Starting /dee2/code/volunteer_pipeline.sh SRR7180112 current disk space = 3056420212736 free memory = 1265295996 SRR7180112 SRAfilesize 7e26a073fc50d0595f22caab4daa7af9 SRR7180112.sra SRR7180112.sra file validated SRR7180112 is paired end SRR7180112 is conventional basespace SRR7180112 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180112_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.1275 18.0 18.0 33.0 18.0 33.0 2 28.173 29.0 25.0 33.0 18.0 33.0 3 30.73725 31.0 29.0 33.0 27.0 33.0 4 31.8655 33.0 31.0 33.0 29.0 33.0 5 32.63325 33.0 33.0 33.0 32.0 34.0 6 36.42425 38.0 36.0 38.0 34.0 38.0 7 37.1545 38.0 38.0 38.0 36.0 38.0 8 37.50775 38.0 38.0 38.0 37.0 38.0 9 37.609 38.0 38.0 38.0 38.0 38.0 10-14 37.6708 38.0 38.0 38.0 38.0 38.0 15-19 37.690149999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.643600000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.630050000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.59665 38.0 38.0 38.0 38.0 38.0 35-39 37.523700000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.52035 38.0 38.0 38.0 38.0 38.0 45-49 37.5292 38.0 38.0 38.0 37.8 38.0 50-54 37.4794 38.0 38.0 38.0 37.6 38.0 55-59 37.43055 38.0 38.0 38.0 37.0 38.0 60-64 37.37965 38.0 38.0 38.0 37.0 38.0 65-69 37.34725 38.0 38.0 38.0 37.0 38.0 70-74 37.2855 38.0 38.0 38.0 36.8 38.0 75-79 37.2755 38.0 38.0 38.0 36.8 38.0 80-84 37.1646 38.0 38.0 38.0 36.2 38.0 85-89 37.1528 38.0 38.0 38.0 36.2 38.0 90-94 37.03565 38.0 38.0 38.0 36.0 38.0 95-99 37.00465 38.0 38.0 38.0 35.8 38.0 100-104 36.8409 38.0 38.0 38.0 35.2 38.0 105-109 36.6823 38.0 38.0 38.0 34.8 38.0 110-114 36.662349999999996 38.0 38.0 38.0 34.2 38.0 115-119 36.562349999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.4331 38.0 38.0 38.0 34.0 38.0 125-129 36.3019 38.0 37.8 38.0 33.8 38.0 130-134 36.043150000000004 38.0 37.0 38.0 33.2 38.0 135-139 35.86615 38.0 36.4 38.0 32.8 38.0 140-144 35.6228 38.0 36.0 38.0 31.8 38.0 145-149 35.27915 38.0 36.0 38.0 31.0 38.0 150-151 32.282375 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 2.0 18 0.0 19 2.0 20 2.0 21 3.0 22 3.0 23 5.0 24 3.0 25 6.0 26 6.0 27 15.0 28 14.0 29 19.0 30 26.0 31 42.0 32 50.0 33 79.0 34 120.0 35 195.0 36 664.0 37 2741.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.69579030976966 15.67381519724649 13.158591474715383 34.47180301826847 2 22.336168084042022 21.03551775887944 34.86743371685843 21.76088044022011 3 20.599999999999998 27.224999999999998 26.974999999999998 25.2 4 22.625 32.85 22.7 21.825 5 22.05 34.825 24.275 18.85 6 17.2 34.35 26.424999999999997 22.025 7 13.975000000000001 21.475 47.15 17.4 8 18.099999999999998 21.95 31.45 28.499999999999996 9 19.35 21.975 32.35 26.325 10-14 20.4 28.26 26.51 24.83 15-19 19.400000000000002 28.325 28.634999999999998 23.64 20-24 20.14 28.83 27.12 23.91 25-29 20.135 28.799999999999997 27.705000000000002 23.36 30-34 19.99 28.884999999999998 27.43 23.695 35-39 20.064999999999998 28.595 27.865000000000002 23.474999999999998 40-44 20.225 28.57 27.88 23.325000000000003 45-49 20.235 28.79 27.905 23.07 50-54 19.919999999999998 28.610000000000003 28.249999999999996 23.22 55-59 19.61 27.67 28.860000000000003 23.86 60-64 20.349999999999998 28.035 27.965 23.65 65-69 20.0 28.599999999999998 27.815 23.585 70-74 20.1 28.444999999999997 27.224999999999998 24.23 75-79 19.74 27.985 28.249999999999996 24.025 80-84 20.585 27.834999999999997 28.43 23.150000000000002 85-89 20.39 28.310000000000002 27.700000000000003 23.599999999999998 90-94 20.41 28.235 27.675 23.68 95-99 20.22 28.395 27.975 23.41 100-104 20.995 28.215 27.35 23.44 105-109 20.75 27.365000000000002 28.74 23.145 110-114 20.3 28.349999999999998 27.584999999999997 23.765 115-119 20.855 27.985 27.884999999999998 23.275000000000002 120-124 20.53 27.595 28.27 23.605 125-129 20.715 27.639999999999997 27.644999999999996 24.0 130-134 20.18 28.775000000000002 27.555000000000003 23.49 135-139 20.64 28.315 27.52 23.525 140-144 20.355 28.095 28.205000000000002 23.345 145-149 20.560000000000002 27.884999999999998 27.884999999999998 23.669999999999998 150-151 21.034180543382995 28.208338550143985 26.956303993990232 23.801176912482784 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 3.0 22 3.5 23 3.0 24 1.0 25 1.0 26 0.5 27 3.0 28 6.5 29 16.5 30 21.5 31 18.5 32 27.0 33 41.0 34 51.0 35 70.5 36 93.0 37 109.0 38 138.5 39 170.0 40 207.0 41 237.5 42 267.0 43 266.5 44 268.5 45 285.0 46 270.5 47 257.5 48 225.0 49 189.0 50 164.5 51 139.0 52 107.0 53 79.0 54 65.0 55 50.5 56 35.0 57 26.5 58 20.0 59 11.5 60 12.0 61 14.0 62 7.5 63 3.5 64 2.0 65 1.5 66 2.0 67 2.5 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.575 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.3375 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.3 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.8625 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTG 10 0.006841402 144.925 3 GTGCTTC 10 0.006841402 144.925 9 >>END_MODULE SRR7180112 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180112_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06625 33.0 33.0 34.0 33.0 34.0 2 33.196 34.0 33.0 34.0 33.0 34.0 3 33.23725 34.0 33.0 34.0 33.0 34.0 4 33.1855 34.0 33.0 34.0 33.0 34.0 5 33.23 34.0 33.0 34.0 33.0 34.0 6 37.3175 38.0 38.0 38.0 37.0 38.0 7 37.4325 38.0 38.0 38.0 37.0 38.0 8 37.39125 38.0 38.0 38.0 38.0 38.0 9 37.3275 38.0 38.0 38.0 38.0 38.0 10-14 37.4091 38.0 38.0 38.0 37.6 38.0 15-19 37.3183 38.0 38.0 38.0 37.0 38.0 20-24 37.354949999999995 38.0 38.0 38.0 37.6 38.0 25-29 37.33165 38.0 38.0 38.0 37.4 38.0 30-34 37.2747 38.0 38.0 38.0 37.0 38.0 35-39 37.2128 38.0 38.0 38.0 37.0 38.0 40-44 37.1269 38.0 38.0 38.0 37.0 38.0 45-49 37.154399999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.2014 38.0 38.0 38.0 37.0 38.0 55-59 37.149649999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.119749999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.02505 38.0 38.0 38.0 36.2 38.0 70-74 37.01205 38.0 38.0 38.0 36.0 38.0 75-79 36.949200000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.89895 38.0 38.0 38.0 36.0 38.0 85-89 36.779999999999994 38.0 38.0 38.0 35.4 38.0 90-94 36.6533 38.0 38.0 38.0 35.2 38.0 95-99 36.634249999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.44695 38.0 38.0 38.0 34.2 38.0 105-109 36.328649999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.2102 38.0 38.0 38.0 34.0 38.0 115-119 36.12555 38.0 38.0 38.0 34.0 38.0 120-124 35.90615 38.0 37.2 38.0 33.2 38.0 125-129 35.621050000000004 38.0 37.0 38.0 31.2 38.0 130-134 35.46235 38.0 36.2 38.0 31.4 38.0 135-139 34.994 38.0 36.0 38.0 28.6 38.0 140-144 34.8155 38.0 35.6 38.0 28.0 38.0 145-149 34.319 38.0 34.8 38.0 26.8 38.0 150-151 30.792749999999998 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 0.0 5 0.0 6 3.0 7 1.0 8 1.0 9 0.0 10 2.0 11 1.0 12 1.0 13 2.0 14 2.0 15 4.0 16 4.0 17 4.0 18 2.0 19 5.0 20 3.0 21 4.0 22 4.0 23 4.0 24 6.0 25 13.0 26 14.0 27 14.0 28 18.0 29 29.0 30 38.0 31 38.0 32 64.0 33 88.0 34 118.0 35 233.0 36 555.0 37 2718.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.68467116779195 15.95398849712428 17.404351087771943 27.956989247311824 2 25.0 21.45 35.75 17.8 3 20.05 26.8 30.725 22.425 4 23.075000000000003 35.175 22.55 19.2 5 25.85 35.725 20.925 17.5 6 18.65 37.925 22.725 20.7 7 18.175 16.950000000000003 43.35 21.525 8 19.929982495623904 23.95598899724931 27.056764191047762 29.057264316079017 9 22.475 24.375 28.375 24.775 10-14 23.615 28.544999999999998 25.545 22.295 15-19 22.95114755737787 28.32141607080354 27.751387569378466 20.976048802440122 20-24 22.32281298454459 28.765067773720805 27.52463362176762 21.387485619966988 25-29 23.006411540773392 28.97214986976558 27.17892205970747 20.842516529753556 30-34 22.902255639097742 27.924812030075184 27.994987468671678 21.17794486215539 35-39 23.014042126379135 28.465396188565695 27.29689067201605 21.223671013039116 40-44 22.816166883963493 28.34720690001003 28.096479791395048 20.74014642463143 45-49 23.11275860341632 28.51775785202625 27.35560787456795 21.01387566998948 50-54 22.929585917183438 28.565713142628525 26.875375075015 21.629325865173037 55-59 22.69340401060159 28.189228384257635 28.164224633695056 20.95314297144572 60-64 23.176158807940396 28.56642832141607 27.366368318415923 20.891044552227612 65-69 23.251162558127906 28.121406070303518 27.65638281914096 20.97104855242762 70-74 23.845 28.110000000000003 27.474999999999998 20.57 75-79 23.294999999999998 27.944999999999997 27.505000000000003 21.255 80-84 23.026151307565378 28.366418320916047 27.69638481924096 20.911045552277614 85-89 23.645 28.449999999999996 27.694999999999997 20.21 90-94 23.23 28.28 27.71 20.78 95-99 23.95 28.26 27.38 20.41 100-104 23.805 28.13 27.0 21.065 105-109 23.345 27.884999999999998 27.72 21.05 110-114 23.9 28.365000000000002 27.55 20.185 115-119 23.405 28.485 27.18 20.93 120-124 24.015 28.189999999999998 27.950000000000003 19.845 125-129 24.505 27.639999999999997 28.17 19.685 130-134 23.549999999999997 28.525 27.355 20.57 135-139 23.875 27.88 27.88 20.365 140-144 23.93 27.47 28.134999999999998 20.465 145-149 23.79 28.04 27.68 20.49 150-151 24.363636363636363 29.065830721003135 26.75862068965517 19.81191222570533 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 2.5 26 3.5 27 4.0 28 4.5 29 6.0 30 9.5 31 14.5 32 20.0 33 21.5 34 36.0 35 61.0 36 78.0 37 94.5 38 130.0 39 170.5 40 209.0 41 247.5 42 272.5 43 279.5 44 283.5 45 292.0 46 283.0 47 248.5 48 221.5 49 214.5 50 174.5 51 131.5 52 113.5 53 103.0 54 79.5 55 46.5 56 27.5 57 23.0 58 22.0 59 17.0 60 15.5 61 11.0 62 5.5 63 4.5 64 5.0 65 3.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.005 20-24 0.034999999999999996 25-29 0.18 30-34 0.25 35-39 0.3 40-44 0.29 45-49 0.185 50-54 0.02 55-59 0.015 60-64 0.005 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.7875 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.1375000000000002 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.45 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.5875 0.0 0.0 0.0 0.0 134-135 2.8625 0.0 0.0 0.0 0.0 136-137 3.0875 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACTTT 10 0.006867937 144.7375 3 TTTCTCC 10 0.006867937 144.7375 8 >>END_MODULE Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra Read 792797 spots for SRR7180112.sra Written 792797 spots for SRR7180112.sra Read 792780 spots for SRR7180112.sra Written 792780 spots for SRR7180112.sra SRR ids: ['SRR7180112.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_puwg3avp SRR7180112.sra spots: 15855617 blocks: [[1, 792780], [792781, 1585560], [1585561, 2378340], [2378341, 3171120], [3171121, 3963900], [3963901, 4756680], [4756681, 5549460], [5549461, 6342240], [6342241, 7135020], [7135021, 7927800], [7927801, 8720580], [8720581, 9513360], [9513361, 10306140], [10306141, 11098920], [11098921, 11891700], [11891701, 12684480], [12684481, 13477260], [13477261, 14270040], [14270041, 15062820], [15062821, 15855617]] SRR7180112 file size 5351247 SRR7180112 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180112 SRR7180112_1.fastq SRR7180112_2.fastq Input file: SRR7180112_1.fastq Paired file: SRR7180112_2.fastq trimmed: SRR7180112-trimmed-pair1.fastq, SRR7180112-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:54:32 2025 >> started Mon Feb 10 19:54:50 2025 >> done (18.102s) 15855617 read pairs processed; of these: 11487 ( 0.07%) short read pairs filtered out after trimming by size control 8329 ( 0.05%) empty read pairs filtered out after trimming by size control 15835801 (99.88%) read pairs available; of these: 5482333 (34.62%) trimmed read pairs available after processing 10353468 (65.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 7 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 5 0.00% 30 3 0.00% 31 1 0.00% 32 3 0.00% 33 1 0.00% 34 4 0.00% 35 4 0.00% 36 5 0.00% 37 1 0.00% 38 3 0.00% 39 2 0.00% 40 7 0.00% 41 1 0.00% 42 5 0.00% 43 5 0.00% 44 6 0.00% 45 12 0.00% 46 9 0.00% 47 10 0.00% 48 8 0.00% 49 7 0.00% 50 11 0.00% 51 16 0.00% 52 18 0.00% 53 18 0.00% 54 26 0.00% 55 28 0.00% 56 34 0.00% 57 37 0.00% 58 50 0.00% 59 49 0.00% 60 50 0.00% 61 36 0.00% 62 61 0.00% 63 61 0.00% 64 93 0.00% 65 94 0.00% 66 84 0.00% 67 109 0.00% 68 125 0.00% 69 124 0.00% 70 142 0.00% 71 148 0.00% 72 195 0.00% 73 244 0.00% 74 265 0.00% 75 298 0.00% 76 360 0.00% 77 398 0.00% 78 482 0.00% 79 485 0.00% 80 532 0.00% 81 695 0.00% 82 784 0.00% 83 863 0.01% 84 1522 0.01% 85 1980 0.01% 86 2152 0.01% 87 2396 0.02% 88 2652 0.02% 89 2814 0.02% 90 3046 0.02% 91 3111 0.02% 92 3291 0.02% 93 3601 0.02% 94 3870 0.02% 95 4179 0.03% 96 4495 0.03% 97 4807 0.03% 98 4945 0.03% 99 5439 0.03% 100 5863 0.04% 101 6149 0.04% 102 6511 0.04% 103 6988 0.04% 104 7445 0.05% 105 8407 0.05% 106 8548 0.05% 107 9282 0.06% 108 9825 0.06% 109 10459 0.07% 110 11218 0.07% 111 11652 0.07% 112 12384 0.08% 113 13075 0.08% 114 13896 0.09% 115 15055 0.10% 116 15792 0.10% 117 16450 0.10% 118 17709 0.11% 119 18672 0.12% 120 20027 0.13% 121 20474 0.13% 122 21860 0.14% 123 22108 0.14% 124 23122 0.15% 125 24289 0.15% 126 25132 0.16% 127 26594 0.17% 128 27674 0.17% 129 29320 0.19% 130 30928 0.20% 131 32573 0.21% 132 34456 0.22% 133 36022 0.23% 134 38079 0.24% 135 40839 0.26% 136 43005 0.27% 137 44958 0.28% 138 48325 0.31% 139 51698 0.33% 140 56160 0.35% 141 61064 0.39% 142 67414 0.43% 143 74555 0.47% 144 85270 0.54% 145 100009 0.63% 146 123157 0.78% 147 164328 1.04% 148 251844 1.59% 149 514790 3.25% 150 3055435 19.29% 151 10353468 65.38% 15835801 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.72 fanout-score-rank=23 prefix-density=0.25 prefix-fanout=3.6 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=478.27 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=36.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=9.91 fanout-score-rank=16 prefix-density=0.27 prefix-fanout=5.9 sequence=GGTGCTGAGAATGGCTGCAAGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=451.80 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=35.3 sequence=AAGAAGAAGAAA SRR7180112 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:55:39 Started mapping on | Feb 10 19:55:39 Finished on | Feb 10 19:58:09 Mapping speed, Million of reads per hour | 380.06 Number of input reads | 15835801 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14463821 Uniquely mapped reads % | 91.34% Average mapped length | 296.98 Number of splices: Total | 14884488 Number of splices: Annotated (sjdb) | 14581191 Number of splices: GT/AG | 14636061 Number of splices: GC/AG | 196180 Number of splices: AT/AC | 10824 Number of splices: Non-canonical | 41423 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 387242 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 41589 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.88% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 997442 997442 997442 N_multimapping 387242 387242 387242 N_noFeature 407658 14332197 468523 N_ambiguous 148247 970 76922 UnstrandedReadsAssigned:13907916 PositiveStrandReadsAssigned:130654 NegativeStrandReadsAssigned:13918376 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180112 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180112-trimmed-pair1.fastq SRR7180112-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,835,801 reads, 13,812,416 reads pseudoaligned [quant] estimated average fragment length: 256.322 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR7180112.ke.tsv 34699 SRR7180112.se.tsv 87100 total ==> SRR7180112.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.68 1584 66.8562 Potri.005G024800.1.v4.1 1035 779.678 163 15.5536 Potri.004G059700.1.v4.1 961 705.722 27 2.84636 Potri.007G009000.2.v4.1 1416 1160.68 0 0 Potri.003G141000.2.v4.1 2943 2687.68 546.187 15.119 Potri.016G087400.1.v4.1 270 72.9181 799 815.213 Potri.015G069301.1.v4.1 564 314.578 0 0 Potri.010G195200.1.v4.1 1773 1517.68 509.849 24.9932 Potri.012G127500.1.v4.1 977 721.706 5007 516.151 ==> SRR7180112.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 450 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 464 SRR7180112 completed mapping pipeline successfully