Starting /dee2/code/volunteer_pipeline.sh SRR7180111 current disk space = 3056291176448 free memory = 1167694304 SRR7180111 SRAfilesize d72d0393edca3a43c098f7f9fa9b1b48 SRR7180111.sra SRR7180111.sra file validated SRR7180111 is paired end SRR7180111 is conventional basespace SRR7180111 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180111_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.67825 30.0 18.0 32.0 18.0 33.0 2 31.09625 33.0 30.0 33.0 27.0 33.0 3 32.227 33.0 33.0 33.0 29.0 34.0 4 32.7205 33.0 33.0 34.0 32.0 34.0 5 33.023 33.0 33.0 34.0 32.0 34.0 6 36.80625 38.0 37.0 38.0 34.0 38.0 7 37.29 38.0 38.0 38.0 36.0 38.0 8 37.4275 38.0 38.0 38.0 37.0 38.0 9 37.5325 38.0 38.0 38.0 38.0 38.0 10-14 37.56295 38.0 38.0 38.0 38.0 38.0 15-19 37.5483 38.0 38.0 38.0 38.0 38.0 20-24 37.53545 38.0 38.0 38.0 38.0 38.0 25-29 37.4759 38.0 38.0 38.0 37.8 38.0 30-34 37.48285 38.0 38.0 38.0 37.6 38.0 35-39 37.477799999999995 38.0 38.0 38.0 37.6 38.0 40-44 37.4524 38.0 38.0 38.0 37.0 38.0 45-49 37.40675 38.0 38.0 38.0 37.0 38.0 50-54 37.363350000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.35585 38.0 38.0 38.0 37.0 38.0 60-64 37.2708 38.0 38.0 38.0 37.0 38.0 65-69 37.1814 38.0 38.0 38.0 36.6 38.0 70-74 37.161150000000006 38.0 38.0 38.0 36.0 38.0 75-79 37.165 38.0 38.0 38.0 36.2 38.0 80-84 37.07145 38.0 38.0 38.0 36.0 38.0 85-89 36.991499999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.989000000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.83985 38.0 38.0 38.0 35.6 38.0 100-104 36.7281 38.0 38.0 38.0 35.0 38.0 105-109 36.7147 38.0 38.0 38.0 35.0 38.0 110-114 36.507349999999995 38.0 38.0 38.0 34.2 38.0 115-119 36.419599999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.34595 38.0 37.8 38.0 34.0 38.0 125-129 36.1977 38.0 37.8 38.0 33.8 38.0 130-134 35.87625 38.0 36.8 38.0 32.6 38.0 135-139 35.68275 38.0 36.4 38.0 32.2 38.0 140-144 35.24365 38.0 36.0 38.0 30.4 38.0 145-149 34.86585 38.0 36.0 38.0 28.8 38.0 150-151 32.102000000000004 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 1.0 22 5.0 23 9.0 24 5.0 25 9.0 26 21.0 27 20.0 28 19.0 29 15.0 30 45.0 31 39.0 32 51.0 33 75.0 34 135.0 35 207.0 36 545.0 37 2790.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.180566587238545 13.58220810166799 12.946783161239079 39.290442149854385 2 19.925 19.25 38.2 22.625 3 21.175 23.125 26.700000000000003 28.999999999999996 4 22.725 31.825 22.3 23.150000000000002 5 23.25 32.975 24.825 18.95 6 17.075000000000003 34.449999999999996 27.625 20.849999999999998 7 14.475 22.125 43.35 20.05 8 17.599999999999998 22.8 30.75 28.849999999999998 9 18.4 22.85 32.324999999999996 26.424999999999997 10-14 19.695 28.494999999999997 27.125 24.685000000000002 15-19 19.935 27.839999999999996 27.875 24.349999999999998 20-24 20.185 27.57 27.96 24.285 25-29 20.5 28.410000000000004 27.83 23.26 30-34 19.830000000000002 28.32 27.99 23.86 35-39 20.075000000000003 28.255000000000003 27.615000000000002 24.055 40-44 20.505000000000003 28.439999999999998 27.235 23.82 45-49 19.77 27.810000000000002 27.839999999999996 24.58 50-54 20.150000000000002 28.110000000000003 27.315 24.425 55-59 20.19 27.555000000000003 28.215 24.04 60-64 20.085 28.065 27.985 23.865 65-69 20.055 28.15 27.439999999999998 24.355 70-74 20.435 27.08 27.85 24.635 75-79 20.505000000000003 27.58 27.884999999999998 24.03 80-84 20.45 27.62 28.04 23.89 85-89 20.555 28.015 27.625 23.805 90-94 20.685000000000002 27.71 27.560000000000002 24.044999999999998 95-99 20.835 27.42 27.815 23.93 100-104 21.425 27.77 27.029999999999998 23.775 105-109 20.685000000000002 26.815 28.025 24.474999999999998 110-114 20.565 27.639999999999997 27.685 24.11 115-119 20.465 28.449999999999996 27.61 23.474999999999998 120-124 20.880000000000003 27.82 27.22 24.08 125-129 20.9 27.565 27.49 24.044999999999998 130-134 21.985 27.134999999999998 27.365000000000002 23.515 135-139 21.18 27.865000000000002 27.115000000000002 23.84 140-144 21.415 27.3 27.32 23.965 145-149 21.215 27.57 27.029999999999998 24.185000000000002 150-151 21.512500000000003 27.1125 26.900000000000002 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.0 23 2.0 24 3.0 25 2.0 26 3.5 27 3.5 28 5.5 29 12.0 30 15.5 31 17.5 32 24.0 33 38.5 34 52.5 35 57.5 36 70.5 37 92.5 38 118.0 39 142.0 40 180.5 41 220.5 42 250.5 43 273.5 44 274.5 45 266.5 46 260.0 47 255.0 48 248.0 49 226.0 50 194.0 51 165.0 52 124.5 53 89.5 54 76.5 55 59.0 56 37.5 57 31.5 58 27.5 59 19.0 60 14.0 61 10.0 62 7.0 63 7.5 64 5.5 65 3.0 66 1.5 67 1.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8496993987976 99.65 2 0.1002004008016032 0.2 3 0.0501002004008016 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.5374999999999996 0.0 0.0 0.0 0.0 122-123 2.925 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.7874999999999996 0.0 0.0 0.0 0.0 128-129 4.1875 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 5.0625 0.0 0.0 0.0 0.0 134-135 5.512499999999999 0.0 0.0 0.0 0.0 136-137 6.012499999999999 0.0 0.0 0.0 0.0 138-139 6.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180111 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180111_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.882 33.0 33.0 34.0 32.0 34.0 2 33.09075 34.0 33.0 34.0 32.0 34.0 3 33.12275 34.0 33.0 34.0 33.0 34.0 4 32.999 34.0 33.0 34.0 32.0 34.0 5 33.068 34.0 33.0 34.0 33.0 34.0 6 37.18825 38.0 38.0 38.0 37.0 38.0 7 37.2545 38.0 38.0 38.0 37.0 38.0 8 37.157 38.0 38.0 38.0 37.0 38.0 9 37.2975 38.0 38.0 38.0 37.0 38.0 10-14 37.31305 38.0 38.0 38.0 37.0 38.0 15-19 37.1982 38.0 38.0 38.0 37.0 38.0 20-24 37.197950000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.1532 38.0 38.0 38.0 37.0 38.0 30-34 37.19455 38.0 38.0 38.0 37.0 38.0 35-39 37.0958 38.0 38.0 38.0 37.0 38.0 40-44 37.0892 38.0 38.0 38.0 37.0 38.0 45-49 37.0805 38.0 38.0 38.0 37.0 38.0 50-54 37.137649999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.0513 38.0 38.0 38.0 36.4 38.0 60-64 36.9554 38.0 38.0 38.0 36.2 38.0 65-69 36.9781 38.0 38.0 38.0 36.0 38.0 70-74 36.96235 38.0 38.0 38.0 36.0 38.0 75-79 36.91420000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.8266 38.0 38.0 38.0 35.8 38.0 85-89 36.696549999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.6379 38.0 38.0 38.0 35.2 38.0 95-99 36.522 38.0 38.0 38.0 34.4 38.0 100-104 36.4035 38.0 38.0 38.0 34.2 38.0 105-109 36.30575 38.0 38.0 38.0 34.0 38.0 110-114 36.22255 38.0 38.0 38.0 34.0 38.0 115-119 36.16045 38.0 38.0 38.0 34.0 38.0 120-124 35.95555 38.0 37.4 38.0 33.0 38.0 125-129 35.8103 38.0 37.0 38.0 33.0 38.0 130-134 35.454550000000005 38.0 36.2 38.0 31.0 38.0 135-139 35.3732 38.0 36.0 38.0 31.0 38.0 140-144 34.9593 38.0 35.8 38.0 29.4 38.0 145-149 34.42274999999999 38.0 35.0 38.0 27.4 38.0 150-151 30.9005 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 3.0 5 1.0 6 0.0 7 0.0 8 2.0 9 1.0 10 0.0 11 1.0 12 2.0 13 2.0 14 3.0 15 1.0 16 2.0 17 2.0 18 4.0 19 4.0 20 0.0 21 7.0 22 6.0 23 9.0 24 15.0 25 15.0 26 14.0 27 15.0 28 17.0 29 28.0 30 39.0 31 42.0 32 56.0 33 94.0 34 128.0 35 192.0 36 519.0 37 2767.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.319148936170215 16.971214017521902 16.195244055068837 31.51439299123905 2 23.036518259129565 23.311655827913956 36.79339669834917 16.858429214607305 3 21.8304576144036 25.55638909727432 30.23255813953488 22.380595148787197 4 23.625 33.775 23.175 19.425 5 23.761880940470235 36.69334667333667 22.136068034017008 17.408704352176088 6 19.904976244061015 35.65891472868217 24.681170292573142 19.754938734683673 7 20.200250312891114 17.822277847309138 40.30037546933667 21.67709637046308 8 21.405351337834457 22.55563890972743 28.33208302075519 27.70692673168292 9 22.13053263315829 25.256314078519633 29.107276819204802 23.50587646911728 10-14 23.67118355917796 28.94644732236612 25.306265313265662 22.076103805190257 15-19 23.050372667700465 28.372767745485465 27.632434595568007 20.94442499124606 20-24 23.664313254218616 28.40618897401232 26.813880126182966 21.1156176455861 25-29 22.970197846230906 28.01402454295016 27.262709742048585 21.753067868770348 30-34 23.21911632100992 28.639414888287746 26.83097885983368 21.310489930868652 35-39 23.847966705109563 27.76914205485634 27.393070250213107 20.98982098982099 40-44 23.337176081399427 28.11889128364493 27.377073830885667 21.16685880406997 45-49 23.237532545563788 28.569997997196072 27.233126376927697 20.959343080312436 50-54 23.12424969987995 28.30132052821128 27.465986394557824 21.10844337735094 55-59 23.83357503625544 28.059208881332196 26.859028854328148 21.248187228084213 60-64 23.509701940388076 28.305661132226444 27.08041608321664 21.104220844168832 65-69 24.33621681084054 28.171408570428518 27.091354567728388 20.40102005100255 70-74 24.095 27.33 27.529999999999998 21.044999999999998 75-79 24.396219810990548 27.45137256862843 27.191359567978402 20.96104805240262 80-84 24.511225561278064 28.32641632081604 26.811340567028353 20.351017550877543 85-89 24.761238061903097 28.196409820491024 26.30131506575329 20.741037051852594 90-94 24.27 27.87 27.224999999999998 20.635 95-99 23.865 29.115000000000002 26.650000000000002 20.369999999999997 100-104 24.335 28.1 26.57 20.995 105-109 23.535 27.985 27.685 20.794999999999998 110-114 24.215 27.57 27.169999999999998 21.044999999999998 115-119 24.42 28.854999999999997 26.455000000000002 20.27 120-124 24.235 28.515 27.084999999999997 20.165 125-129 24.615000000000002 27.88 27.224999999999998 20.28 130-134 25.355 27.92 26.784999999999997 19.939999999999998 135-139 25.130000000000003 27.644999999999996 26.915 20.31 140-144 24.959999999999997 28.084999999999997 26.995 19.96 145-149 25.05 27.744999999999997 26.58 20.625 150-151 26.053256657082137 26.96587073384173 26.753344168021005 20.22752844105513 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 1.5 25 1.0 26 3.0 27 3.0 28 0.5 29 2.5 30 5.5 31 6.0 32 13.0 33 25.0 34 33.0 35 42.0 36 63.0 37 87.5 38 110.5 39 152.0 40 175.5 41 222.0 42 264.5 43 263.0 44 289.5 45 317.5 46 297.0 47 266.0 48 250.5 49 236.0 50 198.5 51 144.0 52 118.5 53 103.0 54 77.0 55 57.5 56 47.0 57 31.5 58 25.5 59 18.0 60 10.5 61 8.5 62 6.5 63 6.5 64 4.0 65 1.5 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.05 3 0.025 4 0.0 5 0.05 6 0.025 7 0.125 8 0.025 9 0.025 10-14 0.005 15-19 0.045 20-24 0.145 25-29 0.17500000000000002 30-34 0.19 35-39 0.28500000000000003 40-44 0.245 45-49 0.13999999999999999 50-54 0.04 55-59 0.015 60-64 0.02 65-69 0.005 70-74 0.0 75-79 0.005 80-84 0.005 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.8875 0.0 0.0 0.0 0.0 118-119 2.2 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.775 0.0 0.0 0.0 0.0 128-129 4.1625 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 5.0375 0.0 0.0 0.0 0.0 134-135 5.5 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTGCA 10 0.006830828 145.0 4 CGGTTTC 10 0.006830828 145.0 2 >>END_MODULE Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra Read 940008 spots for SRR7180111.sra Written 940008 spots for SRR7180111.sra Read 939990 spots for SRR7180111.sra Written 939990 spots for SRR7180111.sra SRR ids: ['SRR7180111.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_60xsq8s_ SRR7180111.sra spots: 18799818 blocks: [[1, 939990], [939991, 1879980], [1879981, 2819970], [2819971, 3759960], [3759961, 4699950], [4699951, 5639940], [5639941, 6579930], [6579931, 7519920], [7519921, 8459910], [8459911, 9399900], [9399901, 10339890], [10339891, 11279880], [11279881, 12219870], [12219871, 13159860], [13159861, 14099850], [14099851, 15039840], [15039841, 15979830], [15979831, 16919820], [16919821, 17859810], [17859811, 18799818]] SRR7180111 file size 6348941 SRR7180111 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180111 SRR7180111_1.fastq SRR7180111_2.fastq Input file: SRR7180111_1.fastq Paired file: SRR7180111_2.fastq trimmed: SRR7180111-trimmed-pair1.fastq, SRR7180111-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:07:15 2025 >> started Mon Feb 10 20:07:39 2025 >> done (23.127s) 18799818 read pairs processed; of these: 22899 ( 0.12%) short read pairs filtered out after trimming by size control 21322 ( 0.11%) empty read pairs filtered out after trimming by size control 18755597 (99.76%) read pairs available; of these: 7331623 (39.09%) trimmed read pairs available after processing 11423974 (60.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 5 0.00% 21 0 0.00% 22 4 0.00% 23 2 0.00% 24 6 0.00% 25 5 0.00% 26 7 0.00% 27 4 0.00% 28 4 0.00% 29 8 0.00% 30 7 0.00% 31 3 0.00% 32 7 0.00% 33 4 0.00% 34 3 0.00% 35 5 0.00% 36 8 0.00% 37 27 0.00% 38 4 0.00% 39 2 0.00% 40 40 0.00% 41 41 0.00% 42 7 0.00% 43 16 0.00% 44 35 0.00% 45 87 0.00% 46 74 0.00% 47 14 0.00% 48 32 0.00% 49 91 0.00% 50 135 0.00% 51 72 0.00% 52 60 0.00% 53 52 0.00% 54 98 0.00% 55 168 0.00% 56 63 0.00% 57 67 0.00% 58 64 0.00% 59 252 0.00% 60 145 0.00% 61 91 0.00% 62 117 0.00% 63 137 0.00% 64 194 0.00% 65 185 0.00% 66 206 0.00% 67 230 0.00% 68 297 0.00% 69 359 0.00% 70 366 0.00% 71 444 0.00% 72 530 0.00% 73 624 0.00% 74 685 0.00% 75 815 0.00% 76 967 0.01% 77 1167 0.01% 78 1329 0.01% 79 1340 0.01% 80 1556 0.01% 81 1748 0.01% 82 2023 0.01% 83 2351 0.01% 84 3548 0.02% 85 4374 0.02% 86 4883 0.03% 87 5243 0.03% 88 5781 0.03% 89 6166 0.03% 90 6409 0.03% 91 6881 0.04% 92 7355 0.04% 93 7963 0.04% 94 8591 0.05% 95 9435 0.05% 96 10023 0.05% 97 10601 0.06% 98 11392 0.06% 99 12412 0.07% 100 13077 0.07% 101 13977 0.07% 102 14616 0.08% 103 15620 0.08% 104 16822 0.09% 105 17477 0.09% 106 19036 0.10% 107 19914 0.11% 108 21478 0.11% 109 22316 0.12% 110 23994 0.13% 111 24963 0.13% 112 26121 0.14% 113 27444 0.15% 114 28439 0.15% 115 29672 0.16% 116 31386 0.17% 117 32935 0.18% 118 34938 0.19% 119 37063 0.20% 120 37996 0.20% 121 40443 0.22% 122 41442 0.22% 123 42153 0.22% 124 44475 0.24% 125 45206 0.24% 126 46999 0.25% 127 48932 0.26% 128 51464 0.27% 129 53377 0.28% 130 54922 0.29% 131 57650 0.31% 132 60355 0.32% 133 62945 0.34% 134 65132 0.35% 135 67718 0.36% 136 70242 0.37% 137 74009 0.39% 138 77414 0.41% 139 82347 0.44% 140 86966 0.46% 141 93015 0.50% 142 102201 0.54% 143 110457 0.59% 144 124641 0.66% 145 142082 0.76% 146 170843 0.91% 147 217994 1.16% 148 320993 1.71% 149 615147 3.28% 150 3610223 19.25% 151 11423974 60.91% 18755597 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=23 prefix-density=0.43 prefix-fanout=3.0 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=412.64 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=34.3 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=35 prefix-density=0.57 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=284.33 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=29.4 sequence=GAAGAAGAAGAAA SRR7180111 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:08:31 Started mapping on | Feb 10 20:08:31 Finished on | Feb 10 20:11:09 Mapping speed, Million of reads per hour | 427.34 Number of input reads | 18755597 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17458586 Uniquely mapped reads % | 93.08% Average mapped length | 294.76 Number of splices: Total | 17911607 Number of splices: Annotated (sjdb) | 17591278 Number of splices: GT/AG | 17630425 Number of splices: GC/AG | 222962 Number of splices: AT/AC | 12725 Number of splices: Non-canonical | 45495 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484990 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 54487 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 831266 831266 831266 N_multimapping 484990 484990 484990 N_noFeature 373972 17305996 435715 N_ambiguous 174610 760 83427 UnstrandedReadsAssigned:16910004 PositiveStrandReadsAssigned:151830 NegativeStrandReadsAssigned:16939444 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180111 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180111-trimmed-pair1.fastq SRR7180111-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,755,597 reads, 16,833,353 reads pseudoaligned [quant] estimated average fragment length: 233.549 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR7180111.ke.tsv 34699 SRR7180111.se.tsv 87100 total ==> SRR7180111.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.45 1202 36.9473 Potri.005G024800.1.v4.1 1035 802.451 229 15.6619 Potri.004G059700.1.v4.1 961 728.466 42 3.16422 Potri.007G009000.2.v4.1 1416 1183.45 0 0 Potri.003G141000.2.v4.1 2943 2710.45 560 11.339 Potri.016G087400.1.v4.1 270 82.1927 1591.58 1062.73 Potri.015G069301.1.v4.1 564 334.872 0 0 Potri.010G195200.1.v4.1 1773 1540.45 353 12.5763 Potri.012G127500.1.v4.1 977 744.461 5304 391.01 ==> SRR7180111.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 69 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 526 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 299 SRR7180111 completed mapping pipeline successfully