Starting /dee2/code/volunteer_pipeline.sh SRR7180105 current disk space = 3057020436480 free memory = 1338311552 SRR7180105 SRAfilesize 2b23850e5bec431d05d593e950f8b7f7 SRR7180105.sra SRR7180105.sra file validated SRR7180105 is paired end SRR7180105 is conventional basespace SRR7180105 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180105_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.614 32.0 18.0 33.0 18.0 33.0 2 29.32225 32.0 27.0 33.0 18.0 34.0 3 30.76675 31.0 29.0 33.0 27.0 33.0 4 30.72575 32.0 31.0 33.0 25.0 33.0 5 32.02375 33.0 32.0 33.0 31.0 33.0 6 36.12275 38.0 36.0 38.0 33.0 38.0 7 37.095 38.0 38.0 38.0 35.0 38.0 8 37.3335 38.0 38.0 38.0 36.0 38.0 9 37.495 38.0 38.0 38.0 37.0 38.0 10-14 37.580200000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.5886 38.0 38.0 38.0 38.0 38.0 20-24 37.5526 38.0 38.0 38.0 38.0 38.0 25-29 37.61135 38.0 38.0 38.0 38.0 38.0 30-34 37.58385 38.0 38.0 38.0 38.0 38.0 35-39 37.553650000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.55615 38.0 38.0 38.0 38.0 38.0 45-49 37.511 38.0 38.0 38.0 38.0 38.0 50-54 37.45065000000001 38.0 38.0 38.0 37.4 38.0 55-59 37.3314 38.0 38.0 38.0 37.0 38.0 60-64 37.33635 38.0 38.0 38.0 37.0 38.0 65-69 36.960899999999995 38.0 38.0 38.0 36.2 38.0 70-74 36.93195 38.0 38.0 38.0 36.0 38.0 75-79 37.0409 38.0 38.0 38.0 36.0 38.0 80-84 37.048950000000005 38.0 38.0 38.0 36.0 38.0 85-89 37.0627 38.0 38.0 38.0 36.0 38.0 90-94 36.924899999999994 38.0 38.0 38.0 35.6 38.0 95-99 36.75775 38.0 38.0 38.0 35.0 38.0 100-104 36.524449999999995 38.0 38.0 38.0 34.2 38.0 105-109 36.49660000000001 38.0 38.0 38.0 34.2 38.0 110-114 36.209050000000005 38.0 37.6 38.0 33.6 38.0 115-119 36.0555 38.0 37.2 38.0 33.0 38.0 120-124 35.9037 38.0 37.0 38.0 32.2 38.0 125-129 35.646249999999995 38.0 36.2 38.0 31.0 38.0 130-134 35.3702 38.0 36.0 38.0 29.8 38.0 135-139 35.0127 38.0 35.0 38.0 28.8 38.0 140-144 34.569900000000004 38.0 34.6 38.0 27.0 38.0 145-149 33.2761 38.0 33.8 38.0 17.8 38.0 150-151 28.559375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 2.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 3.0 20 1.0 21 2.0 22 3.0 23 3.0 24 5.0 25 11.0 26 14.0 27 18.0 28 18.0 29 23.0 30 36.0 31 42.0 32 67.0 33 119.0 34 174.0 35 321.0 36 884.0 37 2247.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.48248248248248 15.39039039039039 12.737737737737737 39.38938938938939 2 18.3 21.25 33.625 26.825 3 20.275000000000002 23.125 26.150000000000002 30.45 4 23.65 27.750000000000004 23.724999999999998 24.875 5 22.325 32.6 23.599999999999998 21.475 6 18.6 35.05 25.775 20.575 7 14.374999999999998 24.125 43.375 18.125 8 18.05 24.625 30.825000000000003 26.5 9 17.599999999999998 23.400000000000002 33.825 25.174999999999997 10-14 19.785 29.21 27.355 23.65 15-19 19.98 28.310000000000002 27.825 23.885 20-24 19.59489872468117 28.67716929232308 27.991997999499873 23.735933983495876 25-29 20.105 28.83 27.755000000000003 23.31 30-34 19.39 28.7 28.355000000000004 23.555 35-39 19.545 28.125 27.74 24.59 40-44 19.765 27.735 28.705000000000002 23.794999999999998 45-49 20.105 27.915 27.77 24.21 50-54 19.925 28.16 28.285 23.630000000000003 55-59 20.06 27.555000000000003 28.63 23.755000000000003 60-64 20.612214274996248 27.769719401790628 27.949782423848347 23.668283899364777 65-69 19.942459115687463 28.195033313143547 28.58873410054513 23.273773470623865 70-74 19.956670697299476 27.53929866989117 28.073357517130187 24.43067311567916 75-79 20.71 27.634999999999998 27.595 24.060000000000002 80-84 20.41 27.82 27.805000000000003 23.965 85-89 20.54 27.77 27.82 23.87 90-94 20.26 27.310000000000002 28.13 24.3 95-99 20.735 27.46 28.175 23.630000000000003 100-104 20.491147344203263 27.72331699509853 27.848354506351907 23.937181154346305 105-109 20.794999999999998 27.215 28.08 23.91 110-114 20.76849952469105 27.587932155901335 27.973182568669635 23.670385750737978 115-119 20.985 27.975 27.275 23.765 120-124 20.555 27.83 27.235 24.38 125-129 20.974999999999998 27.92 27.18 23.925 130-134 20.575 27.805000000000003 27.21 24.41 135-139 20.645 28.285 26.845000000000002 24.224999999999998 140-144 20.560000000000002 27.665 27.32 24.455 145-149 20.885 27.634999999999998 26.974999999999998 24.505 150-151 20.549999999999997 27.325 26.787499999999998 25.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 3.5 25 6.0 26 5.0 27 7.5 28 10.5 29 16.0 30 20.5 31 26.0 32 34.5 33 36.5 34 51.5 35 67.0 36 76.5 37 89.5 38 118.5 39 167.0 40 202.5 41 218.5 42 245.5 43 269.0 44 273.0 45 284.5 46 281.5 47 253.0 48 229.5 49 196.0 50 164.0 51 151.0 52 127.5 53 99.0 54 67.0 55 40.0 56 34.0 57 30.5 58 22.5 59 19.5 60 15.0 61 12.5 62 9.0 63 3.5 64 2.5 65 2.0 66 1.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.025 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.034999999999999996 65-69 0.9400000000000001 70-74 0.76 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.065 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.4 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 3.0374999999999996 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 3.8625 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.7625 0.0 0.0 0.0 0.0 126-127 5.2875 0.0 0.0 0.0 0.0 128-129 5.8875 0.0 0.0 0.0 0.0 130-131 6.574999999999999 0.0 0.0 0.0 0.0 132-133 7.225 0.0 0.0 0.0 0.0 134-135 8.0125 0.0 0.0 0.0 0.0 136-137 8.662500000000001 0.0 0.0 0.0 0.0 138-139 9.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAATA 10 0.0068555363 144.825 6 TCATTGG 10 0.0068555363 144.825 9 GTAGTTT 10 0.0068555363 144.825 7 >>END_MODULE SRR7180105 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180105_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82475 34.0 33.0 34.0 32.0 34.0 2 32.9295 34.0 33.0 34.0 32.0 34.0 3 32.93625 34.0 33.0 34.0 33.0 34.0 4 32.941 34.0 33.0 34.0 33.0 34.0 5 32.883 34.0 33.0 34.0 33.0 34.0 6 36.9915 38.0 38.0 38.0 38.0 38.0 7 36.9925 38.0 38.0 38.0 38.0 38.0 8 36.98125 38.0 38.0 38.0 37.0 38.0 9 36.93125 38.0 38.0 38.0 38.0 38.0 10-14 36.87425 38.0 38.0 38.0 37.2 38.0 15-19 37.120850000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.10415 38.0 38.0 38.0 37.2 38.0 25-29 37.15795000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.15585 38.0 38.0 38.0 37.8 38.0 35-39 37.11465 38.0 38.0 38.0 37.0 38.0 40-44 37.0452 38.0 38.0 38.0 37.0 38.0 45-49 37.0595 38.0 38.0 38.0 37.0 38.0 50-54 37.020050000000005 38.0 38.0 38.0 37.0 38.0 55-59 36.942899999999995 38.0 38.0 38.0 36.8 38.0 60-64 36.8486 38.0 38.0 38.0 36.4 38.0 65-69 36.71445000000001 38.0 38.0 38.0 35.8 38.0 70-74 36.811550000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.7357 38.0 38.0 38.0 36.0 38.0 80-84 36.6614 38.0 38.0 38.0 36.0 38.0 85-89 36.5421 38.0 38.0 38.0 35.2 38.0 90-94 36.45295 38.0 38.0 38.0 35.0 38.0 95-99 36.3206 38.0 38.0 38.0 34.4 38.0 100-104 36.17569999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.183 38.0 38.0 38.0 34.0 38.0 110-114 35.8697 38.0 37.8 38.0 33.4 38.0 115-119 35.72155000000001 38.0 37.6 38.0 32.6 38.0 120-124 35.5527 38.0 37.2 38.0 31.8 38.0 125-129 35.2602 38.0 36.4 38.0 31.0 38.0 130-134 34.924850000000006 38.0 36.0 38.0 28.4 38.0 135-139 34.28935 38.0 34.6 38.0 25.2 38.0 140-144 33.9259 38.0 33.6 38.0 23.6 38.0 145-149 33.1659 38.0 33.0 38.0 16.8 38.0 150-151 28.055875 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 10.0 4 6.0 5 2.0 6 0.0 7 1.0 8 2.0 9 1.0 10 2.0 11 0.0 12 2.0 13 3.0 14 8.0 15 1.0 16 2.0 17 4.0 18 5.0 19 5.0 20 4.0 21 11.0 22 4.0 23 7.0 24 18.0 25 12.0 26 11.0 27 11.0 28 21.0 29 22.0 30 34.0 31 53.0 32 67.0 33 109.0 34 138.0 35 237.0 36 614.0 37 2560.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.739843552863995 17.764319959626544 19.60635881907646 25.889477668433003 2 24.250063019914293 24.401310814217293 33.55180236954878 17.796823796319636 3 21.496975806451612 26.83971774193548 30.997983870967744 20.665322580645164 4 24.250063019914293 33.82908999243761 22.586337282581294 19.3345097050668 5 23.695487774136627 37.433829089992436 22.485505419712627 16.385177716158307 6 19.536757301107755 36.958710976837864 25.0 18.50453172205438 7 20.105820105820104 18.594104308390023 41.8493323255228 19.45074326026707 8 22.001008064516128 23.160282258064516 27.746975806451612 27.091733870967744 9 22.645796516031304 26.07927291088109 28.932087856601868 22.342842716485737 10-14 24.557332391666247 28.542602027947332 25.561216768400342 21.33884881198608 15-19 23.643546531979798 29.324398659798973 27.139070860629094 19.89298394759214 20-24 24.04 29.025000000000002 26.845000000000002 20.09 25-29 23.7 28.005000000000003 27.474999999999998 20.82 30-34 23.544999999999998 28.345 27.47 20.64 35-39 23.119999999999997 28.384999999999998 27.060000000000002 21.435000000000002 40-44 23.97 28.235 26.955000000000002 20.84 45-49 24.325 28.549999999999997 26.68 20.445 50-54 23.494999999999997 28.410000000000004 27.250000000000004 20.845 55-59 23.625 28.349999999999998 27.060000000000002 20.965 60-64 23.815 28.235 27.435 20.515 65-69 24.02 28.475 27.24 20.265 70-74 24.435000000000002 28.735 26.605 20.225 75-79 24.24121206060303 28.346417320866042 26.96634831741587 20.446022301115054 80-84 23.84192096048024 27.958979489744873 27.35367683841921 20.845422711355678 85-89 24.006001500375092 28.347086771692926 27.191797949487373 20.455113778444613 90-94 24.12 27.779999999999998 27.694999999999997 20.405 95-99 24.23 28.410000000000004 27.175 20.185 100-104 24.52 28.375 26.97 20.135 105-109 24.060000000000002 27.965 27.439999999999998 20.535 110-114 24.395 28.29 27.13 20.185 115-119 24.42 27.935 27.284999999999997 20.36 120-124 24.310000000000002 28.27 27.37 20.05 125-129 24.685000000000002 28.315 27.215 19.785 130-134 25.275 28.275 26.96 19.49 135-139 25.135 28.73 26.314999999999998 19.82 140-144 25.435000000000002 27.860000000000003 27.01 19.695 145-149 26.05 27.555000000000003 26.915 19.48 150-151 25.124999999999996 27.825 26.450000000000003 20.599999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.0 24 0.5 25 1.0 26 3.0 27 5.0 28 6.5 29 9.0 30 11.5 31 13.5 32 20.5 33 25.5 34 35.5 35 54.5 36 75.0 37 111.0 38 139.5 39 159.0 40 178.0 41 215.0 42 265.0 43 286.5 44 293.0 45 275.5 46 272.5 47 259.0 48 230.0 49 202.5 50 165.5 51 154.5 52 127.0 53 93.0 54 68.0 55 53.0 56 46.5 57 36.0 58 27.0 59 19.0 60 14.0 61 10.0 62 7.5 63 5.5 64 5.5 65 5.0 66 2.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.8250000000000001 3 0.8 4 0.8250000000000001 5 0.8250000000000001 6 0.7000000000000001 7 0.775 8 0.8 9 0.975 10-14 0.885 15-19 0.015 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.05 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.4278882456581928 0.8500000000000001 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0125 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0125 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.07500000000000001 0.0 0.0 0.025 0.0 82-83 0.1125 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.25 0.0 0.0 0.025 0.0 88-89 0.3375 0.0 0.0 0.025 0.0 90-91 0.3875 0.0 0.0 0.025 0.0 92-93 0.475 0.0 0.0 0.025 0.0 94-95 0.5625 0.0 0.0 0.025 0.0 96-97 0.6 0.0 0.0 0.025 0.0 98-99 0.8 0.0 0.0 0.025 0.0 100-101 0.975 0.0 0.0 0.025 0.0 102-103 1.1375000000000002 0.0 0.0 0.025 0.0 104-105 1.2999999999999998 0.0 0.0 0.025 0.0 106-107 1.625 0.0 0.0 0.025 0.0 108-109 1.8875 0.0 0.0 0.025 0.0 110-111 2.2375 0.0 0.0 0.025 0.0 112-113 2.5125 0.0 0.0 0.025 0.0 114-115 2.7875 0.0 0.0 0.025 0.0 116-117 3.125 0.0 0.0 0.025 0.0 118-119 3.7 0.0 0.0 0.025 0.0 120-121 3.9875 0.0 0.0 0.025 0.0 122-123 4.4 0.0 0.0 0.025 0.0 124-125 4.9375 0.0 0.0 0.025 0.0 126-127 5.4625 0.0 0.0 0.025 0.0 128-129 6.0125 0.0 0.0 0.025 0.0 130-131 6.699999999999999 0.0 0.0 0.025 0.0 132-133 7.300000000000001 0.0 0.0 0.025 0.0 134-135 8.1 0.0 0.0 0.025 0.0 136-137 8.7375 0.0 0.0 0.025 0.0 138-139 9.325 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTAAT 10 0.006597606 146.67088 6 CTTGCAG 10 0.006597606 146.67088 1 AGTCTTG 10 0.0068537686 144.8375 145 >>END_MODULE Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra Read 619765 spots for SRR7180105.sra Written 619765 spots for SRR7180105.sra SRR ids: ['SRR7180105.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eoy15xc6 SRR7180105.sra spots: 12395300 blocks: [[1, 619765], [619766, 1239530], [1239531, 1859295], [1859296, 2479060], [2479061, 3098825], [3098826, 3718590], [3718591, 4338355], [4338356, 4958120], [4958121, 5577885], [5577886, 6197650], [6197651, 6817415], [6817416, 7437180], [7437181, 8056945], [8056946, 8676710], [8676711, 9296475], [9296476, 9916240], [9916241, 10536005], [10536006, 11155770], [11155771, 11775535], [11775536, 12395300]] SRR7180105 file size 4178660 SRR7180105 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180105 SRR7180105_1.fastq SRR7180105_2.fastq Input file: SRR7180105_1.fastq Paired file: SRR7180105_2.fastq trimmed: SRR7180105-trimmed-pair1.fastq, SRR7180105-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:09:59 2025 >> started Mon Feb 10 19:10:14 2025 >> done (14.049s) 12395300 read pairs processed; of these: 19944 ( 0.16%) short read pairs filtered out after trimming by size control 18938 ( 0.15%) empty read pairs filtered out after trimming by size control 12356418 (99.69%) read pairs available; of these: 6566504 (53.14%) trimmed read pairs available after processing 5789914 (46.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 4 0.00% 23 4 0.00% 24 3 0.00% 25 2 0.00% 26 5 0.00% 27 2 0.00% 28 4 0.00% 29 5 0.00% 30 1 0.00% 31 2 0.00% 32 5 0.00% 33 0 0.00% 34 3 0.00% 35 2 0.00% 36 9 0.00% 37 5 0.00% 38 6 0.00% 39 3 0.00% 40 6 0.00% 41 10 0.00% 42 4 0.00% 43 9 0.00% 44 9 0.00% 45 9 0.00% 46 14 0.00% 47 7 0.00% 48 21 0.00% 49 23 0.00% 50 23 0.00% 51 20 0.00% 52 28 0.00% 53 39 0.00% 54 40 0.00% 55 45 0.00% 56 52 0.00% 57 62 0.00% 58 77 0.00% 59 67 0.00% 60 99 0.00% 61 125 0.00% 62 125 0.00% 63 143 0.00% 64 179 0.00% 65 203 0.00% 66 238 0.00% 67 305 0.00% 68 329 0.00% 69 385 0.00% 70 412 0.00% 71 483 0.00% 72 616 0.00% 73 714 0.01% 74 838 0.01% 75 947 0.01% 76 1126 0.01% 77 1249 0.01% 78 1432 0.01% 79 1587 0.01% 80 1899 0.02% 81 2108 0.02% 82 2377 0.02% 83 2770 0.02% 84 3977 0.03% 85 4921 0.04% 86 5239 0.04% 87 5806 0.05% 88 6200 0.05% 89 6556 0.05% 90 7011 0.06% 91 7405 0.06% 92 8145 0.07% 93 8676 0.07% 94 9531 0.08% 95 10108 0.08% 96 10900 0.09% 97 11701 0.09% 98 12499 0.10% 99 13348 0.11% 100 14052 0.11% 101 14925 0.12% 102 15915 0.13% 103 16579 0.13% 104 17752 0.14% 105 19040 0.15% 106 19815 0.16% 107 21350 0.17% 108 22532 0.18% 109 23478 0.19% 110 24545 0.20% 111 25810 0.21% 112 26781 0.22% 113 27642 0.22% 114 29004 0.23% 115 30149 0.24% 116 31443 0.25% 117 32751 0.27% 118 33762 0.27% 119 35294 0.29% 120 36835 0.30% 121 38006 0.31% 122 39644 0.32% 123 40462 0.33% 124 42106 0.34% 125 42978 0.35% 126 44738 0.36% 127 46206 0.37% 128 47661 0.39% 129 49073 0.40% 130 50873 0.41% 131 53081 0.43% 132 54482 0.44% 133 57482 0.47% 134 59081 0.48% 135 61306 0.50% 136 63786 0.52% 137 66533 0.54% 138 69027 0.56% 139 73614 0.60% 140 77197 0.62% 141 84029 0.68% 142 90810 0.73% 143 100343 0.81% 144 113403 0.92% 145 130416 1.06% 146 161111 1.30% 147 233159 1.89% 148 352277 2.85% 149 603631 4.89% 150 2947179 23.85% 151 5789914 46.86% 12356418 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=29 prefix-density=0.71 prefix-fanout=2.5 sequence=CCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=27.46 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=4.2 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=32 prefix-density=0.94 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=28 fanout-score=30.88 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=10.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7180105 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:11:12 Started mapping on | Feb 10 19:11:12 Finished on | Feb 10 19:13:10 Mapping speed, Million of reads per hour | 376.98 Number of input reads | 12356418 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11531514 Uniquely mapped reads % | 93.32% Average mapped length | 291.55 Number of splices: Total | 10818535 Number of splices: Annotated (sjdb) | 10590409 Number of splices: GT/AG | 10642499 Number of splices: GC/AG | 135504 Number of splices: AT/AC | 8861 Number of splices: Non-canonical | 31671 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269884 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 43878 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.02% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 571083 571083 571083 N_multimapping 269884 269884 269884 N_noFeature 328274 11415562 386001 N_ambiguous 119129 597 60573 UnstrandedReadsAssigned:11084111 PositiveStrandReadsAssigned:115355 NegativeStrandReadsAssigned:11084940 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7180105 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180105-trimmed-pair1.fastq SRR7180105-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,356,418 reads, 10,993,269 reads pseudoaligned [quant] estimated average fragment length: 218.215 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7180105.ke.tsv 34699 SRR7180105.se.tsv 87100 total ==> SRR7180105.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.79 1346 62.1943 Potri.005G024800.1.v4.1 1035 817.785 368 37.4434 Potri.004G059700.1.v4.1 961 743.795 6 0.671221 Potri.007G009000.2.v4.1 1416 1198.79 0 0 Potri.003G141000.2.v4.1 2943 2725.79 674.315 20.5844 Potri.016G087400.1.v4.1 270 88.1398 768 725.031 Potri.015G069301.1.v4.1 564 348.488 0 0 Potri.010G195200.1.v4.1 1773 1555.79 426 22.7839 Potri.012G127500.1.v4.1 977 759.785 11702 1281.55 ==> SRR7180105.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 66 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 354 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 343 SRR7180105 completed mapping pipeline successfully