Starting /dee2/code/volunteer_pipeline.sh SRR7180107 current disk space = 3056895000576 free memory = 922960288 SRR7180107 SRAfilesize 536a9ebd25fb01fe79ed4d86142adeba SRR7180107.sra SRR7180107.sra file validated SRR7180107 is paired end SRR7180107 is conventional basespace SRR7180107 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180107_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.73025 34.0 33.0 34.0 32.0 34.0 2 33.0925 34.0 33.0 34.0 32.0 34.0 3 33.143 34.0 33.0 34.0 32.0 34.0 4 33.434 34.0 33.0 34.0 33.0 34.0 5 33.4725 34.0 33.0 34.0 33.0 34.0 6 37.3015 38.0 38.0 38.0 36.0 38.0 7 37.5045 38.0 38.0 38.0 37.0 38.0 8 37.68175 38.0 38.0 38.0 38.0 38.0 9 37.7265 38.0 38.0 38.0 38.0 38.0 10-14 37.7449 38.0 38.0 38.0 38.0 38.0 15-19 37.706849999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.70225 38.0 38.0 38.0 38.0 38.0 25-29 37.6867 38.0 38.0 38.0 38.0 38.0 30-34 37.65865 38.0 38.0 38.0 38.0 38.0 35-39 37.6353 38.0 38.0 38.0 38.0 38.0 40-44 37.59295 38.0 38.0 38.0 38.0 38.0 45-49 37.574850000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.505950000000006 38.0 38.0 38.0 38.0 38.0 55-59 37.5259 38.0 38.0 38.0 38.0 38.0 60-64 37.4979 38.0 38.0 38.0 37.8 38.0 65-69 37.449650000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.37179999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.378750000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.300349999999995 38.0 38.0 38.0 37.0 38.0 85-89 37.27835 38.0 38.0 38.0 37.0 38.0 90-94 37.19135 38.0 38.0 38.0 36.6 38.0 95-99 37.1757 38.0 38.0 38.0 36.8 38.0 100-104 37.043150000000004 38.0 38.0 38.0 36.0 38.0 105-109 36.9709 38.0 38.0 38.0 36.0 38.0 110-114 36.890550000000005 38.0 38.0 38.0 35.6 38.0 115-119 36.75725 38.0 38.0 38.0 35.0 38.0 120-124 36.6258 38.0 38.0 38.0 35.0 38.0 125-129 36.529399999999995 38.0 38.0 38.0 34.4 38.0 130-134 36.32795 38.0 38.0 38.0 34.0 38.0 135-139 36.1008 38.0 38.0 38.0 33.8 38.0 140-144 35.9459 38.0 37.6 38.0 33.0 38.0 145-149 35.5416 38.0 36.6 38.0 32.4 38.0 150-151 32.650875 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 2.0 20 7.0 21 2.0 22 2.0 23 2.0 24 4.0 25 11.0 26 6.0 27 10.0 28 8.0 29 11.0 30 22.0 31 34.0 32 42.0 33 64.0 34 68.0 35 143.0 36 426.0 37 3130.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.85132650380877 14.079327554504859 12.16180719726819 35.907538744418176 2 21.7 18.025 37.275000000000006 23.0 3 19.05 24.525 27.975 28.449999999999996 4 22.8 33.025 21.375 22.8 5 21.3 34.9 24.349999999999998 19.45 6 18.525 34.75 25.7 21.025 7 14.7 22.400000000000002 43.824999999999996 19.075 8 18.15 22.325 31.55 27.975 9 18.0 22.900000000000002 32.9 26.200000000000003 10-14 20.66 28.634999999999998 26.875 23.830000000000002 15-19 20.32 27.485 28.435 23.76 20-24 20.05 28.585 27.35 24.015 25-29 19.775000000000002 27.82 28.470000000000002 23.935000000000002 30-34 20.41 28.32 27.36 23.91 35-39 20.535 28.15 27.55 23.765 40-44 20.115 28.18 27.975 23.73 45-49 20.474999999999998 27.22 28.494999999999997 23.810000000000002 50-54 20.49 27.755000000000003 27.779999999999998 23.974999999999998 55-59 20.555 27.66 27.655 24.13 60-64 19.99 28.535 27.79 23.685000000000002 65-69 20.244999999999997 27.884999999999998 27.785 24.085 70-74 20.165 27.88 27.755000000000003 24.2 75-79 20.21 27.279999999999998 28.235 24.275 80-84 20.16 27.675 27.975 24.19 85-89 20.955 27.555000000000003 28.025 23.465 90-94 20.495 27.834999999999997 27.58 24.09 95-99 20.474999999999998 27.29 28.09 24.145 100-104 20.105 28.110000000000003 27.93 23.855 105-109 20.11 27.889999999999997 28.08 23.919999999999998 110-114 20.575 28.060000000000002 27.779999999999998 23.585 115-119 20.925 27.905 27.735 23.435 120-124 21.12 27.83 27.275 23.775 125-129 21.36 27.805000000000003 27.27 23.565 130-134 20.925 28.475 26.905 23.695 135-139 21.07 27.67 27.16 24.099999999999998 140-144 21.04 27.73 27.49 23.74 145-149 21.135 28.34 27.045 23.48 150-151 21.325 28.025 26.724999999999998 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 2.5 23 3.0 24 1.5 25 2.0 26 3.0 27 5.0 28 5.5 29 5.0 30 8.0 31 14.0 32 20.5 33 33.5 34 43.0 35 49.5 36 70.5 37 101.0 38 126.0 39 151.5 40 184.5 41 215.5 42 254.0 43 282.0 44 292.0 45 293.5 46 284.5 47 266.5 48 226.5 49 205.5 50 193.5 51 151.5 52 119.0 53 101.5 54 75.0 55 54.0 56 41.5 57 31.5 58 20.5 59 12.5 60 11.5 61 7.0 62 4.0 63 3.0 64 3.0 65 3.0 66 3.5 67 3.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1625 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.7374999999999998 0.0 0.0 0.0 0.0 118-119 2.15 0.0 0.0 0.0 0.0 120-121 2.5374999999999996 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.9124999999999996 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 5.012499999999999 0.0 0.0 0.0 0.0 132-133 5.575 0.0 0.0 0.0 0.0 134-135 6.137499999999999 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.00354369 20.707142 140-144 >>END_MODULE SRR7180107 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180107_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.221 34.0 33.0 34.0 33.0 34.0 2 33.18025 34.0 33.0 34.0 33.0 34.0 3 33.2965 34.0 33.0 34.0 33.0 34.0 4 33.28375 34.0 33.0 34.0 33.0 34.0 5 33.27925 34.0 33.0 34.0 33.0 34.0 6 37.533 38.0 38.0 38.0 38.0 38.0 7 37.4745 38.0 38.0 38.0 38.0 38.0 8 37.41275 38.0 38.0 38.0 38.0 38.0 9 37.37025 38.0 38.0 38.0 38.0 38.0 10-14 37.3856 38.0 38.0 38.0 38.0 38.0 15-19 37.43515 38.0 38.0 38.0 38.0 38.0 20-24 37.39565 38.0 38.0 38.0 38.0 38.0 25-29 37.4307 38.0 38.0 38.0 38.0 38.0 30-34 37.378550000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.3756 38.0 38.0 38.0 38.0 38.0 40-44 37.33155000000001 38.0 38.0 38.0 37.8 38.0 45-49 37.3552 38.0 38.0 38.0 37.4 38.0 50-54 37.31065 38.0 38.0 38.0 37.4 38.0 55-59 37.227700000000006 38.0 38.0 38.0 37.0 38.0 60-64 37.2427 38.0 38.0 38.0 37.0 38.0 65-69 37.119 38.0 38.0 38.0 37.0 38.0 70-74 37.124300000000005 38.0 38.0 38.0 36.8 38.0 75-79 37.08865000000001 38.0 38.0 38.0 36.8 38.0 80-84 37.093450000000004 38.0 38.0 38.0 36.4 38.0 85-89 36.906150000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.8303 38.0 38.0 38.0 36.0 38.0 95-99 36.8375 38.0 38.0 38.0 35.8 38.0 100-104 36.6511 38.0 38.0 38.0 35.0 38.0 105-109 36.4048 38.0 38.0 38.0 34.2 38.0 110-114 36.39705 38.0 38.0 38.0 34.0 38.0 115-119 36.310249999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.10925 38.0 38.0 38.0 33.8 38.0 125-129 35.92914999999999 38.0 37.4 38.0 33.0 38.0 130-134 35.5571 38.0 36.6 38.0 31.4 38.0 135-139 35.34885 38.0 36.0 38.0 31.0 38.0 140-144 35.14275 38.0 36.0 38.0 31.0 38.0 145-149 34.6914 38.0 35.6 38.0 28.2 38.0 150-151 31.05025 35.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 2.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 3.0 15 2.0 16 0.0 17 3.0 18 3.0 19 1.0 20 2.0 21 7.0 22 7.0 23 9.0 24 6.0 25 16.0 26 11.0 27 15.0 28 14.0 29 19.0 30 33.0 31 42.0 32 59.0 33 61.0 34 101.0 35 176.0 36 514.0 37 2882.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.125 15.950000000000001 16.85 27.075 2 24.775 22.400000000000002 33.925 18.9 3 21.7 26.424999999999997 30.125 21.75 4 25.324999999999996 33.75 22.275 18.65 5 26.075 35.125 21.6 17.2 6 20.25 37.2 23.425 19.125 7 18.85 18.45 41.575 21.125 8 21.5 23.3 27.900000000000002 27.3 9 22.1 26.0 28.175 23.724999999999998 10-14 24.48 28.185 25.655 21.68 15-19 23.669999999999998 27.855 27.16 21.315 20-24 23.145 28.804999999999996 27.139999999999997 20.91 25-29 22.795 28.87 27.474999999999998 20.86 30-34 24.02 27.93 27.43 20.62 35-39 22.97 28.415000000000003 27.22 21.395 40-44 23.830000000000002 28.134999999999998 26.935 21.099999999999998 45-49 23.425 28.685 26.795 21.095 50-54 24.03 27.675 27.639999999999997 20.655 55-59 23.505000000000003 28.115000000000002 27.92 20.46 60-64 23.945 28.449999999999996 26.674999999999997 20.93 65-69 23.615 28.74 27.165 20.48 70-74 23.810000000000002 28.265 27.384999999999998 20.54 75-79 24.125 28.165000000000003 27.005000000000003 20.705000000000002 80-84 23.665 28.185 27.36 20.79 85-89 24.02 28.34 26.8 20.84 90-94 23.76 27.99 27.425 20.825 95-99 23.73 28.03 27.265 20.974999999999998 100-104 24.215 28.065 27.24 20.48 105-109 23.435 28.044999999999998 27.689999999999998 20.830000000000002 110-114 23.674999999999997 28.425 27.345000000000002 20.555 115-119 24.13 27.99 27.48 20.4 120-124 24.275 28.125 27.235 20.365 125-129 24.135 28.655 27.07 20.14 130-134 25.095 28.29 26.724999999999998 19.89 135-139 25.590000000000003 27.67 27.165 19.575 140-144 25.165 28.744999999999997 26.075 20.015 145-149 25.795 28.365000000000002 26.395000000000003 19.445 150-151 25.618904726181547 28.319579894973746 27.094273568392097 18.967241810452613 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.0 28 3.0 29 5.5 30 7.5 31 12.0 32 18.5 33 23.5 34 29.5 35 46.0 36 60.5 37 82.0 38 114.0 39 143.0 40 177.5 41 226.0 42 277.0 43 282.5 44 283.0 45 307.5 46 307.5 47 301.0 48 261.0 49 209.0 50 178.0 51 139.0 52 112.0 53 88.5 54 74.5 55 60.5 56 41.5 57 33.5 58 24.0 59 16.0 60 13.0 61 7.5 62 4.0 63 4.5 64 4.0 65 4.0 66 2.5 67 1.0 68 1.0 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1625 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.8999999999999999 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.7000000000000002 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.3375000000000004 0.0 0.0 0.0 0.0 126-127 3.9 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.987500000000001 0.0 0.0 0.0 0.0 132-133 5.5375 0.0 0.0 0.0 0.0 134-135 6.112500000000001 0.0 0.0 0.0 0.0 136-137 6.6 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGATG 10 0.006830828 145.0 9 >>END_MODULE Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820757 spots for SRR7180107.sra Written 820757 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra Read 820755 spots for SRR7180107.sra Written 820755 spots for SRR7180107.sra SRR ids: ['SRR7180107.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xo03gi69 SRR7180107.sra spots: 16415102 blocks: [[1, 820755], [820756, 1641510], [1641511, 2462265], [2462266, 3283020], [3283021, 4103775], [4103776, 4924530], [4924531, 5745285], [5745286, 6566040], [6566041, 7386795], [7386796, 8207550], [8207551, 9028305], [9028306, 9849060], [9849061, 10669815], [10669816, 11490570], [11490571, 12311325], [12311326, 13132080], [13132081, 13952835], [13952836, 14773590], [14773591, 15594345], [15594346, 16415102]] SRR7180107 file size 5540839 SRR7180107 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180107 SRR7180107_1.fastq SRR7180107_2.fastq Input file: SRR7180107_1.fastq Paired file: SRR7180107_2.fastq trimmed: SRR7180107-trimmed-pair1.fastq, SRR7180107-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:21:49 2025 >> started Mon Feb 10 19:22:05 2025 >> done (16.706s) 16415102 read pairs processed; of these: 16580 ( 0.10%) short read pairs filtered out after trimming by size control 11483 ( 0.07%) empty read pairs filtered out after trimming by size control 16387039 (99.83%) read pairs available; of these: 5958892 (36.36%) trimmed read pairs available after processing 10428147 (63.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 1 0.00% 21 3 0.00% 22 1 0.00% 23 3 0.00% 24 4 0.00% 25 3 0.00% 26 7 0.00% 27 4 0.00% 28 2 0.00% 29 1 0.00% 30 3 0.00% 31 4 0.00% 32 3 0.00% 33 9 0.00% 34 3 0.00% 35 5 0.00% 36 5 0.00% 37 6 0.00% 38 2 0.00% 39 2 0.00% 40 3 0.00% 41 5 0.00% 42 7 0.00% 43 8 0.00% 44 7 0.00% 45 19 0.00% 46 15 0.00% 47 21 0.00% 48 13 0.00% 49 8 0.00% 50 14 0.00% 51 22 0.00% 52 37 0.00% 53 59 0.00% 54 46 0.00% 55 46 0.00% 56 32 0.00% 57 41 0.00% 58 45 0.00% 59 64 0.00% 60 68 0.00% 61 85 0.00% 62 90 0.00% 63 108 0.00% 64 105 0.00% 65 146 0.00% 66 171 0.00% 67 178 0.00% 68 197 0.00% 69 242 0.00% 70 273 0.00% 71 308 0.00% 72 367 0.00% 73 414 0.00% 74 511 0.00% 75 590 0.00% 76 712 0.00% 77 830 0.01% 78 915 0.01% 79 1051 0.01% 80 1203 0.01% 81 1401 0.01% 82 1612 0.01% 83 1869 0.01% 84 2808 0.02% 85 3606 0.02% 86 3875 0.02% 87 4438 0.03% 88 4659 0.03% 89 4965 0.03% 90 5309 0.03% 91 5733 0.03% 92 6411 0.04% 93 6830 0.04% 94 7318 0.04% 95 8025 0.05% 96 8617 0.05% 97 9275 0.06% 98 9820 0.06% 99 10720 0.07% 100 11410 0.07% 101 12099 0.07% 102 12854 0.08% 103 13530 0.08% 104 14725 0.09% 105 15626 0.10% 106 16786 0.10% 107 17824 0.11% 108 19165 0.12% 109 20048 0.12% 110 21324 0.13% 111 22640 0.14% 112 23507 0.14% 113 24498 0.15% 114 26073 0.16% 115 27320 0.17% 116 28469 0.17% 117 30201 0.18% 118 31556 0.19% 119 33368 0.20% 120 34924 0.21% 121 36765 0.22% 122 37230 0.23% 123 38561 0.24% 124 40218 0.25% 125 41267 0.25% 126 42574 0.26% 127 44746 0.27% 128 46571 0.28% 129 48045 0.29% 130 50474 0.31% 131 52118 0.32% 132 53917 0.33% 133 56717 0.35% 134 58387 0.36% 135 61054 0.37% 136 63563 0.39% 137 66055 0.40% 138 69331 0.42% 139 72116 0.44% 140 76200 0.47% 141 80704 0.49% 142 86202 0.53% 143 93361 0.57% 144 102873 0.63% 145 115082 0.70% 146 132814 0.81% 147 166586 1.02% 148 234919 1.43% 149 448100 2.73% 150 2867951 17.50% 151 10428147 63.64% 16387039 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.40 fanout-score-rank=21 prefix-density=0.29 prefix-fanout=3.8 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=38 fanout-score=473.95 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=33.9 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=33 prefix-density=0.23 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=349.67 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=32.0 sequence=GAAGAAGAAGAAA SRR7180107 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:22:53 Started mapping on | Feb 10 19:22:54 Finished on | Feb 10 19:25:14 Mapping speed, Million of reads per hour | 421.38 Number of input reads | 16387039 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14983007 Uniquely mapped reads % | 91.43% Average mapped length | 294.64 Number of splices: Total | 15332803 Number of splices: Annotated (sjdb) | 15085365 Number of splices: GT/AG | 15099375 Number of splices: GC/AG | 188422 Number of splices: AT/AC | 11030 Number of splices: Non-canonical | 33976 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373634 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 47477 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.93% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1047016 1047016 1047016 N_multimapping 373634 373634 373634 N_noFeature 289265 14854672 347194 N_ambiguous 142862 594 72153 UnstrandedReadsAssigned:14550880 PositiveStrandReadsAssigned:127741 NegativeStrandReadsAssigned:14563660 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180107 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180107-trimmed-pair1.fastq SRR7180107-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,387,039 reads, 14,500,017 reads pseudoaligned [quant] estimated average fragment length: 227.32 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR7180107.ke.tsv 34699 SRR7180107.se.tsv 87100 total ==> SRR7180107.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.68 1056 41.5763 Potri.005G024800.1.v4.1 1035 808.68 318 27.7391 Potri.004G059700.1.v4.1 961 734.68 20 1.92032 Potri.007G009000.2.v4.1 1416 1189.68 0 0 Potri.003G141000.2.v4.1 2943 2716.68 540 14.0216 Potri.016G087400.1.v4.1 270 83.7862 1083 911.798 Potri.015G069301.1.v4.1 564 340.055 0 0 Potri.010G195200.1.v4.1 1773 1546.68 341 15.5524 Potri.012G127500.1.v4.1 977 750.68 4220 396.552 ==> SRR7180107.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 353 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 163 SRR7180107 completed mapping pipeline successfully