Starting /dee2/code/volunteer_pipeline.sh SRR7180110 current disk space = 3056525656064 free memory = 978567708 SRR7180110 SRAfilesize f50fc3af1a6ad912566d509382bae16d SRR7180110.sra SRR7180110.sra file validated SRR7180110 is paired end SRR7180110 is conventional basespace SRR7180110 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180110_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.51875 33.0 32.0 34.0 25.0 34.0 2 30.931 33.0 31.0 33.0 27.0 34.0 3 32.45525 33.0 33.0 34.0 30.0 34.0 4 32.828 33.0 33.0 34.0 31.0 34.0 5 33.12925 34.0 33.0 34.0 32.0 34.0 6 36.95125 38.0 37.0 38.0 35.0 38.0 7 37.43675 38.0 38.0 38.0 37.0 38.0 8 37.51275 38.0 38.0 38.0 37.0 38.0 9 37.6065 38.0 38.0 38.0 38.0 38.0 10-14 37.6297 38.0 38.0 38.0 38.0 38.0 15-19 37.57090000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.5487 38.0 38.0 38.0 38.0 38.0 25-29 37.56285 38.0 38.0 38.0 38.0 38.0 30-34 37.5429 38.0 38.0 38.0 38.0 38.0 35-39 37.523199999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.507200000000005 38.0 38.0 38.0 37.6 38.0 45-49 37.4973 38.0 38.0 38.0 37.0 38.0 50-54 37.40625 38.0 38.0 38.0 37.0 38.0 55-59 37.367200000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.30365 38.0 38.0 38.0 37.0 38.0 65-69 37.297 38.0 38.0 38.0 36.8 38.0 70-74 37.19325 38.0 38.0 38.0 36.4 38.0 75-79 37.14215 38.0 38.0 38.0 36.4 38.0 80-84 37.0543 38.0 38.0 38.0 36.0 38.0 85-89 36.9969 38.0 38.0 38.0 36.0 38.0 90-94 36.975649999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.911950000000004 38.0 38.0 38.0 35.6 38.0 100-104 36.8086 38.0 38.0 38.0 35.0 38.0 105-109 36.68685 38.0 38.0 38.0 34.8 38.0 110-114 36.533 38.0 38.0 38.0 34.2 38.0 115-119 36.4769 38.0 38.0 38.0 34.0 38.0 120-124 36.33655 38.0 38.0 38.0 33.8 38.0 125-129 36.13175 38.0 37.8 38.0 33.8 38.0 130-134 35.8682 38.0 37.0 38.0 32.6 38.0 135-139 35.706849999999996 38.0 36.4 38.0 32.2 38.0 140-144 35.429500000000004 38.0 36.0 38.0 30.6 38.0 145-149 35.00585 38.0 36.0 38.0 30.6 38.0 150-151 31.760875 36.5 32.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 0.0 13 1.0 14 2.0 15 1.0 16 1.0 17 2.0 18 1.0 19 0.0 20 2.0 21 3.0 22 4.0 23 1.0 24 5.0 25 9.0 26 9.0 27 17.0 28 19.0 29 27.0 30 37.0 31 36.0 32 52.0 33 73.0 34 113.0 35 211.0 36 534.0 37 2837.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.143086386734424 13.880716769189622 13.613265579031827 37.36293126504413 2 20.849999999999998 16.725 38.25 24.175 3 18.825 22.075 28.249999999999996 30.85 4 21.625 29.549999999999997 23.724999999999998 25.1 5 22.05 33.4 24.275 20.275000000000002 6 17.7 33.4 26.85 22.05 7 12.75 22.55 44.975 19.725 8 17.675 22.8 31.65 27.875 9 16.05 23.075000000000003 34.275 26.6 10-14 19.675 28.994999999999997 27.04 24.29 15-19 19.759999999999998 28.23 28.265 23.745 20-24 19.5 28.15 28.16 24.19 25-29 19.855 28.43 28.49 23.225 30-34 20.145 27.91 27.744999999999997 24.2 35-39 19.5 27.71 28.235 24.555 40-44 19.52 28.51 28.23 23.74 45-49 19.48 27.889999999999997 28.355000000000004 24.275 50-54 20.215 27.74 28.410000000000004 23.635 55-59 20.19 27.985 28.005000000000003 23.82 60-64 19.86 28.065 27.860000000000003 24.215 65-69 19.685 28.265 28.065 23.985 70-74 19.865 28.025 27.98 24.13 75-79 20.29 27.26 28.275 24.175 80-84 20.05 27.665 28.22 24.065 85-89 19.35 28.89 27.66 24.099999999999998 90-94 20.205000000000002 28.42 27.705000000000002 23.669999999999998 95-99 20.05 27.555000000000003 28.29 24.104999999999997 100-104 19.814999999999998 28.060000000000002 28.175 23.95 105-109 20.3 27.965 27.54 24.195 110-114 20.375 27.944999999999997 27.905 23.775 115-119 20.755000000000003 27.839999999999996 26.915 24.490000000000002 120-124 20.175 27.71 28.04 24.075 125-129 20.965 27.42 27.250000000000004 24.365000000000002 130-134 20.44 28.265 27.060000000000002 24.235 135-139 20.69 28.205000000000002 26.540000000000003 24.565 140-144 20.560000000000002 28.105000000000004 27.200000000000003 24.135 145-149 20.52 28.33 26.88 24.27 150-151 20.8625 28.299999999999997 26.7125 24.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 2.5 25 4.5 26 5.0 27 6.0 28 10.5 29 14.0 30 15.5 31 20.0 32 25.0 33 32.5 34 48.5 35 64.0 36 87.5 37 107.0 38 137.0 39 174.5 40 183.5 41 218.0 42 259.0 43 260.5 44 276.5 45 297.5 46 284.0 47 270.0 48 241.5 49 186.5 50 171.0 51 157.5 52 115.5 53 81.5 54 56.5 55 44.5 56 37.5 57 29.0 58 16.0 59 8.0 60 10.0 61 8.5 62 5.5 63 5.0 64 2.0 65 1.0 66 2.0 67 4.0 68 4.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5249999999999999 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 1.0125000000000002 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.975 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.15 0.0 0.0 0.0 0.0 116-117 3.5999999999999996 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.2625 0.0 0.0 0.0 0.0 126-127 5.6875 0.0 0.0 0.0 0.0 128-129 6.137499999999999 0.0 0.0 0.0 0.0 130-131 6.775 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 7.8875 0.0 0.0 0.0 0.0 136-137 8.5875 0.0 0.0 0.0 0.0 138-139 9.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACTGC 10 0.006841402 144.925 3 CCTCCTA 10 0.006841402 144.925 145 GACTGCA 10 0.006841402 144.925 4 >>END_MODULE SRR7180110 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180110_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82175 33.0 33.0 34.0 32.0 34.0 2 32.9455 34.0 33.0 34.0 32.0 34.0 3 33.01075 34.0 33.0 34.0 32.0 34.0 4 32.97975 34.0 33.0 34.0 32.0 34.0 5 32.87925 34.0 33.0 34.0 32.0 34.0 6 37.1235 38.0 38.0 38.0 37.0 38.0 7 37.02425 38.0 38.0 38.0 37.0 38.0 8 36.94275 38.0 38.0 38.0 37.0 38.0 9 37.1055 38.0 38.0 38.0 37.0 38.0 10-14 37.0852 38.0 38.0 38.0 37.0 38.0 15-19 37.06055 38.0 38.0 38.0 36.8 38.0 20-24 37.0595 38.0 38.0 38.0 37.0 38.0 25-29 36.9935 38.0 38.0 38.0 36.8 38.0 30-34 36.931650000000005 38.0 38.0 38.0 36.6 38.0 35-39 36.81230000000001 38.0 38.0 38.0 36.2 38.0 40-44 36.835800000000006 38.0 38.0 38.0 36.0 38.0 45-49 36.899899999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.873599999999996 38.0 38.0 38.0 36.2 38.0 55-59 36.82775 38.0 38.0 38.0 36.0 38.0 60-64 36.76405 38.0 38.0 38.0 36.0 38.0 65-69 36.66335 38.0 38.0 38.0 35.8 38.0 70-74 36.69585 38.0 38.0 38.0 36.0 38.0 75-79 36.61525 38.0 38.0 38.0 35.2 38.0 80-84 36.5755 38.0 38.0 38.0 35.2 38.0 85-89 36.4191 38.0 38.0 38.0 34.4 38.0 90-94 36.296499999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.297450000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.080650000000006 38.0 38.0 38.0 34.0 38.0 105-109 35.84805 38.0 37.6 38.0 32.8 38.0 110-114 35.896 38.0 37.8 38.0 33.0 38.0 115-119 35.773900000000005 38.0 37.6 38.0 33.0 38.0 120-124 35.5783 38.0 37.0 38.0 32.0 38.0 125-129 35.2724 38.0 36.4 38.0 30.6 38.0 130-134 34.95555 38.0 36.0 38.0 28.2 38.0 135-139 34.6287 38.0 35.6 38.0 27.2 38.0 140-144 34.32025 38.0 35.2 38.0 24.8 38.0 145-149 33.8531 38.0 35.0 38.0 22.4 38.0 150-151 30.501875000000002 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 3.0 5 3.0 6 3.0 7 2.0 8 2.0 9 4.0 10 1.0 11 4.0 12 4.0 13 2.0 14 1.0 15 5.0 16 3.0 17 3.0 18 3.0 19 6.0 20 3.0 21 3.0 22 12.0 23 7.0 24 12.0 25 21.0 26 12.0 27 20.0 28 28.0 29 37.0 30 27.0 31 44.0 32 72.0 33 88.0 34 132.0 35 226.0 36 563.0 37 2627.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.55 16.05 19.55 26.85 2 24.4 23.95 33.625 18.025 3 21.4 26.200000000000003 31.275 21.125 4 24.349999999999998 33.825 23.25 18.575 5 24.15 35.8 23.275000000000002 16.775000000000002 6 18.775 35.975 25.525 19.725 7 19.475 18.275 40.45 21.8 8 21.45 23.1 28.499999999999996 26.950000000000003 9 23.175 25.174999999999997 27.800000000000004 23.849999999999998 10-14 24.095 28.794999999999998 25.905 21.205 15-19 23.395 28.244999999999997 27.634999999999998 20.724999999999998 20-24 23.577073121936582 28.50855256576973 27.548264479343803 20.366109832949885 25-29 23.637728296222164 28.111083312484364 27.51063297473105 20.740555416562422 30-34 23.342347756410255 28.57071314102564 27.173477564102566 20.91346153846154 35-39 23.749624135511677 29.30740703618322 26.766563095118773 20.17640573318633 40-44 23.57833558795531 28.473370409339143 27.68675785359988 20.261536149105666 45-49 24.049429657794676 28.692215329197516 26.85111066639984 20.407244346607964 50-54 23.838575786367954 27.6741511226684 28.029204380657095 20.458068710306545 55-59 24.157415741574155 27.69276927692769 27.477747774777477 20.672067206720673 60-64 23.885 27.67 27.485 20.96 65-69 23.525 28.4 27.950000000000003 20.125 70-74 24.015 28.435 27.275 20.275000000000002 75-79 24.02 27.900000000000002 27.93 20.150000000000002 80-84 23.91 28.084999999999997 27.805000000000003 20.200000000000003 85-89 24.005000000000003 27.744999999999997 27.810000000000002 20.44 90-94 24.235 27.875 27.650000000000002 20.24 95-99 24.474999999999998 28.610000000000003 27.315 19.6 100-104 24.245 28.49 27.445000000000004 19.82 105-109 24.415 27.994999999999997 27.644999999999996 19.945 110-114 24.305 28.15 27.384999999999998 20.16 115-119 24.955 28.18 27.12 19.744999999999997 120-124 24.29 28.194999999999997 27.72 19.794999999999998 125-129 25.259999999999998 27.985 27.169999999999998 19.585 130-134 25.369999999999997 28.365000000000002 27.055 19.21 135-139 25.09 28.625 27.065 19.220000000000002 140-144 25.580000000000002 28.26 27.389999999999997 18.77 145-149 25.95 28.32 26.61 19.12 150-151 26.515814476809602 28.34104263032879 26.978372296537067 18.16477059632454 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.5 23 3.0 24 3.5 25 4.5 26 4.5 27 4.5 28 4.5 29 6.0 30 8.5 31 11.0 32 18.5 33 28.0 34 32.5 35 45.5 36 69.5 37 92.5 38 121.0 39 159.0 40 196.5 41 227.0 42 269.0 43 288.5 44 286.0 45 302.0 46 296.5 47 253.0 48 228.5 49 227.0 50 189.5 51 158.0 52 131.5 53 97.0 54 67.5 55 38.0 56 24.5 57 22.0 58 20.0 59 12.0 60 10.0 61 8.0 62 9.0 63 7.5 64 2.0 65 0.5 66 1.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.075 30-34 0.16 35-39 0.22999999999999998 40-44 0.20500000000000002 45-49 0.06 50-54 0.015 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5249999999999999 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 1.0125000000000002 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.5875 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.4 0.0 0.0 0.0 0.0 122-123 4.7625 0.0 0.0 0.0 0.0 124-125 5.3125 0.0 0.0 0.0 0.0 126-127 5.737500000000001 0.0 0.0 0.0 0.0 128-129 6.1875 0.0 0.0 0.0 0.0 130-131 6.8 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 7.8875 0.0 0.0 0.0 0.0 136-137 8.6125 0.0 0.0 0.0 0.0 138-139 9.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra Read 938572 spots for SRR7180110.sra Written 938572 spots for SRR7180110.sra Read 938568 spots for SRR7180110.sra Written 938568 spots for SRR7180110.sra SRR ids: ['SRR7180110.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ir843fb SRR7180110.sra spots: 18771364 blocks: [[1, 938568], [938569, 1877136], [1877137, 2815704], [2815705, 3754272], [3754273, 4692840], [4692841, 5631408], [5631409, 6569976], [6569977, 7508544], [7508545, 8447112], [8447113, 9385680], [9385681, 10324248], [10324249, 11262816], [11262817, 12201384], [12201385, 13139952], [13139953, 14078520], [14078521, 15017088], [15017089, 15955656], [15955657, 16894224], [16894225, 17832792], [17832793, 18771364]] SRR7180110 file size 6339298 SRR7180110 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180110 SRR7180110_1.fastq SRR7180110_2.fastq Input file: SRR7180110_1.fastq Paired file: SRR7180110_2.fastq trimmed: SRR7180110-trimmed-pair1.fastq, SRR7180110-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:47:08 2025 >> started Mon Feb 10 19:47:28 2025 >> done (19.634s) 18771364 read pairs processed; of these: 36995 ( 0.20%) short read pairs filtered out after trimming by size control 28342 ( 0.15%) empty read pairs filtered out after trimming by size control 18706027 (99.65%) read pairs available; of these: 7581410 (40.53%) trimmed read pairs available after processing 11124617 (59.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 3 0.00% 21 0 0.00% 22 6 0.00% 23 3 0.00% 24 6 0.00% 25 8 0.00% 26 11 0.00% 27 9 0.00% 28 6 0.00% 29 7 0.00% 30 13 0.00% 31 6 0.00% 32 5 0.00% 33 5 0.00% 34 6 0.00% 35 2 0.00% 36 7 0.00% 37 7 0.00% 38 7 0.00% 39 10 0.00% 40 13 0.00% 41 12 0.00% 42 6 0.00% 43 14 0.00% 44 14 0.00% 45 19 0.00% 46 13 0.00% 47 19 0.00% 48 28 0.00% 49 26 0.00% 50 29 0.00% 51 38 0.00% 52 36 0.00% 53 41 0.00% 54 54 0.00% 55 59 0.00% 56 63 0.00% 57 67 0.00% 58 89 0.00% 59 87 0.00% 60 125 0.00% 61 151 0.00% 62 183 0.00% 63 197 0.00% 64 235 0.00% 65 245 0.00% 66 275 0.00% 67 349 0.00% 68 415 0.00% 69 483 0.00% 70 534 0.00% 71 668 0.00% 72 810 0.00% 73 928 0.00% 74 1047 0.01% 75 1214 0.01% 76 1398 0.01% 77 1690 0.01% 78 1840 0.01% 79 2015 0.01% 80 2291 0.01% 81 2780 0.01% 82 3126 0.02% 83 3634 0.02% 84 5558 0.03% 85 7014 0.04% 86 7447 0.04% 87 8375 0.04% 88 9004 0.05% 89 9486 0.05% 90 9750 0.05% 91 10861 0.06% 92 11528 0.06% 93 12260 0.07% 94 13445 0.07% 95 14322 0.08% 96 15363 0.08% 97 16695 0.09% 98 17740 0.09% 99 19082 0.10% 100 20075 0.11% 101 20928 0.11% 102 22402 0.12% 103 23833 0.13% 104 24885 0.13% 105 26889 0.14% 106 28692 0.15% 107 29794 0.16% 108 31688 0.17% 109 33636 0.18% 110 35238 0.19% 111 37053 0.20% 112 38323 0.20% 113 39268 0.21% 114 41478 0.22% 115 43254 0.23% 116 44732 0.24% 117 47307 0.25% 118 49743 0.27% 119 51131 0.27% 120 54932 0.29% 121 56028 0.30% 122 57116 0.31% 123 58580 0.31% 124 60960 0.33% 125 61853 0.33% 126 64340 0.34% 127 65970 0.35% 128 67967 0.36% 129 69692 0.37% 130 72749 0.39% 131 75562 0.40% 132 77816 0.42% 133 80323 0.43% 134 83163 0.44% 135 86414 0.46% 136 87999 0.47% 137 91844 0.49% 138 94762 0.51% 139 98882 0.53% 140 104024 0.56% 141 109885 0.59% 142 117363 0.63% 143 126642 0.68% 144 139864 0.75% 145 155453 0.83% 146 179749 0.96% 147 224479 1.20% 148 317281 1.70% 149 567513 3.03% 150 3166433 16.93% 151 11124617 59.47% 18706027 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=31 prefix-density=0.54 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=39.35 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.5 sequence=GATATCATAATGACTGAAAAACATCTTACATTGCTTAATCAAACACACGCTAGCTCGCTTATAAGCGCCCCTAGTTAAGGGAAACCTTTATTTAATAAAGTCACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=33 prefix-density=0.83 prefix-fanout=2.5 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=226.83 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=12.4 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT SRR7180110 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:48:18 Started mapping on | Feb 10 19:48:18 Finished on | Feb 10 19:50:33 Mapping speed, Million of reads per hour | 498.83 Number of input reads | 18706027 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17525348 Uniquely mapped reads % | 93.69% Average mapped length | 292.37 Number of splices: Total | 17871384 Number of splices: Annotated (sjdb) | 17523928 Number of splices: GT/AG | 17585074 Number of splices: GC/AG | 228322 Number of splices: AT/AC | 14220 Number of splices: Non-canonical | 43768 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433405 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 57649 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.62% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 779527 779527 779527 N_multimapping 433405 433405 433405 N_noFeature 421696 17351953 502179 N_ambiguous 171915 960 78408 UnstrandedReadsAssigned:16931737 PositiveStrandReadsAssigned:172435 NegativeStrandReadsAssigned:16944761 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7180110 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180110-trimmed-pair1.fastq SRR7180110-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,706,027 reads, 16,841,731 reads pseudoaligned [quant] estimated average fragment length: 221.909 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR7180110.ke.tsv 34699 SRR7180110.se.tsv 87100 total ==> SRR7180110.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.09 1468 45.4715 Potri.005G024800.1.v4.1 1035 814.091 327 22.3593 Potri.004G059700.1.v4.1 961 740.116 27 2.03071 Potri.007G009000.2.v4.1 1416 1195.09 0 0 Potri.003G141000.2.v4.1 2943 2722.09 916.277 18.7373 Potri.016G087400.1.v4.1 270 88.506 1570 987.44 Potri.015G069301.1.v4.1 564 345.985 0 0 Potri.010G195200.1.v4.1 1773 1552.09 391.786 14.0513 Potri.012G127500.1.v4.1 977 756.106 6716 494.438 ==> SRR7180110.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 84 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 537 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 495 SRR7180110 completed mapping pipeline successfully