Starting /dee2/code/volunteer_pipeline.sh SRR7180106 current disk space = 3056554340352 free memory = 1138126232 SRR7180106 SRAfilesize 6a26df1023adf4c298ce761801e8b01b SRR7180106.sra SRR7180106.sra file validated SRR7180106 is paired end SRR7180106 is conventional basespace SRR7180106 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180106_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69075 33.0 33.0 34.0 32.0 34.0 2 33.09375 34.0 33.0 34.0 32.0 34.0 3 33.168 34.0 33.0 34.0 32.0 34.0 4 32.854 33.0 33.0 34.0 32.0 34.0 5 33.332 34.0 33.0 34.0 33.0 34.0 6 37.3095 38.0 38.0 38.0 36.0 38.0 7 37.5215 38.0 38.0 38.0 37.0 38.0 8 37.597 38.0 38.0 38.0 37.0 38.0 9 37.691 38.0 38.0 38.0 38.0 38.0 10-14 37.69855 38.0 38.0 38.0 38.0 38.0 15-19 37.66759999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.668400000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.653749999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.5972 38.0 38.0 38.0 38.0 38.0 35-39 37.59805 38.0 38.0 38.0 38.0 38.0 40-44 37.54565 38.0 38.0 38.0 38.0 38.0 45-49 37.50260000000001 38.0 38.0 38.0 37.8 38.0 50-54 37.48405 38.0 38.0 38.0 37.6 38.0 55-59 37.4289 38.0 38.0 38.0 37.0 38.0 60-64 37.4055 38.0 38.0 38.0 37.0 38.0 65-69 37.39755 38.0 38.0 38.0 37.0 38.0 70-74 37.311049999999994 38.0 38.0 38.0 37.0 38.0 75-79 37.292199999999994 38.0 38.0 38.0 37.0 38.0 80-84 37.215199999999996 38.0 38.0 38.0 36.8 38.0 85-89 37.18655 38.0 38.0 38.0 36.2 38.0 90-94 37.1409 38.0 38.0 38.0 36.0 38.0 95-99 37.0385 38.0 38.0 38.0 36.0 38.0 100-104 36.96225 38.0 38.0 38.0 36.0 38.0 105-109 36.78845 38.0 38.0 38.0 35.2 38.0 110-114 36.721450000000004 38.0 38.0 38.0 35.0 38.0 115-119 36.528800000000004 38.0 38.0 38.0 34.2 38.0 120-124 36.413250000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.302049999999994 38.0 38.0 38.0 34.0 38.0 130-134 36.050799999999995 38.0 37.4 38.0 33.2 38.0 135-139 35.9135 38.0 37.0 38.0 33.0 38.0 140-144 35.710950000000004 38.0 36.4 38.0 33.0 38.0 145-149 35.2539 38.0 36.0 38.0 31.0 38.0 150-151 32.255624999999995 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 1.0 17 2.0 18 0.0 19 2.0 20 3.0 21 3.0 22 6.0 23 3.0 24 2.0 25 4.0 26 10.0 27 5.0 28 16.0 29 21.0 30 22.0 31 30.0 32 43.0 33 83.0 34 99.0 35 176.0 36 467.0 37 2995.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.94968553459119 14.91090146750524 12.919287211740041 35.22012578616352 2 19.950000000000003 19.45 35.875 24.725 3 20.225 24.025 26.575 29.175 4 22.900000000000002 31.225 22.725 23.150000000000002 5 21.975 34.425 24.5 19.1 6 17.65 34.8 25.95 21.6 7 12.925 23.425 43.6 20.05 8 19.025 22.875 30.825000000000003 27.275 9 18.0 23.724999999999998 32.775 25.5 10-14 20.06 29.404999999999998 27.11 23.425 15-19 19.66 28.749999999999996 27.855 23.735 20-24 19.744999999999997 29.020000000000003 27.92 23.315 25-29 19.67 28.955 27.875 23.5 30-34 20.135 28.705000000000002 28.17 22.99 35-39 20.13 28.49 28.249999999999996 23.13 40-44 19.895 28.560000000000002 27.529999999999998 24.015 45-49 19.845 28.485 27.54 24.13 50-54 20.14 28.32 27.935 23.605 55-59 20.445 27.62 28.349999999999998 23.585 60-64 19.615 28.12 28.21 24.055 65-69 20.419999999999998 28.325 27.52 23.735 70-74 19.545 28.73 27.855 23.87 75-79 20.185 28.34 26.955000000000002 24.52 80-84 20.415 27.900000000000002 27.82 23.865 85-89 20.115 28.18 28.044999999999998 23.66 90-94 20.165 28.665000000000003 28.105000000000004 23.064999999999998 95-99 19.955000000000002 27.925 28.17 23.95 100-104 20.94 28.660000000000004 27.405 22.994999999999997 105-109 20.560000000000002 28.185 27.950000000000003 23.305 110-114 20.375 28.425 27.445000000000004 23.755000000000003 115-119 20.810000000000002 27.965 27.985 23.24 120-124 20.369999999999997 27.994999999999997 27.92 23.715 125-129 20.75 27.58 27.950000000000003 23.72 130-134 20.535 28.16 27.055 24.25 135-139 20.585 28.07 27.325 24.02 140-144 20.61 27.765 27.79 23.835 145-149 20.46 28.189999999999998 27.700000000000003 23.65 150-151 19.725 28.512500000000003 28.075 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 1.5 24 3.0 25 5.0 26 7.5 27 8.5 28 9.0 29 14.5 30 20.5 31 25.0 32 29.5 33 43.0 34 57.5 35 76.0 36 95.5 37 108.5 38 140.0 39 179.5 40 201.5 41 217.5 42 235.0 43 251.0 44 282.5 45 283.5 46 264.0 47 251.0 48 227.0 49 190.0 50 152.5 51 133.5 52 110.5 53 88.0 54 67.0 55 45.5 56 36.5 57 33.0 58 25.0 59 19.0 60 14.0 61 10.0 62 7.5 63 5.5 64 6.0 65 3.0 66 0.5 67 1.5 68 3.5 69 2.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19354838709677 98.4 2 0.8064516129032258 1.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.9125 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.1375000000000002 0.0 0.0 0.0 0.0 130-131 1.3 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.6749999999999998 0.0 0.0 0.0 0.0 136-137 1.875 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180106 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180106_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16325 34.0 33.0 34.0 33.0 34.0 2 33.11725 34.0 33.0 34.0 33.0 34.0 3 33.2085 34.0 33.0 34.0 33.0 34.0 4 33.17225 34.0 33.0 34.0 33.0 34.0 5 33.178 34.0 33.0 34.0 33.0 34.0 6 37.41525 38.0 38.0 38.0 38.0 38.0 7 37.36725 38.0 38.0 38.0 38.0 38.0 8 37.361 38.0 38.0 38.0 38.0 38.0 9 37.25575 38.0 38.0 38.0 37.0 38.0 10-14 37.291450000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.28535000000001 38.0 38.0 38.0 37.4 38.0 20-24 37.264799999999994 38.0 38.0 38.0 37.4 38.0 25-29 37.252950000000006 38.0 38.0 38.0 37.2 38.0 30-34 37.25155 38.0 38.0 38.0 37.0 38.0 35-39 37.2085 38.0 38.0 38.0 37.0 38.0 40-44 37.180949999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.1726 38.0 38.0 38.0 37.0 38.0 50-54 37.117399999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.120050000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.128 38.0 38.0 38.0 37.0 38.0 65-69 36.97515 38.0 38.0 38.0 36.0 38.0 70-74 36.958450000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.84310000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.83735 38.0 38.0 38.0 36.0 38.0 85-89 36.701049999999995 38.0 38.0 38.0 35.2 38.0 90-94 36.5361 38.0 38.0 38.0 34.8 38.0 95-99 36.45675000000001 38.0 38.0 38.0 34.4 38.0 100-104 36.27965 38.0 38.0 38.0 34.0 38.0 105-109 36.037850000000006 38.0 37.8 38.0 33.6 38.0 110-114 35.992399999999996 38.0 38.0 38.0 33.4 38.0 115-119 35.89685 38.0 37.2 38.0 33.0 38.0 120-124 35.644549999999995 38.0 37.0 38.0 31.2 38.0 125-129 35.4456 38.0 36.4 38.0 31.0 38.0 130-134 35.27185 38.0 36.0 38.0 30.2 38.0 135-139 35.02175 38.0 36.0 38.0 29.0 38.0 140-144 34.58675 38.0 35.2 38.0 27.6 38.0 145-149 34.142 38.0 35.0 38.0 25.6 38.0 150-151 30.257875 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 2.0 5 3.0 6 0.0 7 2.0 8 1.0 9 0.0 10 0.0 11 3.0 12 3.0 13 0.0 14 3.0 15 2.0 16 3.0 17 6.0 18 3.0 19 2.0 20 4.0 21 4.0 22 8.0 23 7.0 24 13.0 25 13.0 26 13.0 27 14.0 28 18.0 29 25.0 30 32.0 31 44.0 32 64.0 33 96.0 34 120.0 35 215.0 36 567.0 37 2699.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.2 16.975 16.725 26.1 2 24.55 22.875 35.125 17.45 3 21.325 27.625 29.675 21.375 4 25.05 33.650000000000006 23.525 17.775 5 25.1 35.375 23.025000000000002 16.5 6 18.5 36.95 24.675 19.875 7 19.325 19.175 39.475 22.025 8 21.25 24.075 26.5 28.175 9 22.375 24.975 28.625 24.025 10-14 23.630000000000003 28.42 26.200000000000003 21.75 15-19 23.580000000000002 28.595 27.134999999999998 20.69 20-24 23.189999999999998 28.199999999999996 27.41 21.2 25-29 23.45 27.96 27.565 21.025 30-34 23.169999999999998 28.865000000000002 27.389999999999997 20.575 35-39 23.03 28.389999999999997 27.21 21.37 40-44 23.27 28.355000000000004 27.534999999999997 20.84 45-49 23.44 27.6 28.395 20.565 50-54 23.135 28.384999999999998 27.715 20.765 55-59 23.455000000000002 27.950000000000003 27.655 20.94 60-64 23.785 28.4 27.529999999999998 20.285 65-69 23.78 28.335 27.295 20.59 70-74 23.68 28.865000000000002 27.07 20.385 75-79 23.810000000000002 28.505000000000003 27.384999999999998 20.3 80-84 23.369999999999997 28.48 27.35 20.8 85-89 23.985 27.87 27.99 20.155 90-94 23.599999999999998 27.815 28.215 20.369999999999997 95-99 23.669999999999998 28.705000000000002 27.685 19.939999999999998 100-104 24.195 27.55 27.26 20.995 105-109 23.805 27.235 28.58 20.380000000000003 110-114 23.53 28.015 28.02 20.435 115-119 23.59 27.83 28.185 20.395 120-124 24.42 27.555000000000003 27.625 20.4 125-129 23.635 27.810000000000002 28.294999999999998 20.26 130-134 24.485 28.470000000000002 27.279999999999998 19.765 135-139 23.73 28.15 27.875 20.244999999999997 140-144 24.535 28.16 27.445000000000004 19.86 145-149 23.849999999999998 28.754999999999995 27.32 20.075000000000003 150-151 23.95898461923221 28.61072902338377 27.160185069401027 20.270101287982996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.5 24 1.5 25 1.5 26 3.0 27 4.5 28 6.0 29 9.5 30 13.0 31 16.0 32 21.0 33 31.5 34 35.0 35 48.5 36 77.0 37 93.0 38 122.5 39 163.0 40 194.0 41 228.5 42 267.5 43 302.0 44 294.0 45 294.5 46 303.0 47 260.5 48 224.0 49 200.0 50 174.5 51 139.0 52 102.5 53 80.5 54 65.0 55 48.5 56 38.5 57 34.5 58 24.5 59 17.0 60 11.0 61 9.5 62 6.5 63 5.0 64 7.0 65 4.5 66 2.5 67 3.0 68 3.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.243761028485 98.425 2 0.7310310057978321 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8875 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.1375000000000002 0.0 0.0 0.0 0.0 128-129 1.2625000000000002 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 2.025 0.0 0.0 0.0 0.0 138-139 2.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751783 spots for SRR7180106.sra Written 751783 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra Read 751772 spots for SRR7180106.sra Written 751772 spots for SRR7180106.sra SRR ids: ['SRR7180106.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ztzrm33p SRR7180106.sra spots: 15035451 blocks: [[1, 751772], [751773, 1503544], [1503545, 2255316], [2255317, 3007088], [3007089, 3758860], [3758861, 4510632], [4510633, 5262404], [5262405, 6014176], [6014177, 6765948], [6765949, 7517720], [7517721, 8269492], [8269493, 9021264], [9021265, 9773036], [9773037, 10524808], [10524809, 11276580], [11276581, 12028352], [12028353, 12780124], [12780125, 13531896], [13531897, 14283668], [14283669, 15035451]] SRR7180106 file size 5073320 SRR7180106 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180106 SRR7180106_1.fastq SRR7180106_2.fastq Input file: SRR7180106_1.fastq Paired file: SRR7180106_2.fastq trimmed: SRR7180106-trimmed-pair1.fastq, SRR7180106-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:43:25 2025 >> started Mon Feb 10 19:43:42 2025 >> done (16.781s) 15035451 read pairs processed; of these: 26761 ( 0.18%) short read pairs filtered out after trimming by size control 20936 ( 0.14%) empty read pairs filtered out after trimming by size control 14987754 (99.68%) read pairs available; of these: 4913131 (32.78%) trimmed read pairs available after processing 10074623 (67.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 8 0.00% 22 1 0.00% 23 9 0.00% 24 5 0.00% 25 7 0.00% 26 7 0.00% 27 5 0.00% 28 7 0.00% 29 10 0.00% 30 5 0.00% 31 6 0.00% 32 3 0.00% 33 3 0.00% 34 8 0.00% 35 7 0.00% 36 5 0.00% 37 3 0.00% 38 5 0.00% 39 3 0.00% 40 9 0.00% 41 7 0.00% 42 2 0.00% 43 7 0.00% 44 9 0.00% 45 12 0.00% 46 10 0.00% 47 23 0.00% 48 11 0.00% 49 13 0.00% 50 15 0.00% 51 25 0.00% 52 31 0.00% 53 40 0.00% 54 39 0.00% 55 36 0.00% 56 26 0.00% 57 35 0.00% 58 31 0.00% 59 46 0.00% 60 51 0.00% 61 49 0.00% 62 86 0.00% 63 77 0.00% 64 90 0.00% 65 67 0.00% 66 82 0.00% 67 105 0.00% 68 119 0.00% 69 125 0.00% 70 142 0.00% 71 170 0.00% 72 195 0.00% 73 223 0.00% 74 224 0.00% 75 292 0.00% 76 364 0.00% 77 383 0.00% 78 410 0.00% 79 444 0.00% 80 510 0.00% 81 637 0.00% 82 700 0.00% 83 872 0.01% 84 1994 0.01% 85 2816 0.02% 86 2935 0.02% 87 3410 0.02% 88 3631 0.02% 89 3529 0.02% 90 3612 0.02% 91 3711 0.02% 92 3803 0.03% 93 3740 0.02% 94 4032 0.03% 95 3828 0.03% 96 3944 0.03% 97 4388 0.03% 98 4536 0.03% 99 4705 0.03% 100 5022 0.03% 101 5347 0.04% 102 5521 0.04% 103 5889 0.04% 104 6241 0.04% 105 6509 0.04% 106 7164 0.05% 107 7441 0.05% 108 7914 0.05% 109 8300 0.06% 110 8718 0.06% 111 9398 0.06% 112 9974 0.07% 113 10337 0.07% 114 11061 0.07% 115 11373 0.08% 116 12015 0.08% 117 12772 0.09% 118 13383 0.09% 119 14374 0.10% 120 15425 0.10% 121 15914 0.11% 122 16164 0.11% 123 16505 0.11% 124 17504 0.12% 125 17970 0.12% 126 18889 0.13% 127 19834 0.13% 128 20428 0.14% 129 22023 0.15% 130 23176 0.15% 131 24532 0.16% 132 25954 0.17% 133 27513 0.18% 134 29082 0.19% 135 31144 0.21% 136 32539 0.22% 137 35373 0.24% 138 38531 0.26% 139 41063 0.27% 140 44752 0.30% 141 48825 0.33% 142 53686 0.36% 143 60586 0.40% 144 69969 0.47% 145 83273 0.56% 146 103882 0.69% 147 139374 0.93% 148 215853 1.44% 149 448903 3.00% 150 2910144 19.42% 151 10074623 67.22% 14987754 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=26 prefix-density=0.75 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=140.25 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.8 sequence=AACAACATTCTGAACATAAAGACACCAAATACTTAAAAACTACAATAGATGAAAGCCCAAATGACCCATAAAGTATTCAGACCACCCATAATTTAAAGCTGCCAGCCAGGTGCATTGCTTCCGGTTCCCGTCCCTGTAGTATATCCGGTGCCACCAGTCCCAGTGCCAAATGCAGCGTCACCGGCACGCGTATTATGGCCAGTGGTGTCACCTGGAAGCCCACCTGGATGTGTCCTC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=21 prefix-density=0.74 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=56.90 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=10.6 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7180106 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:44:28 Started mapping on | Feb 10 19:44:28 Finished on | Feb 10 19:46:31 Mapping speed, Million of reads per hour | 438.67 Number of input reads | 14987754 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 13741115 Uniquely mapped reads % | 91.68% Average mapped length | 297.32 Number of splices: Total | 13591916 Number of splices: Annotated (sjdb) | 13321342 Number of splices: GT/AG | 13373774 Number of splices: GC/AG | 170863 Number of splices: AT/AC | 10400 Number of splices: Non-canonical | 36879 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311623 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 53097 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.81% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 961128 961128 961128 N_multimapping 311623 311623 311623 N_noFeature 357555 13614159 402989 N_ambiguous 149546 771 67627 UnstrandedReadsAssigned:13234014 PositiveStrandReadsAssigned:126185 NegativeStrandReadsAssigned:13270499 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7180106 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180106-trimmed-pair1.fastq SRR7180106-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,987,754 reads, 13,185,383 reads pseudoaligned [quant] estimated average fragment length: 258.73 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7180106.ke.tsv 34699 SRR7180106.se.tsv 87100 total ==> SRR7180106.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.27 1733 63.3512 Potri.005G024800.1.v4.1 1035 777.27 1203 99.5931 Potri.004G059700.1.v4.1 961 703.275 14 1.28097 Potri.007G009000.2.v4.1 1416 1158.27 0 0 Potri.003G141000.2.v4.1 2943 2685.27 1028 24.6343 Potri.016G087400.1.v4.1 270 65.3799 937 922.212 Potri.015G069301.1.v4.1 564 309.053 0 0 Potri.010G195200.1.v4.1 1773 1515.27 747 31.7224 Potri.012G127500.1.v4.1 977 719.27 4730 423.16 ==> SRR7180106.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 473 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 294 SRR7180106 completed mapping pipeline successfully