Starting /dee2/code/volunteer_pipeline.sh SRR7180108 current disk space = 3056801579008 free memory = 1342845164 SRR7180108 SRAfilesize 21bb81b1a59ce1ec8bdf5f8fd3073f1a SRR7180108.sra SRR7180108.sra file validated SRR7180108 is paired end SRR7180108 is conventional basespace SRR7180108 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180108_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.59925 34.0 33.0 34.0 32.0 34.0 2 33.0875 34.0 33.0 34.0 32.0 34.0 3 33.15 34.0 33.0 34.0 32.0 34.0 4 32.88225 33.0 33.0 34.0 32.0 34.0 5 33.23225 33.0 33.0 34.0 33.0 34.0 6 36.676 38.0 37.0 38.0 34.0 38.0 7 37.4275 38.0 38.0 38.0 37.0 38.0 8 37.53775 38.0 38.0 38.0 37.0 38.0 9 37.6655 38.0 38.0 38.0 38.0 38.0 10-14 37.650999999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.637249999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.61725 38.0 38.0 38.0 38.0 38.0 25-29 37.584 38.0 38.0 38.0 38.0 38.0 30-34 37.572 38.0 38.0 38.0 38.0 38.0 35-39 37.51664999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.48545 38.0 38.0 38.0 38.0 38.0 45-49 37.4718 38.0 38.0 38.0 38.0 38.0 50-54 37.461999999999996 38.0 38.0 38.0 37.8 38.0 55-59 37.39375 38.0 38.0 38.0 37.0 38.0 60-64 37.3327 38.0 38.0 38.0 37.0 38.0 65-69 37.33825 38.0 38.0 38.0 37.0 38.0 70-74 37.29085 38.0 38.0 38.0 37.0 38.0 75-79 37.2727 38.0 38.0 38.0 37.0 38.0 80-84 37.21275 38.0 38.0 38.0 37.0 38.0 85-89 37.1132 38.0 38.0 38.0 36.6 38.0 90-94 37.051649999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.997499999999995 38.0 38.0 38.0 36.0 38.0 100-104 36.90089999999999 38.0 38.0 38.0 36.0 38.0 105-109 36.828450000000004 38.0 38.0 38.0 35.6 38.0 110-114 36.704750000000004 38.0 38.0 38.0 35.0 38.0 115-119 36.557050000000004 38.0 38.0 38.0 34.4 38.0 120-124 36.482299999999995 38.0 38.0 38.0 34.4 38.0 125-129 36.29285 38.0 38.0 38.0 34.0 38.0 130-134 36.11450000000001 38.0 38.0 38.0 33.6 38.0 135-139 35.9245 38.0 38.0 38.0 33.2 38.0 140-144 35.68915 38.0 37.0 38.0 33.0 38.0 145-149 35.332499999999996 38.0 36.4 38.0 32.2 38.0 150-151 32.37125 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 0.0 10 2.0 11 2.0 12 0.0 13 2.0 14 1.0 15 2.0 16 1.0 17 0.0 18 3.0 19 4.0 20 0.0 21 1.0 22 2.0 23 7.0 24 10.0 25 3.0 26 10.0 27 16.0 28 17.0 29 19.0 30 27.0 31 31.0 32 44.0 33 58.0 34 87.0 35 150.0 36 456.0 37 3042.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.891963109354414 13.80764163372859 14.440052700922266 33.860342555994734 2 20.825 18.625 36.5 24.05 3 18.6 25.6 26.650000000000002 29.15 4 21.425 31.225 23.875 23.474999999999998 5 19.7 34.949999999999996 25.85 19.5 6 17.9 35.475 25.7 20.925 7 14.299999999999999 25.275 42.125 18.3 8 17.7 24.4 32.2 25.7 9 17.525 24.175 33.875 24.425 10-14 19.095000000000002 29.565 27.700000000000003 23.64 15-19 19.15 28.544999999999998 28.299999999999997 24.005000000000003 20-24 19.665 29.015 28.1 23.22 25-29 19.61 29.494999999999997 27.52 23.375 30-34 20.0 29.56 27.805000000000003 22.634999999999998 35-39 19.75 28.999999999999996 28.17 23.080000000000002 40-44 19.869999999999997 29.115000000000002 27.994999999999997 23.02 45-49 19.79 28.65 27.775 23.785 50-54 20.380000000000003 29.065 27.77 22.785 55-59 20.315 28.994999999999997 27.52 23.169999999999998 60-64 20.26 28.205000000000002 28.025 23.51 65-69 19.56 29.285 27.66 23.494999999999997 70-74 20.375 28.735 27.529999999999998 23.36 75-79 19.509999999999998 28.244999999999997 27.705000000000002 24.54 80-84 20.02 28.13 27.815 24.035 85-89 20.755000000000003 28.110000000000003 27.485 23.65 90-94 19.905 28.860000000000003 27.794999999999998 23.44 95-99 20.085 28.365000000000002 28.02 23.53 100-104 20.285 28.365000000000002 27.955000000000002 23.395 105-109 20.255000000000003 29.044999999999998 27.11 23.59 110-114 19.97 28.575 27.595 23.86 115-119 20.82 28.37 27.400000000000002 23.41 120-124 20.48 28.799999999999997 27.22 23.5 125-129 20.615 28.144999999999996 27.325 23.915 130-134 21.255 28.249999999999996 26.474999999999998 24.02 135-139 20.62 28.485 27.21 23.685000000000002 140-144 20.315 28.125 27.169999999999998 24.39 145-149 20.474999999999998 28.585 26.855 24.085 150-151 21.6625 28.425 25.7875 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 2.5 24 5.5 25 7.0 26 6.5 27 10.0 28 15.0 29 20.5 30 26.0 31 35.5 32 49.5 33 59.0 34 71.0 35 87.5 36 104.0 37 121.0 38 147.5 39 165.0 40 181.5 41 218.5 42 234.5 43 246.5 44 259.0 45 248.5 46 241.5 47 236.0 48 224.0 49 193.0 50 163.5 51 132.0 52 98.5 53 87.0 54 73.5 55 53.0 56 37.5 57 30.5 58 27.5 59 19.5 60 10.5 61 10.0 62 8.0 63 5.5 64 4.0 65 2.5 66 1.5 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.6500000000000004 0.0 0.0 0.0 0.0 122-123 2.9875 0.0 0.0 0.0 0.0 124-125 3.45 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.9875 0.0 0.0 0.0 0.0 132-133 5.550000000000001 0.0 0.0 0.0 0.0 134-135 6.1875 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138-139 7.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTAAGA 10 0.0068378756 144.95 7 CAAAACT 10 0.0068378756 144.95 8 >>END_MODULE SRR7180108 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180108_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.066 33.0 33.0 34.0 32.0 34.0 2 32.99075 34.0 33.0 34.0 32.0 34.0 3 33.07075 34.0 33.0 34.0 33.0 34.0 4 33.007 34.0 33.0 34.0 33.0 34.0 5 33.02875 34.0 33.0 34.0 33.0 34.0 6 37.199 38.0 38.0 38.0 37.0 38.0 7 37.15375 38.0 38.0 38.0 37.0 38.0 8 37.1145 38.0 38.0 38.0 37.0 38.0 9 37.1525 38.0 38.0 38.0 37.0 38.0 10-14 37.07555000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.03340000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.022149999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.035799999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.0323 38.0 38.0 38.0 37.0 38.0 35-39 37.00939999999999 38.0 38.0 38.0 37.0 38.0 40-44 36.96854999999999 38.0 38.0 38.0 37.0 38.0 45-49 36.931799999999996 38.0 38.0 38.0 36.4 38.0 50-54 36.92565 38.0 38.0 38.0 36.6 38.0 55-59 36.85105 38.0 38.0 38.0 36.2 38.0 60-64 36.7943 38.0 38.0 38.0 36.0 38.0 65-69 36.734700000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.6856 38.0 38.0 38.0 36.0 38.0 75-79 36.64385 38.0 38.0 38.0 35.8 38.0 80-84 36.586149999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.35505 38.0 38.0 38.0 34.2 38.0 90-94 36.2769 38.0 38.0 38.0 34.2 38.0 95-99 36.20765 38.0 38.0 38.0 34.0 38.0 100-104 36.091150000000006 38.0 38.0 38.0 34.0 38.0 105-109 35.80585 38.0 37.8 38.0 33.0 38.0 110-114 35.69635000000001 38.0 37.8 38.0 32.4 38.0 115-119 35.57675 38.0 37.2 38.0 31.6 38.0 120-124 35.35475 38.0 37.0 38.0 30.6 38.0 125-129 35.04209999999999 38.0 36.0 38.0 28.4 38.0 130-134 34.8698 38.0 36.0 38.0 28.0 38.0 135-139 34.55135 38.0 35.8 38.0 26.6 38.0 140-144 34.238350000000004 38.0 35.0 38.0 24.0 38.0 145-149 33.54775 38.0 35.0 38.0 20.4 38.0 150-151 29.622749999999996 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 7.0 4 1.0 5 0.0 6 0.0 7 0.0 8 5.0 9 1.0 10 0.0 11 5.0 12 5.0 13 5.0 14 4.0 15 4.0 16 9.0 17 6.0 18 10.0 19 5.0 20 3.0 21 4.0 22 9.0 23 9.0 24 7.0 25 18.0 26 26.0 27 20.0 28 33.0 29 24.0 30 35.0 31 49.0 32 65.0 33 88.0 34 113.0 35 201.0 36 529.0 37 2686.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.324999999999996 16.5 18.825 25.35 2 25.525 21.675 33.7 19.1 3 22.5 27.400000000000002 29.2 20.9 4 25.6 32.550000000000004 23.425 18.425 5 23.799999999999997 37.1 20.95 18.15 6 19.725 35.199999999999996 26.650000000000002 18.425 7 20.200000000000003 18.05 39.6 22.15 8 21.925 23.225 27.125 27.725 9 22.475 26.424999999999997 27.05 24.05 10-14 23.65 28.265 26.33 21.755 15-19 23.580000000000002 27.98 27.715 20.724999999999998 20-24 23.65 29.075 27.060000000000002 20.215 25-29 23.61 28.599999999999998 26.924999999999997 20.865000000000002 30-34 23.325000000000003 28.410000000000004 27.615000000000002 20.65 35-39 23.474999999999998 28.125 27.515 20.885 40-44 23.665 28.110000000000003 27.485 20.74 45-49 23.72 27.415 28.165000000000003 20.7 50-54 23.395 27.985 28.060000000000002 20.560000000000002 55-59 24.505 28.084999999999997 27.145000000000003 20.265 60-64 23.825 27.474999999999998 27.905 20.794999999999998 65-69 24.55 28.01 27.325 20.115 70-74 24.2 27.42 27.834999999999997 20.544999999999998 75-79 23.115 28.144999999999996 27.955000000000002 20.785 80-84 23.835 27.92 27.605 20.64 85-89 23.7 27.93 27.944999999999997 20.424999999999997 90-94 23.724999999999998 27.755000000000003 28.37 20.150000000000002 95-99 24.075 27.58 28.084999999999997 20.26 100-104 23.655 28.610000000000003 27.51 20.225 105-109 23.794999999999998 27.810000000000002 27.79 20.605 110-114 23.745 28.105000000000004 27.72 20.43 115-119 23.875 28.235 27.735 20.155 120-124 24.14 28.065 27.76 20.035 125-129 23.505000000000003 28.49 28.005000000000003 20.0 130-134 24.94 28.02 27.395000000000003 19.645000000000003 135-139 24.45 28.42 27.529999999999998 19.6 140-144 24.725 28.360000000000003 27.36 19.555 145-149 25.005 27.900000000000002 27.875 19.220000000000002 150-151 25.531382845711427 27.731932983245812 28.044511127781945 18.692173043260816 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.5 9 1.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 2.0 22 2.5 23 1.5 24 2.0 25 2.0 26 5.5 27 8.5 28 8.5 29 10.0 30 11.5 31 15.0 32 21.0 33 34.5 34 44.0 35 50.0 36 70.5 37 91.0 38 111.5 39 149.5 40 186.0 41 225.0 42 243.5 43 268.0 44 296.0 45 286.0 46 275.0 47 263.0 48 243.0 49 200.5 50 165.0 51 148.0 52 119.0 53 96.5 54 79.5 55 57.5 56 45.5 57 40.0 58 31.0 59 21.5 60 14.5 61 10.0 62 10.0 63 7.5 64 5.0 65 3.0 66 1.0 67 1.0 68 1.0 69 1.5 70 0.5 71 0.0 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0125 0.0 100-101 0.6125 0.0 0.0 0.025 0.0 102-103 0.7125 0.0 0.0 0.025 0.0 104-105 0.8 0.0 0.0 0.025 0.0 106-107 0.9375 0.0 0.0 0.025 0.0 108-109 1.075 0.0 0.0 0.025 0.0 110-111 1.3 0.0 0.0 0.025 0.0 112-113 1.5625 0.0 0.0 0.025 0.0 114-115 1.8125 0.0 0.0 0.025 0.0 116-117 2.0875000000000004 0.0 0.0 0.025 0.0 118-119 2.3875 0.0 0.0 0.025 0.0 120-121 2.7 0.0 0.0 0.025 0.0 122-123 3.0125 0.0 0.0 0.025 0.0 124-125 3.45 0.0 0.0 0.025 0.0 126-127 3.9375 0.0 0.0 0.025 0.0 128-129 4.362500000000001 0.0 0.0 0.025 0.0 130-131 4.9875 0.0 0.0 0.025 0.0 132-133 5.4875 0.0 0.0 0.025 0.0 134-135 6.1375 0.0 0.0 0.025 0.0 136-137 6.7 0.0 0.0 0.025 0.0 138-139 7.575 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGAT 10 0.006830828 145.0 7 >>END_MODULE Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799736 spots for SRR7180108.sra Written 799736 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra Read 799718 spots for SRR7180108.sra Written 799718 spots for SRR7180108.sra SRR ids: ['SRR7180108.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f84_89ks SRR7180108.sra spots: 15994378 blocks: [[1, 799718], [799719, 1599436], [1599437, 2399154], [2399155, 3198872], [3198873, 3998590], [3998591, 4798308], [4798309, 5598026], [5598027, 6397744], [6397745, 7197462], [7197463, 7997180], [7997181, 8796898], [8796899, 9596616], [9596617, 10396334], [10396335, 11196052], [11196053, 11995770], [11995771, 12795488], [12795489, 13595206], [13595207, 14394924], [14394925, 15194642], [15194643, 15994378]] SRR7180108 file size 5398269 SRR7180108 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180108 SRR7180108_1.fastq SRR7180108_2.fastq Input file: SRR7180108_1.fastq Paired file: SRR7180108_2.fastq trimmed: SRR7180108-trimmed-pair1.fastq, SRR7180108-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:28:39 2025 >> started Mon Feb 10 19:28:57 2025 >> done (17.656s) 15994378 read pairs processed; of these: 46867 ( 0.29%) short read pairs filtered out after trimming by size control 30630 ( 0.19%) empty read pairs filtered out after trimming by size control 15916881 (99.52%) read pairs available; of these: 5962537 (37.46%) trimmed read pairs available after processing 9954344 (62.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 7 0.00% 21 12 0.00% 22 9 0.00% 23 9 0.00% 24 14 0.00% 25 12 0.00% 26 20 0.00% 27 21 0.00% 28 17 0.00% 29 15 0.00% 30 23 0.00% 31 17 0.00% 32 26 0.00% 33 15 0.00% 34 19 0.00% 35 13 0.00% 36 20 0.00% 37 9 0.00% 38 15 0.00% 39 24 0.00% 40 14 0.00% 41 22 0.00% 42 27 0.00% 43 17 0.00% 44 21 0.00% 45 37 0.00% 46 37 0.00% 47 44 0.00% 48 37 0.00% 49 49 0.00% 50 41 0.00% 51 64 0.00% 52 66 0.00% 53 102 0.00% 54 95 0.00% 55 84 0.00% 56 95 0.00% 57 98 0.00% 58 85 0.00% 59 104 0.00% 60 139 0.00% 61 158 0.00% 62 145 0.00% 63 183 0.00% 64 171 0.00% 65 192 0.00% 66 217 0.00% 67 270 0.00% 68 291 0.00% 69 288 0.00% 70 369 0.00% 71 429 0.00% 72 458 0.00% 73 594 0.00% 74 611 0.00% 75 723 0.00% 76 889 0.01% 77 1014 0.01% 78 1159 0.01% 79 1164 0.01% 80 1330 0.01% 81 1618 0.01% 82 1853 0.01% 83 2174 0.01% 84 4205 0.03% 85 5950 0.04% 86 6337 0.04% 87 7551 0.05% 88 7690 0.05% 89 7996 0.05% 90 8257 0.05% 91 8244 0.05% 92 8650 0.05% 93 8814 0.06% 94 9046 0.06% 95 9427 0.06% 96 9846 0.06% 97 10476 0.07% 98 10837 0.07% 99 11428 0.07% 100 11990 0.08% 101 12964 0.08% 102 13462 0.08% 103 14709 0.09% 104 15651 0.10% 105 16350 0.10% 106 17775 0.11% 107 18797 0.12% 108 19565 0.12% 109 20630 0.13% 110 21832 0.14% 111 22853 0.14% 112 24301 0.15% 113 25384 0.16% 114 26536 0.17% 115 28162 0.18% 116 29113 0.18% 117 30280 0.19% 118 31974 0.20% 119 33216 0.21% 120 35601 0.22% 121 36491 0.23% 122 37395 0.23% 123 38210 0.24% 124 39714 0.25% 125 40922 0.26% 126 42737 0.27% 127 44211 0.28% 128 45726 0.29% 129 47808 0.30% 130 49277 0.31% 131 51338 0.32% 132 54191 0.34% 133 56106 0.35% 134 58732 0.37% 135 60642 0.38% 136 62597 0.39% 137 65749 0.41% 138 69075 0.43% 139 71775 0.45% 140 75946 0.48% 141 80823 0.51% 142 86563 0.54% 143 92739 0.58% 144 102937 0.65% 145 115775 0.73% 146 133500 0.84% 147 168041 1.06% 148 237833 1.49% 149 450740 2.83% 150 2821146 17.72% 151 9954344 62.54% 15916881 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=26 prefix-density=0.76 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=262.76 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=18.1 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=25 prefix-density=0.65 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=39.52 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.7 sequence=AACTTTGGAGAGGTAGGAATGGGAGTATTTGCACTTGTGGTAACGGTATTTGCATTATTGATGGTTTTTACTATGTTGGGTATGCTGTTCGATTTCTTAAAGGACTGAATATTCGGTGGCAGTATGGGATTTCTAAAAATAATGTTAAGAAT SRR7180108 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:29:50 Started mapping on | Feb 10 19:29:51 Finished on | Feb 10 19:32:48 Mapping speed, Million of reads per hour | 323.73 Number of input reads | 15916881 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14355696 Uniquely mapped reads % | 90.19% Average mapped length | 294.15 Number of splices: Total | 13417045 Number of splices: Annotated (sjdb) | 13143633 Number of splices: GT/AG | 13205964 Number of splices: GC/AG | 162409 Number of splices: AT/AC | 10200 Number of splices: Non-canonical | 38472 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380398 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 89482 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.74% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1225996 1225996 1225996 N_multimapping 380398 380398 380398 N_noFeature 387509 14198515 447136 N_ambiguous 175317 760 77537 UnstrandedReadsAssigned:13792870 PositiveStrandReadsAssigned:156421 NegativeStrandReadsAssigned:13831023 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180108 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180108-trimmed-pair1.fastq SRR7180108-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,916,881 reads, 13,777,511 reads pseudoaligned [quant] estimated average fragment length: 224.774 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,201 rounds 52401 SRR7180108.ke.tsv 34699 SRR7180108.se.tsv 87100 total ==> SRR7180108.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.23 1815 60.591 Potri.005G024800.1.v4.1 1035 811.226 1496 110.458 Potri.004G059700.1.v4.1 961 737.226 11 0.893718 Potri.007G009000.2.v4.1 1416 1192.23 0 0 Potri.003G141000.2.v4.1 2943 2719.23 751 16.5426 Potri.016G087400.1.v4.1 270 81.7282 1168.82 856.609 Potri.015G069301.1.v4.1 564 341.97 0 0 Potri.010G195200.1.v4.1 1773 1549.23 425 16.4317 Potri.012G127500.1.v4.1 977 753.226 1159 92.1651 ==> SRR7180108.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 537 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 127 SRR7180108 completed mapping pipeline successfully