Starting /dee2/code/volunteer_pipeline.sh SRR7180109 current disk space = 3056138133504 free memory = 1577262296 SRR7180109 SRAfilesize 39bb753c6018986da332d8e40097acf5 SRR7180109.sra SRR7180109.sra file validated SRR7180109 is paired end SRR7180109 is conventional basespace SRR7180109 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180109_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.15075 33.0 25.0 33.0 18.0 34.0 2 31.44175 33.0 31.0 33.0 27.0 34.0 3 31.37325 33.0 31.0 33.0 27.0 34.0 4 32.23875 33.0 32.0 33.0 31.0 34.0 5 32.73725 33.0 33.0 33.0 32.0 34.0 6 37.05675 38.0 37.0 38.0 36.0 38.0 7 37.3855 38.0 38.0 38.0 37.0 38.0 8 37.611 38.0 38.0 38.0 37.0 38.0 9 37.65325 38.0 38.0 38.0 38.0 38.0 10-14 37.72815 38.0 38.0 38.0 38.0 38.0 15-19 37.711149999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.6962 38.0 38.0 38.0 38.0 38.0 25-29 37.665299999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.6691 38.0 38.0 38.0 38.0 38.0 35-39 37.63035000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.58845 38.0 38.0 38.0 38.0 38.0 45-49 37.6023 38.0 38.0 38.0 38.0 38.0 50-54 37.55409999999999 38.0 38.0 38.0 38.0 38.0 55-59 37.5428 38.0 38.0 38.0 38.0 38.0 60-64 37.48175 38.0 38.0 38.0 37.8 38.0 65-69 37.475699999999996 38.0 38.0 38.0 37.2 38.0 70-74 37.44895 38.0 38.0 38.0 37.0 38.0 75-79 37.3566 38.0 38.0 38.0 37.0 38.0 80-84 37.35209999999999 38.0 38.0 38.0 37.0 38.0 85-89 37.2581 38.0 38.0 38.0 36.8 38.0 90-94 37.18725 38.0 38.0 38.0 37.0 38.0 95-99 37.1611 38.0 38.0 38.0 36.6 38.0 100-104 37.060500000000005 38.0 38.0 38.0 36.0 38.0 105-109 36.92190000000001 38.0 38.0 38.0 36.0 38.0 110-114 36.82305 38.0 38.0 38.0 35.2 38.0 115-119 36.769999999999996 38.0 38.0 38.0 35.0 38.0 120-124 36.640499999999996 38.0 38.0 38.0 34.8 38.0 125-129 36.5946 38.0 38.0 38.0 34.6 38.0 130-134 36.3831 38.0 38.0 38.0 34.0 38.0 135-139 36.13805000000001 38.0 37.8 38.0 33.8 38.0 140-144 35.9242 38.0 37.8 38.0 33.2 38.0 145-149 35.6422 38.0 36.8 38.0 32.8 38.0 150-151 32.917875 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 1.0 19 1.0 20 1.0 21 1.0 22 6.0 23 7.0 24 3.0 25 8.0 26 5.0 27 15.0 28 18.0 29 17.0 30 14.0 31 25.0 32 39.0 33 53.0 34 68.0 35 175.0 36 450.0 37 3087.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.913907284768214 14.410596026490067 12.317880794701987 38.35761589403974 2 21.9 19.400000000000002 37.7 21.0 3 19.225 24.525 27.05 29.2 4 22.275 31.55 22.3 23.875 5 22.225 33.85 24.3 19.625 6 17.349999999999998 34.8 25.75 22.1 7 14.6 21.85 43.35 20.200000000000003 8 19.35 21.8 31.075000000000003 27.775 9 18.125 22.05 33.775 26.05 10-14 20.145 28.28 26.974999999999998 24.6 15-19 20.015 28.065 27.905 24.015 20-24 20.375 27.900000000000002 27.775 23.95 25-29 19.85 28.77 27.87 23.51 30-34 20.61 28.52 27.615000000000002 23.255 35-39 20.86 27.54 28.110000000000003 23.49 40-44 20.455000000000002 28.050000000000004 27.55 23.945 45-49 19.57 28.265 27.705000000000002 24.46 50-54 20.215 28.32 27.900000000000002 23.565 55-59 20.150000000000002 28.175 27.875 23.799999999999997 60-64 20.315 28.165000000000003 27.1 24.42 65-69 20.445 28.395 27.439999999999998 23.72 70-74 20.865000000000002 28.28 27.185 23.669999999999998 75-79 19.7 28.444999999999997 27.41 24.445 80-84 20.465 27.26 28.310000000000002 23.965 85-89 20.57 27.834999999999997 28.050000000000004 23.544999999999998 90-94 20.705000000000002 27.744999999999997 27.565 23.985 95-99 20.765 28.205000000000002 27.195000000000004 23.835 100-104 21.035 27.51 27.525 23.93 105-109 20.830000000000002 27.265 27.650000000000002 24.255 110-114 20.595 27.965 27.750000000000004 23.69 115-119 20.925 28.035 27.52 23.52 120-124 20.82 27.950000000000003 27.045 24.185000000000002 125-129 20.665 27.26 28.23 23.845 130-134 21.305 27.105 27.88 23.71 135-139 21.245 27.66 27.095000000000002 24.0 140-144 21.565 27.689999999999998 27.474999999999998 23.27 145-149 21.37 27.88 26.565 24.185000000000002 150-151 21.12376423476411 27.831310224002003 27.280690777124267 23.764234764109624 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 2.5 25 2.5 26 5.0 27 7.5 28 6.5 29 10.5 30 15.0 31 19.5 32 27.0 33 29.0 34 37.5 35 58.5 36 77.0 37 97.5 38 113.5 39 152.0 40 207.5 41 222.0 42 249.0 43 267.0 44 277.5 45 288.5 46 277.0 47 265.5 48 238.5 49 216.5 50 182.5 51 141.0 52 111.5 53 88.5 54 76.0 55 58.0 56 40.5 57 31.5 58 22.5 59 18.0 60 13.0 61 11.0 62 10.5 63 7.0 64 5.5 65 5.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.325 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 4.0125 0.0 0.0 0.0 0.0 134-135 4.3375 0.0 0.0 0.0 0.0 136-137 4.7625 0.0 0.0 0.0 0.0 138-139 5.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180109 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180109_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05625 33.0 33.0 34.0 33.0 34.0 2 33.21475 34.0 33.0 34.0 33.0 34.0 3 33.32125 34.0 33.0 34.0 33.0 34.0 4 33.301 34.0 33.0 34.0 33.0 34.0 5 33.28725 34.0 33.0 34.0 33.0 34.0 6 37.42025 38.0 38.0 38.0 38.0 38.0 7 37.56925 38.0 38.0 38.0 38.0 38.0 8 37.482 38.0 38.0 38.0 38.0 38.0 9 37.48475 38.0 38.0 38.0 38.0 38.0 10-14 37.5116 38.0 38.0 38.0 38.0 38.0 15-19 37.458850000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.4664 38.0 38.0 38.0 38.0 38.0 25-29 37.48415 38.0 38.0 38.0 38.0 38.0 30-34 37.4457 38.0 38.0 38.0 37.8 38.0 35-39 37.405300000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.37525 38.0 38.0 38.0 37.6 38.0 45-49 37.41335 38.0 38.0 38.0 37.0 38.0 50-54 37.38175 38.0 38.0 38.0 37.0 38.0 55-59 37.323249999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.2363 38.0 38.0 38.0 36.8 38.0 65-69 37.19185 38.0 38.0 38.0 36.8 38.0 70-74 37.249700000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.135149999999996 38.0 38.0 38.0 36.4 38.0 80-84 37.0313 38.0 38.0 38.0 36.0 38.0 85-89 36.9341 38.0 38.0 38.0 36.0 38.0 90-94 36.9 38.0 38.0 38.0 36.0 38.0 95-99 36.8229 38.0 38.0 38.0 35.8 38.0 100-104 36.71455 38.0 38.0 38.0 35.0 38.0 105-109 36.5949 38.0 38.0 38.0 34.6 38.0 110-114 36.53435 38.0 38.0 38.0 34.6 38.0 115-119 36.417649999999995 38.0 38.0 38.0 34.2 38.0 120-124 36.259699999999995 38.0 38.0 38.0 34.0 38.0 125-129 35.997949999999996 38.0 37.4 38.0 33.0 38.0 130-134 35.754949999999994 38.0 37.0 38.0 32.4 38.0 135-139 35.5418 38.0 36.0 38.0 31.6 38.0 140-144 35.1115 38.0 36.0 38.0 30.2 38.0 145-149 34.56725 38.0 35.6 38.0 28.8 38.0 150-151 31.024375 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 1.0 5 0.0 6 0.0 7 2.0 8 2.0 9 0.0 10 0.0 11 0.0 12 3.0 13 1.0 14 0.0 15 1.0 16 0.0 17 2.0 18 3.0 19 5.0 20 7.0 21 3.0 22 4.0 23 3.0 24 2.0 25 12.0 26 10.0 27 15.0 28 23.0 29 19.0 30 24.0 31 41.0 32 43.0 33 76.0 34 104.0 35 203.0 36 486.0 37 2900.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.11460165870822 15.833123900477508 16.486554410655945 31.565720030158328 2 24.562281140570285 22.71135567783892 35.217608804402204 17.508754377188595 3 21.735867933966986 26.28814407203602 30.09004502251126 21.885942971485743 4 24.025 34.175 22.2 19.6 5 24.675 36.35 21.95 17.025000000000002 6 19.0 37.875 23.775 19.35 7 19.025 17.575 41.6 21.8 8 21.725 23.175 27.375 27.725 9 21.55 24.075 29.099999999999998 25.275 10-14 23.255 28.599999999999998 25.855 22.29 15-19 22.89 28.33 27.450000000000003 21.33 20-24 23.375 28.349999999999998 27.16 21.115000000000002 25-29 23.18 28.025 27.565 21.23 30-34 22.972297229722972 28.28282828282828 27.257725772577256 21.487148714871488 35-39 23.22893736241745 27.436461877126277 27.62657594556734 21.708024814888933 40-44 23.590333716915996 28.183319157452345 26.952519137439335 21.273827988192327 45-49 23.235 28.249999999999996 27.255000000000003 21.26 50-54 23.145 27.91 28.015 20.93 55-59 23.23 28.294999999999998 27.055 21.42 60-64 23.835 27.685 27.73 20.75 65-69 23.32 27.779999999999998 27.83 21.07 70-74 24.23 28.299999999999997 27.034999999999997 20.435 75-79 23.445 28.29 27.43 20.835 80-84 23.9 28.365000000000002 27.029999999999998 20.705000000000002 85-89 24.075 27.955000000000002 27.575 20.395 90-94 24.375 28.18 27.189999999999998 20.255000000000003 95-99 24.27 28.065 27.205000000000002 20.46 100-104 23.705000000000002 28.095 27.529999999999998 20.669999999999998 105-109 24.035 28.375 26.884999999999998 20.705000000000002 110-114 23.89 28.64 27.200000000000003 20.27 115-119 24.245 28.32 27.200000000000003 20.235 120-124 24.135 27.87 27.325 20.669999999999998 125-129 24.404999999999998 27.815 27.47 20.31 130-134 23.98 29.185 26.450000000000003 20.385 135-139 24.745 28.08 26.63 20.544999999999998 140-144 24.91 28.29 27.08 19.72 145-149 25.540000000000003 28.000000000000004 26.505000000000003 19.955000000000002 150-151 24.949799196787147 29.0035140562249 26.029116465863456 20.0175702811245 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 1.0 25 1.5 26 1.5 27 2.0 28 4.0 29 3.5 30 6.0 31 11.5 32 18.5 33 27.5 34 32.5 35 37.5 36 60.0 37 84.0 38 122.5 39 162.0 40 194.5 41 239.0 42 257.0 43 275.0 44 292.0 45 310.5 46 307.0 47 266.5 48 244.5 49 208.5 50 158.0 51 145.0 52 134.5 53 101.5 54 73.0 55 54.5 56 42.5 57 31.5 58 22.5 59 14.5 60 11.0 61 8.0 62 7.5 63 7.0 64 4.0 65 4.0 66 2.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.525 2 0.05 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.06 40-44 0.065 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.025 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.475 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.375 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.4 0.0 0.0 0.0 0.0 136-137 4.8375 0.0 0.0 0.0 0.0 138-139 5.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTGTC 10 0.006836113 144.9625 4 GCCTTGT 10 0.006836113 144.9625 9 CTGGTAT 10 0.006836113 144.9625 2 ACTAGTC 10 0.006836113 144.9625 7 >>END_MODULE Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra Read 850416 spots for SRR7180109.sra Written 850416 spots for SRR7180109.sra Read 850400 spots for SRR7180109.sra Written 850400 spots for SRR7180109.sra SRR ids: ['SRR7180109.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2pz59hva SRR7180109.sra spots: 17008016 blocks: [[1, 850400], [850401, 1700800], [1700801, 2551200], [2551201, 3401600], [3401601, 4252000], [4252001, 5102400], [5102401, 5952800], [5952801, 6803200], [6803201, 7653600], [7653601, 8504000], [8504001, 9354400], [9354401, 10204800], [10204801, 11055200], [11055201, 11905600], [11905601, 12756000], [12756001, 13606400], [13606401, 14456800], [14456801, 15307200], [15307201, 16157600], [16157601, 17008016]] SRR7180109 file size 5741758 SRR7180109 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180109 SRR7180109_1.fastq SRR7180109_2.fastq Input file: SRR7180109_1.fastq Paired file: SRR7180109_2.fastq trimmed: SRR7180109-trimmed-pair1.fastq, SRR7180109-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:47:32 2025 >> started Mon Feb 10 20:47:50 2025 >> done (18.435s) 17008016 read pairs processed; of these: 11774 ( 0.07%) short read pairs filtered out after trimming by size control 8959 ( 0.05%) empty read pairs filtered out after trimming by size control 16987283 (99.88%) read pairs available; of these: 6005353 (35.35%) trimmed read pairs available after processing 10981930 (64.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 0 0.00% 25 0 0.00% 26 3 0.00% 27 0 0.00% 28 3 0.00% 29 1 0.00% 30 1 0.00% 31 4 0.00% 32 1 0.00% 33 2 0.00% 34 7 0.00% 35 6 0.00% 36 8 0.00% 37 8 0.00% 38 15 0.00% 39 41 0.00% 40 3 0.00% 41 6 0.00% 42 12 0.00% 43 11 0.00% 44 10 0.00% 45 42 0.00% 46 13 0.00% 47 11 0.00% 48 22 0.00% 49 19 0.00% 50 18 0.00% 51 17 0.00% 52 22 0.00% 53 48 0.00% 54 34 0.00% 55 100 0.00% 56 145 0.00% 57 61 0.00% 58 45 0.00% 59 62 0.00% 60 79 0.00% 61 123 0.00% 62 163 0.00% 63 133 0.00% 64 115 0.00% 65 147 0.00% 66 167 0.00% 67 179 0.00% 68 243 0.00% 69 212 0.00% 70 274 0.00% 71 310 0.00% 72 396 0.00% 73 452 0.00% 74 519 0.00% 75 565 0.00% 76 682 0.00% 77 746 0.00% 78 960 0.01% 79 1168 0.01% 80 1120 0.01% 81 1315 0.01% 82 1575 0.01% 83 1668 0.01% 84 2413 0.01% 85 3121 0.02% 86 3325 0.02% 87 3714 0.02% 88 4224 0.02% 89 4268 0.03% 90 4569 0.03% 91 4969 0.03% 92 5371 0.03% 93 5582 0.03% 94 6292 0.04% 95 6858 0.04% 96 7228 0.04% 97 7695 0.05% 98 8252 0.05% 99 8702 0.05% 100 9436 0.06% 101 9933 0.06% 102 10608 0.06% 103 11423 0.07% 104 12122 0.07% 105 13061 0.08% 106 13995 0.08% 107 14614 0.09% 108 15533 0.09% 109 16483 0.10% 110 17260 0.10% 111 18186 0.11% 112 19256 0.11% 113 20257 0.12% 114 21332 0.13% 115 22755 0.13% 116 23882 0.14% 117 24670 0.15% 118 25875 0.15% 119 27449 0.16% 120 29536 0.17% 121 31103 0.18% 122 30508 0.18% 123 32077 0.19% 124 33357 0.20% 125 34230 0.20% 126 35758 0.21% 127 37683 0.22% 128 39129 0.23% 129 40998 0.24% 130 43075 0.25% 131 44994 0.26% 132 46547 0.27% 133 48960 0.29% 134 50589 0.30% 135 53010 0.31% 136 55802 0.33% 137 58180 0.34% 138 61485 0.36% 139 65064 0.38% 140 69002 0.41% 141 73272 0.43% 142 80434 0.47% 143 87900 0.52% 144 98879 0.58% 145 111153 0.65% 146 129593 0.76% 147 167407 0.99% 148 247862 1.46% 149 489255 2.88% 150 3129670 18.42% 151 10981930 64.65% 16987283 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=12.09 fanout-score-rank=9 prefix-density=0.63 prefix-fanout=3.4 sequence=TTCTCAGCACCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=466.31 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=34.8 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.60 fanout-score-rank=27 prefix-density=0.29 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=61.80 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.8 sequence=GAGAAGGCAATGAGA SRR7180109 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:48:38 Started mapping on | Feb 10 20:48:38 Finished on | Feb 10 20:51:12 Mapping speed, Million of reads per hour | 397.11 Number of input reads | 16987283 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15741624 Uniquely mapped reads % | 92.67% Average mapped length | 295.85 Number of splices: Total | 16243278 Number of splices: Annotated (sjdb) | 15976106 Number of splices: GT/AG | 15988519 Number of splices: GC/AG | 203180 Number of splices: AT/AC | 12014 Number of splices: Non-canonical | 39565 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403961 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 72842 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.45% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 853105 853105 853105 N_multimapping 403961 403961 403961 N_noFeature 326881 15616852 375705 N_ambiguous 155173 901 78634 UnstrandedReadsAssigned:15259570 PositiveStrandReadsAssigned:123871 NegativeStrandReadsAssigned:15287285 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180109 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180109-trimmed-pair1.fastq SRR7180109-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,987,283 reads, 15,170,056 reads pseudoaligned [quant] estimated average fragment length: 235.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52401 SRR7180109.ke.tsv 34699 SRR7180109.se.tsv 87100 total ==> SRR7180109.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.37 1034 36.5674 Potri.005G024800.1.v4.1 1035 800.371 205 16.1539 Potri.004G059700.1.v4.1 961 726.377 25 2.17067 Potri.007G009000.2.v4.1 1416 1181.37 0 0 Potri.003G141000.2.v4.1 2943 2708.37 434 10.1064 Potri.016G087400.1.v4.1 270 78.8331 1267.78 1014.26 Potri.015G069301.1.v4.1 564 332.032 0 0 Potri.010G195200.1.v4.1 1773 1538.37 293 12.0122 Potri.012G127500.1.v4.1 977 742.377 5591 474.985 ==> SRR7180109.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 380 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 165 SRR7180109 completed mapping pipeline successfully