36.2 38.0 30.4 38.0 135-139 34.592600000000004 38.0 35.2 38.0 26.8 38.0 140-144 34.18015 38.0 33.8 38.0 25.0 38.0 145-149 33.4229 38.0 33.0 38.0 20.6 38.0 150-151 28.269 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 1.0 5 5.0 6 0.0 7 2.0 8 1.0 9 1.0 10 1.0 11 3.0 12 0.0 13 1.0 14 6.0 15 2.0 16 4.0 17 2.0 18 1.0 19 8.0 20 5.0 21 5.0 22 7.0 23 12.0 24 4.0 25 11.0 26 13.0 27 24.0 28 16.0 29 18.0 30 50.0 31 54.0 32 64.0 33 100.0 34 149.0 35 246.0 36 611.0 37 2561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.99672296445677 16.964960927653138 17.393496344844973 26.644819763045124 2 24.099722991689752 23.671619239486276 34.726769075799545 17.50188869302443 3 20.986411675893308 27.12632108706593 31.07700050327126 20.810266733769502 4 24.395770392749245 33.76132930513595 22.356495468277945 19.486404833836858 5 23.313192346424973 36.48036253776435 23.136958710976838 17.069486404833835 6 18.275515334338863 37.05379587732529 24.509803921568626 20.16088486676722 7 18.742138364779873 17.58490566037736 42.716981132075475 20.955974842767294 8 20.5889755852001 22.85426629750818 27.98892524540649 28.567832871885223 9 21.24117053481332 26.538849646821394 28.304742684157418 23.91523713420787 10-14 23.61391129032258 28.170362903225804 26.224798387096776 21.99092741935484 15-19 22.927292729272928 28.107810781078108 27.17271727172717 21.79217921792179 20-24 22.825 28.804999999999996 26.8 21.57 25-29 23.28 28.455000000000002 27.38 20.885 30-34 22.939999999999998 28.305000000000003 27.21 21.545 35-39 23.080000000000002 28.265 27.55 21.105 40-44 22.79 28.23 27.860000000000003 21.12 45-49 22.84 27.96 28.199999999999996 21.0 50-54 22.84 28.68 27.169999999999998 21.310000000000002 55-59 23.995 27.134999999999998 27.485 21.385 60-64 23.16 28.325 27.62 20.895 65-69 23.635 28.485 27.634999999999998 20.244999999999997 70-74 23.26 28.525 27.534999999999997 20.68 75-79 24.271213560678035 28.07140357017851 27.05635281764088 20.601030051502576 80-84 23.85454181672669 28.38135254101641 27.40096038415366 20.36314525810324 85-89 23.999799959992 27.635527105421083 27.68553710742148 20.67913582716543 90-94 23.53 28.475 27.42 20.575 95-99 23.9 27.939999999999998 27.675 20.485 100-104 23.745 27.939999999999998 27.48 20.835 105-109 23.915 28.360000000000003 27.405 20.32 110-114 23.645 28.13 27.875 20.349999999999998 115-119 24.345 28.610000000000003 27.224999999999998 19.82 120-124 24.115000000000002 27.925 28.17 19.79 125-129 24.365000000000002 28.32 27.36 19.955000000000002 130-134 24.404999999999998 27.905 27.634999999999998 20.055 135-139 24.755 27.88 26.935 20.43 140-144 24.47 28.535 26.905 20.09 145-149 24.95 28.115000000000002 27.389999999999997 19.545 150-151 25.912499999999998 27.474999999999998 27.025 19.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.5 25 2.5 26 3.5 27 2.5 28 1.5 29 4.5 30 7.0 31 11.5 32 17.0 33 22.5 34 36.0 35 51.5 36 63.5 37 87.5 38 132.5 39 165.5 40 200.0 41 233.5 42 274.5 43 286.5 44 280.5 45 307.5 46 300.0 47 267.0 48 249.0 49 228.0 50 190.0 51 149.5 52 107.5 53 75.0 54 57.5 55 44.0 56 36.0 57 28.0 58 19.0 59 15.5 60 9.0 61 5.0 62 4.0 63 3.0 64 3.0 65 2.0 66 1.5 67 1.5 68 1.0 69 1.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.7250000000000001 3 0.65 4 0.7000000000000001 5 0.7000000000000001 6 0.5499999999999999 7 0.625 8 0.675 9 0.8999999999999999 10-14 0.8 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.04 85-89 0.02 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.3265511178095956 0.65 3 0.07535795026375283 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 2.9625 0.0 0.0 0.0 0.0 130-131 3.2 0.0 0.0 0.0 0.0 132-133 3.6375 0.0 0.0 0.0 0.0 134-135 3.9875 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669375 spots for SRR7180104.sra Written 669375 spots for SRR7180104.sra Read 669390 spots for SRR7180104.sra Written 669390 spots for SRR7180104.sra SRR ids: ['SRR7180104.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j2ixry5y SRR7180104.sra spots: 13387515 blocks: [[1, 669375], [669376, 1338750], [1338751, 2008125], [2008126, 2677500], [2677501, 3346875], [3346876, 4016250], [4016251, 4685625], [4685626, 5355000], [5355001, 6024375], [6024376, 6693750], [6693751, 7363125], [7363126, 8032500], [8032501, 8701875], [8701876, 9371250], [9371251, 10040625], [10040626, 10710000], [10710001, 11379375], [11379376, 12048750], [12048751, 12718125], [12718126, 13387515]] SRR7180104 file size 4514889 SRR7180104 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180104 SRR7180104_1.fastq SRR7180104_2.fastq Input file: SRR7180104_1.fastq Paired file: SRR7180104_2.fastq trimmed: SRR7180104-trimmed-pair1.fastq, SRR7180104-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:13:42 2025 >> started Mon Feb 10 19:13:57 2025 >> done (14.589s) 13387515 read pairs processed; of these: 13809 ( 0.10%) short read pairs filtered out after trimming by size control 8756 ( 0.07%) empty read pairs filtered out after trimming by size control 13364950 (99.83%) read pairs available; of these: 6590145 (49.31%) trimmed read pairs available after processing 6774805 (50.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 4 0.00% 22 5 0.00% 23 3 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 1 0.00% 29 3 0.00% 30 1 0.00% 31 4 0.00% 32 2 0.00% 33 0 0.00% 34 2 0.00% 35 4 0.00% 36 4 0.00% 37 1 0.00% 38 5 0.00% 39 5 0.00% 40 5 0.00% 41 7 0.00% 42 6 0.00% 43 7 0.00% 44 4 0.00% 45 3 0.00% 46 7 0.00% 47 6 0.00% 48 6 0.00% 49 7 0.00% 50 16 0.00% 51 13 0.00% 52 22 0.00% 53 22 0.00% 54 29 0.00% 55 18 0.00% 56 28 0.00% 57 38 0.00% 58 35 0.00% 59 49 0.00% 60 67 0.00% 61 57 0.00% 62 66 0.00% 63 81 0.00% 64 103 0.00% 65 108 0.00% 66 130 0.00% 67 148 0.00% 68 158 0.00% 69 170 0.00% 70 214 0.00% 71 220 0.00% 72 279 0.00% 73 296 0.00% 74 342 0.00% 75 425 0.00% 76 460 0.00% 77 535 0.00% 78 656 0.00% 79 681 0.01% 80 832 0.01% 81 896 0.01% 82 1049 0.01% 83 1210 0.01% 84 1985 0.01% 85 2483 0.02% 86 2625 0.02% 87 2799 0.02% 88 2929 0.02% 89 3015 0.02% 90 3259 0.02% 91 3384 0.03% 92 3851 0.03% 93 4079 0.03% 94 4516 0.03% 95 4772 0.04% 96 5035 0.04% 97 5604 0.04% 98 5666 0.04% 99 6278 0.05% 100 6566 0.05% 101 7058 0.05% 102 7418 0.06% 103 7952 0.06% 104 8607 0.06% 105 9078 0.07% 106 9864 0.07% 107 10376 0.08% 108 11009 0.08% 109 11555 0.09% 110 12310 0.09% 111 12595 0.09% 112 13521 0.10% 113 14396 0.11% 114 15067 0.11% 115 16218 0.12% 116 16707 0.13% 117 17861 0.13% 118 18727 0.14% 119 19452 0.15% 120 20438 0.15% 121 21523 0.16% 122 22648 0.17% 123 23692 0.18% 124 24919 0.19% 125 26021 0.19% 126 27778 0.21% 127 28868 0.22% 128 30138 0.23% 129 32030 0.24% 130 33721 0.25% 131 35193 0.26% 132 37131 0.28% 133 40130 0.30% 134 42561 0.32% 135 45358 0.34% 136 47513 0.36% 137 50952 0.38% 138 55205 0.41% 139 60734 0.45% 140 66531 0.50% 141 73469 0.55% 142 81666 0.61% 143 92990 0.70% 144 109327 0.82% 145 131661 0.99% 146 170443 1.28% 147 261380 1.96% 148 403681 3.02% 149 714095 5.34% 150 3460161 25.89% 151 6774805 50.69% 13364950 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=29 prefix-density=0.61 prefix-fanout=2.8 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=27 fanout-score=21.07 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=7.1 sequence=AGCACCAAGTGGAGGGTGGACTCCTTCTGGAT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=32 prefix-density=0.89 prefix-fanout=1.1 sequence=AGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.18 sequence-density-rank=20 fanout-score=14.49 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=7.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7180104 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:14:54 Started mapping on | Feb 10 19:14:54 Finished on | Feb 10 19:16:58 Mapping speed, Million of reads per hour | 388.01 Number of input reads | 13364950 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12346171 Uniquely mapped reads % | 92.38% Average mapped length | 295.34 Number of splices: Total | 12515643 Number of splices: Annotated (sjdb) | 12283193 Number of splices: GT/AG | 12320340 Number of splices: GC/AG | 156197 Number of splices: AT/AC | 9744 Number of splices: Non-canonical | 29362 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317027 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 24228 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.00% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 715460 715460 715460 N_multimapping 317027 317027 317027 N_noFeature 294011 12213058 364439 N_ambiguous 123028 619 59953 UnstrandedReadsAssigned:11929132 PositiveStrandReadsAssigned:132494 NegativeStrandReadsAssigned:11921779 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180104 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180104-trimmed-pair1.fastq SRR7180104-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,364,950 reads, 11,839,660 reads pseudoaligned [quant] estimated average fragment length: 244.225 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR7180104.ke.tsv 34699 SRR7180104.se.tsv 87100 total ==> SRR7180104.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.78 1031 45.9516 Potri.005G024800.1.v4.1 1035 791.775 314 31.3699 Potri.004G059700.1.v4.1 961 717.792 34 3.74685 Potri.007G009000.2.v4.1 1416 1172.78 0 0 Potri.003G141000.2.v4.1 2943 2699.78 533 15.6165 Potri.016G087400.1.v4.1 270 75.9544 879 915.422 Potri.015G069301.1.v4.1 564 324.117 0 0 Potri.010G195200.1.v4.1 1773 1529.78 294 15.2021 Potri.012G127500.1.v4.1 977 733.792 3905 420.953 ==> SRR7180104.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 52 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 252 SRR7180104 completed mapping pipeline successfully