Starting /dee2/code/volunteer_pipeline.sh SRR7180113 current disk space = 3056060030976 free memory = 1505146760 SRR7180113 SRAfilesize 4debce80a572ad07daca1c23bdbdeca3 SRR7180113.sra SRR7180113.sra file validated SRR7180113 is paired end SRR7180113 is conventional basespace SRR7180113 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180113_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.31975 33.0 18.0 33.0 18.0 34.0 2 30.3235 31.0 29.0 33.0 27.0 33.0 3 31.12025 33.0 31.0 33.0 27.0 33.0 4 32.32725 33.0 33.0 33.0 31.0 34.0 5 32.6955 33.0 33.0 33.0 32.0 34.0 6 36.83825 38.0 37.0 38.0 35.0 38.0 7 37.33225 38.0 38.0 38.0 36.0 38.0 8 37.568 38.0 38.0 38.0 37.0 38.0 9 37.64425 38.0 38.0 38.0 38.0 38.0 10-14 37.693349999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.67315 38.0 38.0 38.0 38.0 38.0 20-24 37.6534 38.0 38.0 38.0 38.0 38.0 25-29 37.642849999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.6134 38.0 38.0 38.0 38.0 38.0 35-39 37.576550000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.5564 38.0 38.0 38.0 38.0 38.0 45-49 37.57234999999999 38.0 38.0 38.0 38.0 38.0 50-54 37.515550000000005 38.0 38.0 38.0 37.8 38.0 55-59 37.50385 38.0 38.0 38.0 37.2 38.0 60-64 37.432249999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.4096 38.0 38.0 38.0 37.0 38.0 70-74 37.337900000000005 38.0 38.0 38.0 37.0 38.0 75-79 37.34665 38.0 38.0 38.0 37.0 38.0 80-84 37.22275 38.0 38.0 38.0 36.6 38.0 85-89 37.2011 38.0 38.0 38.0 36.6 38.0 90-94 37.09565 38.0 38.0 38.0 36.0 38.0 95-99 37.037749999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.95465 38.0 38.0 38.0 35.8 38.0 105-109 36.7329 38.0 38.0 38.0 35.0 38.0 110-114 36.68975 38.0 38.0 38.0 35.0 38.0 115-119 36.5894 38.0 38.0 38.0 34.4 38.0 120-124 36.5485 38.0 38.0 38.0 34.2 38.0 125-129 36.4163 38.0 38.0 38.0 34.0 38.0 130-134 36.1078 38.0 37.6 38.0 33.2 38.0 135-139 35.972 38.0 37.4 38.0 33.0 38.0 140-144 35.7498 38.0 36.6 38.0 33.0 38.0 145-149 35.46365000000001 38.0 36.0 38.0 31.8 38.0 150-151 32.752250000000004 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 1.0 17 3.0 18 3.0 19 3.0 20 0.0 21 2.0 22 8.0 23 5.0 24 2.0 25 2.0 26 8.0 27 8.0 28 17.0 29 16.0 30 27.0 31 35.0 32 48.0 33 69.0 34 99.0 35 167.0 36 523.0 37 2951.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.941050375133976 15.27331189710611 12.808145766345122 36.97749196141479 2 21.231847771657485 19.604406609914875 37.105658487731596 22.058087130696045 3 19.075 27.1 27.325 26.5 4 22.575 33.425 22.6 21.4 5 21.0 35.449999999999996 24.4 19.15 6 17.575 35.675000000000004 25.374999999999996 21.375 7 13.375 21.8 44.824999999999996 20.0 8 18.975 22.2 30.2 28.625 9 17.9 23.225 32.074999999999996 26.8 10-14 20.25 28.565 27.35 23.835 15-19 20.005 28.53 27.47 23.995 20-24 19.71 28.205000000000002 27.71 24.375 25-29 19.965 28.34 27.88 23.815 30-34 20.215 28.07 27.83 23.885 35-39 20.424999999999997 28.360000000000003 27.555000000000003 23.66 40-44 19.88 28.12 28.475 23.525 45-49 20.535 27.450000000000003 27.744999999999997 24.27 50-54 19.945 28.494999999999997 27.455000000000002 24.104999999999997 55-59 20.32 27.445000000000004 28.125 24.11 60-64 20.015 27.779999999999998 28.08 24.125 65-69 20.34 27.634999999999998 28.26 23.765 70-74 20.549999999999997 27.975 27.400000000000002 24.075 75-79 19.935 27.13 28.470000000000002 24.465 80-84 20.39 27.255000000000003 27.82 24.535 85-89 20.84 27.85 27.705000000000002 23.605 90-94 20.13 27.834999999999997 27.92 24.115000000000002 95-99 21.01 27.61 27.435 23.945 100-104 20.905 27.955000000000002 27.584999999999997 23.555 105-109 20.375 27.57 28.115000000000002 23.94 110-114 19.77 28.360000000000003 27.51 24.36 115-119 20.765 28.375 27.245 23.615 120-124 21.01 27.735 27.775 23.48 125-129 20.810000000000002 27.860000000000003 27.275 24.055 130-134 21.365000000000002 27.400000000000002 27.62 23.615 135-139 20.915 27.584999999999997 27.439999999999998 24.060000000000002 140-144 21.035 27.985 27.195000000000004 23.785 145-149 20.86 27.98 27.015 24.145 150-151 21.227301189730746 27.050720100187853 27.050720100187853 24.671258609893552 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.0 25 3.5 26 6.0 27 4.5 28 5.5 29 8.5 30 11.0 31 16.5 32 22.0 33 33.5 34 46.5 35 60.5 36 82.0 37 105.5 38 130.0 39 155.0 40 192.5 41 229.5 42 242.0 43 262.5 44 288.5 45 296.0 46 281.0 47 257.0 48 223.0 49 203.0 50 191.0 51 142.0 52 108.0 53 91.0 54 74.0 55 58.0 56 39.5 57 28.5 58 20.5 59 16.5 60 14.0 61 9.5 62 8.0 63 8.0 64 6.0 65 5.0 66 4.5 67 2.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.7 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.6 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.575 0.0 0.0 0.0 0.0 130-131 5.012499999999999 0.0 0.0 0.0 0.0 132-133 5.449999999999999 0.0 0.0 0.0 0.0 134-135 6.2 0.0 0.0 0.0 0.0 136-137 6.75 0.0 0.0 0.0 0.0 138-139 7.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGAAC 30 0.0014466991 24.158335 140-144 >>END_MODULE SRR7180113 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180113_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96475 33.0 33.0 34.0 32.0 34.0 2 33.14275 34.0 33.0 34.0 33.0 34.0 3 33.17175 34.0 33.0 34.0 33.0 34.0 4 33.11475 34.0 33.0 34.0 33.0 34.0 5 33.15675 34.0 33.0 34.0 33.0 34.0 6 37.22 38.0 38.0 38.0 37.0 38.0 7 37.3015 38.0 38.0 38.0 37.0 38.0 8 37.25 38.0 38.0 38.0 37.0 38.0 9 37.22425 38.0 38.0 38.0 37.0 38.0 10-14 37.27805 38.0 38.0 38.0 37.0 38.0 15-19 37.187400000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.18545 38.0 38.0 38.0 37.0 38.0 25-29 37.1747 38.0 38.0 38.0 37.0 38.0 30-34 37.18845 38.0 38.0 38.0 37.0 38.0 35-39 37.07895 38.0 38.0 38.0 37.0 38.0 40-44 37.0264 38.0 38.0 38.0 37.0 38.0 45-49 37.05875 38.0 38.0 38.0 37.0 38.0 50-54 37.1221 38.0 38.0 38.0 37.0 38.0 55-59 37.0589 38.0 38.0 38.0 36.8 38.0 60-64 37.018100000000004 38.0 38.0 38.0 36.2 38.0 65-69 36.949799999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.90845 38.0 38.0 38.0 36.0 38.0 75-79 36.86965 38.0 38.0 38.0 36.0 38.0 80-84 36.842999999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.6989 38.0 38.0 38.0 35.2 38.0 90-94 36.59715 38.0 38.0 38.0 35.0 38.0 95-99 36.60925 38.0 38.0 38.0 34.6 38.0 100-104 36.42915 38.0 38.0 38.0 34.0 38.0 105-109 36.3506 38.0 38.0 38.0 34.0 38.0 110-114 36.24325 38.0 38.0 38.0 34.0 38.0 115-119 36.00325 38.0 37.6 38.0 33.2 38.0 120-124 35.833 38.0 37.2 38.0 32.2 38.0 125-129 35.49565 38.0 36.8 38.0 31.0 38.0 130-134 35.21835 38.0 36.0 38.0 30.0 38.0 135-139 34.837450000000004 38.0 35.8 38.0 27.4 38.0 140-144 34.5707 38.0 35.0 38.0 27.0 38.0 145-149 33.966300000000004 38.0 34.6 38.0 24.2 38.0 150-151 30.303125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 1.0 6 2.0 7 1.0 8 2.0 9 2.0 10 0.0 11 1.0 12 4.0 13 2.0 14 0.0 15 2.0 16 1.0 17 4.0 18 5.0 19 5.0 20 6.0 21 3.0 22 6.0 23 8.0 24 11.0 25 16.0 26 11.0 27 25.0 28 17.0 29 27.0 30 34.0 31 49.0 32 55.0 33 103.0 34 116.0 35 198.0 36 619.0 37 2654.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.698372966207764 16.07008760951189 17.171464330413016 28.060075093867333 2 25.324999999999996 21.55 33.95 19.175 3 21.0 26.474999999999998 31.5 21.025 4 24.825 33.75 21.975 19.45 5 24.9 37.325 21.925 15.85 6 19.075 37.325 23.45 20.150000000000002 7 19.454863715928983 18.179544886221557 41.13528382095524 21.230307576894223 8 20.67067067067067 23.923923923923923 29.004004004004003 26.401401401401404 9 22.05 24.0 28.675 25.275 10-14 23.625 28.485 25.695 22.195 15-19 23.06345951892784 28.8293243986598 26.854028104215633 21.25318797819673 20-24 23.469336670838548 28.6107634543179 26.703379224030037 21.216520650813518 25-29 23.155152547467562 28.385351435298833 27.408446470617704 21.051049546615904 30-34 22.886070873640417 28.304345646834744 27.798105358127412 21.011478121397424 35-39 23.52970669340687 28.052143394334422 27.630985209325647 20.787164702933065 40-44 23.361909059006365 28.20474256780468 27.12688624855868 21.306462124630272 45-49 23.54326369056566 28.207826043388945 27.59156270354226 20.65734756250313 50-54 23.16005403512283 28.423475258918295 27.577925651673592 20.838545054285284 55-59 23.502626970227674 28.06104578433825 27.410557918438826 21.025769326995245 60-64 23.512053616084824 27.788336500950283 27.753325997799337 20.94628388516555 65-69 23.927178153446032 28.37851355406622 26.89306792037611 20.801240372111636 70-74 23.932393239323932 28.212821282128214 27.49274927492749 20.362036203620363 75-79 24.42 27.939999999999998 27.485 20.155 80-84 23.812381238123812 28.432843284328435 27.052705270527056 20.7020702070207 85-89 23.995 27.71 27.779999999999998 20.515 90-94 24.035 28.199999999999996 27.26 20.505000000000003 95-99 23.674999999999997 27.905 28.12 20.3 100-104 24.075 28.410000000000004 27.1 20.415 105-109 24.26 28.15 27.67 19.919999999999998 110-114 24.169999999999998 27.43 27.61 20.79 115-119 24.58 27.85 27.115000000000002 20.455000000000002 120-124 24.415 28.075 27.08 20.43 125-129 25.095 28.13 26.615 20.16 130-134 24.69 27.99 27.534999999999997 19.785 135-139 24.905 28.095 26.63 20.369999999999997 140-144 25.624999999999996 28.4 26.545 19.43 145-149 25.535000000000004 28.78 25.955000000000002 19.73 150-151 26.367285499247366 27.784746613146012 26.27947817360763 19.568489713998996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.5 25 3.0 26 3.0 27 3.5 28 5.5 29 5.0 30 7.5 31 14.0 32 18.0 33 27.5 34 40.0 35 48.5 36 63.5 37 86.0 38 123.0 39 163.5 40 193.5 41 241.5 42 276.5 43 285.5 44 287.0 45 298.5 46 283.0 47 253.5 48 243.5 49 218.0 50 174.0 51 141.5 52 114.0 53 81.0 54 69.0 55 59.5 56 42.5 57 27.5 58 24.5 59 20.0 60 15.0 61 9.5 62 5.5 63 6.0 64 6.0 65 3.5 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.1 9 0.0 10-14 0.0 15-19 0.015 20-24 0.125 25-29 0.19499999999999998 30-34 0.245 35-39 0.27499999999999997 40-44 0.265 45-49 0.20500000000000002 50-54 0.065 55-59 0.075 60-64 0.03 65-69 0.03 70-74 0.01 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47156517362859 98.825 2 0.42778057372924005 0.8500000000000001 3 0.0754906894816306 0.22499999999999998 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.975 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.4 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.675 0.0 0.0 0.0 0.0 138-139 7.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGTCGT 35 0.00354369 20.707142 135-139 >>END_MODULE Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901772 spots for SRR7180113.sra Written 901772 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra Read 901758 spots for SRR7180113.sra Written 901758 spots for SRR7180113.sra SRR ids: ['SRR7180113.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ws4x1fmy SRR7180113.sra spots: 18035174 blocks: [[1, 901758], [901759, 1803516], [1803517, 2705274], [2705275, 3607032], [3607033, 4508790], [4508791, 5410548], [5410549, 6312306], [6312307, 7214064], [7214065, 8115822], [8115823, 9017580], [9017581, 9919338], [9919339, 10821096], [10821097, 11722854], [11722855, 12624612], [12624613, 13526370], [13526371, 14428128], [14428129, 15329886], [15329887, 16231644], [16231645, 17133402], [17133403, 18035174]] SRR7180113 file size 6089828 SRR7180113 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180113 SRR7180113_1.fastq SRR7180113_2.fastq Input file: SRR7180113_1.fastq Paired file: SRR7180113_2.fastq trimmed: SRR7180113-trimmed-pair1.fastq, SRR7180113-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:32:04 2025 >> started Mon Feb 10 20:32:24 2025 >> done (20.299s) 18035174 read pairs processed; of these: 17058 ( 0.09%) short read pairs filtered out after trimming by size control 14019 ( 0.08%) empty read pairs filtered out after trimming by size control 18004097 (99.83%) read pairs available; of these: 6835460 (37.97%) trimmed read pairs available after processing 11168637 (62.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 4 0.00% 21 6 0.00% 22 5 0.00% 23 1 0.00% 24 5 0.00% 25 4 0.00% 26 5 0.00% 27 6 0.00% 28 6 0.00% 29 2 0.00% 30 3 0.00% 31 3 0.00% 32 4 0.00% 33 3 0.00% 34 4 0.00% 35 6 0.00% 36 4 0.00% 37 1 0.00% 38 8 0.00% 39 4 0.00% 40 5 0.00% 41 5 0.00% 42 7 0.00% 43 12 0.00% 44 10 0.00% 45 10 0.00% 46 11 0.00% 47 9 0.00% 48 15 0.00% 49 25 0.00% 50 15 0.00% 51 17 0.00% 52 29 0.00% 53 40 0.00% 54 41 0.00% 55 48 0.00% 56 43 0.00% 57 40 0.00% 58 60 0.00% 59 95 0.00% 60 89 0.00% 61 117 0.00% 62 134 0.00% 63 141 0.00% 64 169 0.00% 65 202 0.00% 66 194 0.00% 67 234 0.00% 68 293 0.00% 69 327 0.00% 70 408 0.00% 71 474 0.00% 72 516 0.00% 73 659 0.00% 74 779 0.00% 75 849 0.00% 76 1050 0.01% 77 1193 0.01% 78 1331 0.01% 79 1532 0.01% 80 1727 0.01% 81 1988 0.01% 82 2252 0.01% 83 2629 0.01% 84 3594 0.02% 85 4574 0.03% 86 5054 0.03% 87 5725 0.03% 88 6060 0.03% 89 6604 0.04% 90 7072 0.04% 91 7346 0.04% 92 8006 0.04% 93 8732 0.05% 94 9347 0.05% 95 9823 0.05% 96 10593 0.06% 97 11384 0.06% 98 12202 0.07% 99 13031 0.07% 100 14151 0.08% 101 14892 0.08% 102 15845 0.09% 103 16789 0.09% 104 17916 0.10% 105 19180 0.11% 106 20483 0.11% 107 21346 0.12% 108 22178 0.12% 109 23718 0.13% 110 24765 0.14% 111 26085 0.14% 112 27463 0.15% 113 28860 0.16% 114 30544 0.17% 115 31777 0.18% 116 32956 0.18% 117 34566 0.19% 118 36579 0.20% 119 37765 0.21% 120 39615 0.22% 121 40696 0.23% 122 43324 0.24% 123 43496 0.24% 124 45783 0.25% 125 46308 0.26% 126 47606 0.26% 127 50013 0.28% 128 51333 0.29% 129 53578 0.30% 130 55620 0.31% 131 58344 0.32% 132 59604 0.33% 133 62882 0.35% 134 64879 0.36% 135 68140 0.38% 136 69508 0.39% 137 72438 0.40% 138 76399 0.42% 139 79569 0.44% 140 83778 0.47% 141 89249 0.50% 142 96520 0.54% 143 104323 0.58% 144 115743 0.64% 145 130691 0.73% 146 153417 0.85% 147 195619 1.09% 148 282513 1.57% 149 550653 3.06% 150 3256903 18.09% 151 11168637 62.03% 18004097 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=6.02 fanout-score-rank=17 prefix-density=0.71 prefix-fanout=2.2 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=28.99 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.5 sequence=ACAGCAAATACCAGCGGCCCTGACCCCGGGGAACAGTCGCATGACGAGGCAGTTTCCAGAAACGTGTATCACATCTAGGCATGGAATCTTATGCCAGCTAACGGAACAAGCTTTGTGCCATTCGGACCTACCGTAAGCCTATATTTCGTTTTTCTGAGACCTATCCGAGTTCAGTGCGACCGTACAGCTCTGGAACCCAAAGGTTCGTTTTTTTCTTGGTACCTATTCCTCCAGGAATTACTGACCATAGTGCTCGTACGCTAGTCTAGCCTAGTAAAACCACGATCAGCCGACGGTCTGGATGCCGACGCCCGTATACTGTGAGCAG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=7.36 fanout-score-rank=16 prefix-density=0.38 prefix-fanout=4.9 sequence=GGTGCTGAGAATGGCTGCAAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=191.23 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=17.3 sequence=GATTTTGTTATCTCAAAGCTTACACTGTTTATAGTTTGATTACCTGCGCAACAAAATGACACTCTTTGGTAAGATGGAGGCTGAAGTAGAGATCAAAGTTTCTGCTGAAACATTTCATGATATCTTCAGCTGCAGACCACACCACGTTTCCAATATGAGCCCTGCCAAGATACAGAATGTTGATCTGCATGAAGGTGAATGGG SRR7180113 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:33:11 Started mapping on | Feb 10 20:33:12 Finished on | Feb 10 20:35:50 Mapping speed, Million of reads per hour | 410.22 Number of input reads | 18004097 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16424279 Uniquely mapped reads % | 91.23% Average mapped length | 294.29 Number of splices: Total | 16668277 Number of splices: Annotated (sjdb) | 16369697 Number of splices: GT/AG | 16399205 Number of splices: GC/AG | 214141 Number of splices: AT/AC | 12360 Number of splices: Non-canonical | 42571 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416454 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 50812 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.12% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1179755 1179755 1179755 N_multimapping 416454 416454 416454 N_noFeature 377638 16271339 439719 N_ambiguous 165472 968 74005 UnstrandedReadsAssigned:15881169 PositiveStrandReadsAssigned:151972 NegativeStrandReadsAssigned:15910555 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180113 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180113-trimmed-pair1.fastq SRR7180113-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,004,097 reads, 15,792,797 reads pseudoaligned [quant] estimated average fragment length: 231.052 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR7180113.ke.tsv 34699 SRR7180113.se.tsv 87100 total ==> SRR7180113.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.95 1592 54.6096 Potri.005G024800.1.v4.1 1035 804.948 201 15.3147 Potri.004G059700.1.v4.1 961 730.961 18 1.51029 Potri.007G009000.2.v4.1 1416 1185.95 0 0 Potri.003G141000.2.v4.1 2943 2712.95 700 15.8248 Potri.016G087400.1.v4.1 270 83.8212 1024.13 749.348 Potri.015G069301.1.v4.1 564 337.468 0 0 Potri.010G195200.1.v4.1 1773 1542.95 564 22.4186 Potri.012G127500.1.v4.1 977 746.955 6771 555.955 ==> SRR7180113.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 527 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 507 SRR7180113 completed mapping pipeline successfully