Starting /dee2/code/volunteer_pipeline.sh SRR7180115 current disk space = 3056933023744 free memory = 1572017232 SRR7180115 SRAfilesize 9e2d9957ab9d35204084b81a3797ec98 SRR7180115.sra SRR7180115.sra file validated SRR7180115 is paired end SRR7180115 is conventional basespace SRR7180115 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180115_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.8805 33.0 31.0 34.0 18.0 34.0 2 31.131 33.0 30.0 33.0 27.0 34.0 3 32.23675 33.0 33.0 33.0 29.0 34.0 4 32.33775 33.0 33.0 33.0 31.0 34.0 5 32.9525 33.0 33.0 34.0 32.0 34.0 6 37.176 38.0 37.0 38.0 36.0 38.0 7 37.4475 38.0 38.0 38.0 37.0 38.0 8 37.54175 38.0 38.0 38.0 38.0 38.0 9 37.636 38.0 38.0 38.0 38.0 38.0 10-14 37.6588 38.0 38.0 38.0 38.0 38.0 15-19 37.62975 38.0 38.0 38.0 38.0 38.0 20-24 37.6084 38.0 38.0 38.0 38.0 38.0 25-29 37.618849999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.58555 38.0 38.0 38.0 38.0 38.0 35-39 37.56305 38.0 38.0 38.0 38.0 38.0 40-44 37.520849999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.5081 38.0 38.0 38.0 38.0 38.0 50-54 37.428200000000004 38.0 38.0 38.0 37.2 38.0 55-59 37.4217 38.0 38.0 38.0 37.0 38.0 60-64 37.3887 38.0 38.0 38.0 37.0 38.0 65-69 37.290000000000006 38.0 38.0 38.0 37.0 38.0 70-74 37.27569999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.22785 38.0 38.0 38.0 37.0 38.0 80-84 37.163650000000004 38.0 38.0 38.0 36.4 38.0 85-89 37.11535 38.0 38.0 38.0 36.2 38.0 90-94 37.001400000000004 38.0 38.0 38.0 36.0 38.0 95-99 37.00515 38.0 38.0 38.0 36.0 38.0 100-104 36.86775 38.0 38.0 38.0 35.8 38.0 105-109 36.728449999999995 38.0 38.0 38.0 35.0 38.0 110-114 36.70505 38.0 38.0 38.0 34.8 38.0 115-119 36.53855 38.0 38.0 38.0 34.4 38.0 120-124 36.45285 38.0 38.0 38.0 34.0 38.0 125-129 36.2384 38.0 38.0 38.0 34.0 38.0 130-134 35.9742 38.0 37.6 38.0 33.0 38.0 135-139 35.8834 38.0 36.8 38.0 33.0 38.0 140-144 35.6062 38.0 36.2 38.0 31.8 38.0 145-149 35.326750000000004 38.0 36.0 38.0 31.4 38.0 150-151 32.232124999999996 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 3.0 17 1.0 18 3.0 19 3.0 20 0.0 21 1.0 22 3.0 23 5.0 24 9.0 25 10.0 26 8.0 27 14.0 28 12.0 29 9.0 30 32.0 31 34.0 32 49.0 33 80.0 34 104.0 35 182.0 36 498.0 37 2935.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.11309836927933 14.57127827459232 14.229352972119939 36.086270384008415 2 21.111945905334334 19.25870272977711 37.1900826446281 22.439268720260454 3 19.975 27.1 25.7 27.224999999999998 4 23.025000000000002 31.2 22.85 22.925 5 21.125 34.725 25.25 18.9 6 18.35 35.025 26.325 20.3 7 14.249999999999998 21.7 45.125 18.925 8 18.2 22.650000000000002 30.75 28.4 9 18.475 22.900000000000002 31.900000000000002 26.724999999999998 10-14 20.105 28.93 26.669999999999998 24.295 15-19 19.935 28.155 28.52 23.39 20-24 20.085 28.02 27.99 23.905 25-29 19.68 27.805000000000003 28.54 23.974999999999998 30-34 19.875 28.63 27.99 23.505000000000003 35-39 20.01 28.18 28.12 23.69 40-44 19.814999999999998 29.054999999999996 27.41 23.72 45-49 19.71 28.134999999999998 27.975 24.18 50-54 20.52 28.1 27.689999999999998 23.69 55-59 19.650000000000002 28.535 28.035 23.78 60-64 19.475 28.375 27.584999999999997 24.565 65-69 19.975 27.87 27.884999999999998 24.27 70-74 20.14 28.22 28.52 23.119999999999997 75-79 19.68 27.975 28.04 24.305 80-84 19.825 28.265 27.6 24.310000000000002 85-89 20.095 27.765 28.060000000000002 24.08 90-94 20.39 27.725 27.839999999999996 24.044999999999998 95-99 20.169999999999998 28.189999999999998 27.71 23.93 100-104 19.64 28.249999999999996 28.095 24.015 105-109 20.025000000000002 27.33 29.175 23.47 110-114 20.405 28.194999999999997 27.224999999999998 24.175 115-119 20.57 28.335 27.6 23.494999999999997 120-124 21.349999999999998 27.744999999999997 27.18 23.724999999999998 125-129 21.02 28.060000000000002 27.68 23.24 130-134 20.925 28.560000000000002 27.275 23.24 135-139 21.275 28.23 27.060000000000002 23.435 140-144 21.535 27.73 27.055 23.68 145-149 21.36 28.044999999999998 26.450000000000003 24.145 150-151 21.576971214017522 27.77221526908636 26.395494367959948 24.25531914893617 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.0 24 1.5 25 4.5 26 5.0 27 7.0 28 11.5 29 9.5 30 14.5 31 27.0 32 29.0 33 39.5 34 57.0 35 70.5 36 89.0 37 102.5 38 120.0 39 152.5 40 195.0 41 234.0 42 252.0 43 264.5 44 285.0 45 281.5 46 266.0 47 256.5 48 238.5 49 208.0 50 169.5 51 134.0 52 113.0 53 96.0 54 66.0 55 43.5 56 34.0 57 27.0 58 21.5 59 18.0 60 13.0 61 9.0 62 8.0 63 6.0 64 4.0 65 2.5 66 1.0 67 2.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.95 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.725 0.0 0.0 0.0 0.0 122-123 3.2875 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.112500000000001 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.9375 0.0 0.0 0.0 0.0 132-133 5.425 0.0 0.0 0.0 0.0 134-135 5.9625 0.0 0.0 0.0 0.0 136-137 6.525 0.0 0.0 0.0 0.0 138-139 7.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGGTT 10 0.006836113 144.9625 9 TGGATTG 10 0.006836113 144.9625 2 TTTTTTT 45 0.008966441 48.320835 2 >>END_MODULE SRR7180115 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180115_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9975 33.0 33.0 34.0 32.0 34.0 2 33.13875 34.0 33.0 34.0 33.0 34.0 3 33.204 34.0 33.0 34.0 33.0 34.0 4 33.1905 34.0 33.0 34.0 33.0 34.0 5 33.1395 34.0 33.0 34.0 33.0 34.0 6 37.311 38.0 38.0 38.0 37.0 38.0 7 37.4245 38.0 38.0 38.0 38.0 38.0 8 37.39175 38.0 38.0 38.0 38.0 38.0 9 37.3015 38.0 38.0 38.0 37.0 38.0 10-14 37.335899999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.31305 38.0 38.0 38.0 37.0 38.0 20-24 37.2877 38.0 38.0 38.0 37.0 38.0 25-29 37.31415 38.0 38.0 38.0 37.4 38.0 30-34 37.24225 38.0 38.0 38.0 37.0 38.0 35-39 37.161150000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.10809999999999 38.0 38.0 38.0 36.8 38.0 45-49 37.2181 38.0 38.0 38.0 37.0 38.0 50-54 37.18194999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.1691 38.0 38.0 38.0 37.0 38.0 60-64 37.0844 38.0 38.0 38.0 36.6 38.0 65-69 36.97185 38.0 38.0 38.0 36.0 38.0 70-74 36.9722 38.0 38.0 38.0 36.0 38.0 75-79 36.948750000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.910000000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.80264999999999 38.0 38.0 38.0 35.6 38.0 90-94 36.718650000000004 38.0 38.0 38.0 35.2 38.0 95-99 36.731399999999994 38.0 38.0 38.0 35.0 38.0 100-104 36.527100000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.406 38.0 38.0 38.0 34.0 38.0 110-114 36.27855 38.0 38.0 38.0 34.0 38.0 115-119 36.12929999999999 38.0 37.8 38.0 33.6 38.0 120-124 35.912349999999996 38.0 37.2 38.0 33.2 38.0 125-129 35.64045 38.0 36.8 38.0 31.2 38.0 130-134 35.4276 38.0 36.0 38.0 30.6 38.0 135-139 34.9702 38.0 35.6 38.0 27.6 38.0 140-144 34.5824 38.0 35.0 38.0 27.0 38.0 145-149 34.021899999999995 38.0 34.6 38.0 24.6 38.0 150-151 30.304625 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 2.0 13 2.0 14 0.0 15 3.0 16 2.0 17 1.0 18 1.0 19 4.0 20 1.0 21 4.0 22 6.0 23 11.0 24 11.0 25 10.0 26 15.0 27 22.0 28 16.0 29 25.0 30 35.0 31 69.0 32 55.0 33 84.0 34 153.0 35 199.0 36 563.0 37 2693.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.82912184138104 16.737553164873656 17.363022266700025 27.070302727045288 2 23.599999999999998 22.3 33.95 20.150000000000002 3 21.349999999999998 26.6 30.475 21.575 4 24.775 33.875 22.0 19.35 5 24.8 36.199999999999996 21.525 17.474999999999998 6 19.129782445611404 37.33433358339585 22.930732683170792 20.605151287821954 7 18.25912956478239 17.883941970985493 42.54627313656829 21.310655327663834 8 20.140105078809107 23.267450587940957 28.49637227920941 28.096072054040533 9 22.95 25.624999999999996 27.224999999999998 24.2 10-14 24.345 28.139999999999997 25.790000000000003 21.725 15-19 23.53559101595718 27.947576409384222 27.192236506427893 21.324596068230704 20-24 23.967975981986488 28.786589942456843 26.715036277207904 20.530397798348762 25-29 23.22438560488513 28.504930176685523 27.358726662996148 20.911957555433204 30-34 23.313129289184992 28.893452887842507 27.125181585933976 20.66823623703852 35-39 23.223769916825333 28.87563884156729 27.427597955706982 20.47299328590039 40-44 23.328990880849783 28.239302535324178 27.507766309249426 20.923940274576612 45-49 23.82859431317581 28.178814577492993 26.907288746495794 21.085302362835403 50-54 23.08115680976684 28.840188131692184 27.033923746622634 21.044731311918344 55-59 24.125681693100514 28.043228098263874 27.132636213538802 20.698453995096813 60-64 23.39584896224056 28.06201550387597 27.861965491372843 20.68017004251063 65-69 23.343170109538338 28.444955734507076 27.104486570299606 21.10738758565498 70-74 24.20105026256564 28.432108027006752 26.87671917979495 20.49012253063266 75-79 23.5 28.63 26.979999999999997 20.89 80-84 23.3631771119892 28.765067773720805 27.52463362176762 20.347121492522383 85-89 23.74 28.310000000000002 27.785 20.165 90-94 23.385 28.53 27.389999999999997 20.695 95-99 24.2 27.515 27.755000000000003 20.53 100-104 24.310000000000002 27.965 27.24 20.485 105-109 24.490000000000002 28.22 27.33 19.96 110-114 24.065 27.405 28.315 20.215 115-119 23.9 28.105000000000004 27.529999999999998 20.465 120-124 24.9 28.285 27.08 19.735 125-129 24.63746374637464 28.577857785778576 26.86768676867687 19.916991699169916 130-134 24.615000000000002 27.750000000000004 27.700000000000003 19.935 135-139 24.965 28.13 26.96 19.945 140-144 25.130000000000003 28.035 27.544999999999998 19.29 145-149 25.825 28.4 26.655 19.12 150-151 25.81130184187445 28.59290815687257 26.851271770454833 18.744518230798146 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 2.0 28 3.0 29 5.5 30 8.0 31 12.0 32 17.5 33 20.5 34 31.0 35 45.5 36 70.0 37 96.0 38 115.5 39 160.5 40 202.5 41 233.0 42 260.5 43 278.5 44 297.5 45 309.0 46 304.5 47 271.0 48 242.0 49 214.5 50 179.0 51 143.0 52 113.5 53 93.5 54 71.5 55 49.5 56 35.0 57 31.5 58 21.0 59 12.5 60 11.0 61 11.0 62 6.0 63 2.5 64 2.5 65 1.5 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.05 8 0.075 9 0.0 10-14 0.0 15-19 0.045 20-24 0.075 25-29 0.105 30-34 0.185 35-39 0.21 40-44 0.21 45-49 0.12 50-54 0.06999999999999999 55-59 0.065 60-64 0.025 65-69 0.034999999999999996 70-74 0.025 75-79 0.0 80-84 0.034999999999999996 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.4125 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.8625 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.6 0.0 0.0 0.0 0.0 134-135 6.1875 0.0 0.0 0.0 0.0 136-137 6.7125 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGTCC 10 0.006830828 145.0 5 TTAGGGT 10 0.006830828 145.0 9 >>END_MODULE Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra Read 785536 spots for SRR7180115.sra Written 785536 spots for SRR7180115.sra Read 785535 spots for SRR7180115.sra Written 785535 spots for SRR7180115.sra SRR ids: ['SRR7180115.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oc1q7kgq SRR7180115.sra spots: 15710701 blocks: [[1, 785535], [785536, 1571070], [1571071, 2356605], [2356606, 3142140], [3142141, 3927675], [3927676, 4713210], [4713211, 5498745], [5498746, 6284280], [6284281, 7069815], [7069816, 7855350], [7855351, 8640885], [8640886, 9426420], [9426421, 10211955], [10211956, 10997490], [10997491, 11783025], [11783026, 12568560], [12568561, 13354095], [13354096, 14139630], [14139631, 14925165], [14925166, 15710701]] SRR7180115 file size 5302140 SRR7180115 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180115 SRR7180115_1.fastq SRR7180115_2.fastq Input file: SRR7180115_1.fastq Paired file: SRR7180115_2.fastq trimmed: SRR7180115-trimmed-pair1.fastq, SRR7180115-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:18:54 2025 >> started Mon Feb 10 21:19:11 2025 >> done (17.012s) 15710701 read pairs processed; of these: 16784 ( 0.11%) short read pairs filtered out after trimming by size control 9571 ( 0.06%) empty read pairs filtered out after trimming by size control 15684346 (99.83%) read pairs available; of these: 5832187 (37.18%) trimmed read pairs available after processing 9852159 (62.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 8 0.00% 22 6 0.00% 23 0 0.00% 24 4 0.00% 25 2 0.00% 26 4 0.00% 27 5 0.00% 28 9 0.00% 29 9 0.00% 30 6 0.00% 31 5 0.00% 32 7 0.00% 33 7 0.00% 34 4 0.00% 35 6 0.00% 36 7 0.00% 37 5 0.00% 38 12 0.00% 39 3 0.00% 40 3 0.00% 41 4 0.00% 42 7 0.00% 43 8 0.00% 44 12 0.00% 45 5 0.00% 46 11 0.00% 47 15 0.00% 48 13 0.00% 49 26 0.00% 50 16 0.00% 51 27 0.00% 52 16 0.00% 53 23 0.00% 54 21 0.00% 55 28 0.00% 56 48 0.00% 57 55 0.00% 58 40 0.00% 59 66 0.00% 60 65 0.00% 61 78 0.00% 62 84 0.00% 63 69 0.00% 64 98 0.00% 65 118 0.00% 66 154 0.00% 67 156 0.00% 68 150 0.00% 69 235 0.00% 70 249 0.00% 71 253 0.00% 72 330 0.00% 73 370 0.00% 74 473 0.00% 75 531 0.00% 76 602 0.00% 77 701 0.00% 78 789 0.01% 79 941 0.01% 80 1057 0.01% 81 1156 0.01% 82 1340 0.01% 83 1608 0.01% 84 2474 0.02% 85 3270 0.02% 86 3701 0.02% 87 4261 0.03% 88 4559 0.03% 89 4737 0.03% 90 5107 0.03% 91 5515 0.04% 92 5820 0.04% 93 6168 0.04% 94 6531 0.04% 95 6982 0.04% 96 7429 0.05% 97 8057 0.05% 98 8821 0.06% 99 9393 0.06% 100 10070 0.06% 101 10562 0.07% 102 11606 0.07% 103 12312 0.08% 104 13154 0.08% 105 14307 0.09% 106 15416 0.10% 107 16125 0.10% 108 17083 0.11% 109 18118 0.12% 110 19186 0.12% 111 20281 0.13% 112 21531 0.14% 113 22774 0.15% 114 23937 0.15% 115 25312 0.16% 116 26527 0.17% 117 27441 0.17% 118 28806 0.18% 119 30559 0.19% 120 32502 0.21% 121 33413 0.21% 122 34928 0.22% 123 35323 0.23% 124 37355 0.24% 125 38168 0.24% 126 39884 0.25% 127 41267 0.26% 128 42847 0.27% 129 44209 0.28% 130 46860 0.30% 131 48481 0.31% 132 50700 0.32% 133 53257 0.34% 134 54643 0.35% 135 57718 0.37% 136 59808 0.38% 137 61779 0.39% 138 64801 0.41% 139 68570 0.44% 140 72532 0.46% 141 77565 0.49% 142 83361 0.53% 143 89464 0.57% 144 99683 0.64% 145 112710 0.72% 146 131599 0.84% 147 167912 1.07% 148 243496 1.55% 149 474302 3.02% 150 2842954 18.13% 151 9852159 62.82% 15684346 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=19 prefix-density=0.37 prefix-fanout=3.5 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=29.63 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.0 sequence=CAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=33 prefix-density=0.44 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=28.79 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=9.5 sequence=AAGATGATTCCCACCAAGCCCATGGTGGTGGAGACTTTCTCAGCGTATCCTCCACTTGG SRR7180115 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:20:00 Started mapping on | Feb 10 21:20:00 Finished on | Feb 10 21:22:13 Mapping speed, Million of reads per hour | 424.54 Number of input reads | 15684346 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14362466 Uniquely mapped reads % | 91.57% Average mapped length | 294.88 Number of splices: Total | 14593179 Number of splices: Annotated (sjdb) | 14353794 Number of splices: GT/AG | 14363062 Number of splices: GC/AG | 185328 Number of splices: AT/AC | 9638 Number of splices: Non-canonical | 35151 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390062 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 36581 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.65% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 949324 949324 949324 N_multimapping 390062 390062 390062 N_noFeature 279292 14232311 329677 N_ambiguous 147757 830 67446 UnstrandedReadsAssigned:13935417 PositiveStrandReadsAssigned:129325 NegativeStrandReadsAssigned:13965343 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180115 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180115-trimmed-pair1.fastq SRR7180115-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,684,346 reads, 13,875,112 reads pseudoaligned [quant] estimated average fragment length: 230.207 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR7180115.ke.tsv 34699 SRR7180115.se.tsv 87100 total ==> SRR7180115.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.79 889 33.0149 Potri.005G024800.1.v4.1 1035 805.793 168 13.8501 Potri.004G059700.1.v4.1 961 731.803 17 1.5432 Potri.007G009000.2.v4.1 1416 1186.79 0 0 Potri.003G141000.2.v4.1 2943 2713.79 405 9.91394 Potri.016G087400.1.v4.1 270 82.0954 1355 1096.45 Potri.015G069301.1.v4.1 564 337.445 0 0 Potri.010G195200.1.v4.1 1773 1543.79 275 11.8335 Potri.012G127500.1.v4.1 977 747.798 2953 262.329 ==> SRR7180115.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 479 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 324 SRR7180115 completed mapping pipeline successfully