Starting /dee2/code/volunteer_pipeline.sh SRR7180116 current disk space = 3056188145664 free memory = 1281991556 SRR7180116 SRAfilesize c1fcd27103d2c5817b942c9ca685d54a SRR7180116.sra SRR7180116.sra file validated SRR7180116 is paired end SRR7180116 is conventional basespace SRR7180116 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180116_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.09225 32.0 18.0 33.0 18.0 33.0 2 30.196 31.0 29.0 33.0 27.0 33.0 3 30.967 33.0 31.0 33.0 27.0 33.0 4 32.3375 33.0 33.0 33.0 31.0 33.0 5 32.8795 33.0 33.0 34.0 32.0 34.0 6 37.023 38.0 37.0 38.0 35.0 38.0 7 37.45375 38.0 38.0 38.0 37.0 38.0 8 37.6365 38.0 38.0 38.0 38.0 38.0 9 37.73125 38.0 38.0 38.0 38.0 38.0 10-14 37.729949999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.69565 38.0 38.0 38.0 38.0 38.0 20-24 37.650099999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.61695 38.0 38.0 38.0 38.0 38.0 30-34 37.587149999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.54475000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.506299999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.49765 38.0 38.0 38.0 38.0 38.0 50-54 37.48535 38.0 38.0 38.0 38.0 38.0 55-59 37.47225 38.0 38.0 38.0 37.8 38.0 60-64 37.36385 38.0 38.0 38.0 37.0 38.0 65-69 37.361450000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.317600000000006 38.0 38.0 38.0 37.0 38.0 75-79 37.275850000000005 38.0 38.0 38.0 37.0 38.0 80-84 37.20545 38.0 38.0 38.0 36.8 38.0 85-89 37.133500000000005 38.0 38.0 38.0 36.6 38.0 90-94 37.0731 38.0 38.0 38.0 36.2 38.0 95-99 36.9979 38.0 38.0 38.0 36.0 38.0 100-104 36.9498 38.0 38.0 38.0 36.0 38.0 105-109 36.759949999999996 38.0 38.0 38.0 35.0 38.0 110-114 36.7145 38.0 38.0 38.0 35.0 38.0 115-119 36.62935 38.0 38.0 38.0 35.0 38.0 120-124 36.5372 38.0 38.0 38.0 34.4 38.0 125-129 36.3914 38.0 38.0 38.0 34.0 38.0 130-134 36.2069 38.0 38.0 38.0 34.0 38.0 135-139 35.9966 38.0 37.8 38.0 33.2 38.0 140-144 35.77375 38.0 36.8 38.0 33.0 38.0 145-149 35.4249 38.0 36.0 38.0 31.6 38.0 150-151 32.510000000000005 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 3.0 8 2.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 1.0 15 0.0 16 0.0 17 2.0 18 1.0 19 4.0 20 4.0 21 1.0 22 2.0 23 2.0 24 3.0 25 5.0 26 9.0 27 8.0 28 13.0 29 23.0 30 22.0 31 32.0 32 52.0 33 49.0 34 103.0 35 160.0 36 519.0 37 2974.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.41077085533263 13.569165786694825 13.252375923970433 34.76768743400211 2 21.832749123685527 16.800200300450676 36.029043565348026 25.338007010515774 3 20.424999999999997 22.25 26.650000000000002 30.675 4 22.7 28.325 23.45 25.525 5 22.125 31.924999999999997 24.474999999999998 21.475 6 20.225 32.525 26.35 20.9 7 15.65 23.075000000000003 42.8 18.475 8 18.05 24.175 31.825 25.95 9 18.075 24.375 33.025 24.525 10-14 20.19 28.235 27.96 23.615 15-19 20.294999999999998 27.775 28.355000000000004 23.575 20-24 20.205000000000002 28.71 27.97 23.115 25-29 20.65 27.63 28.13 23.59 30-34 20.43 28.425 27.68 23.465 35-39 20.32 27.544999999999998 28.205000000000002 23.93 40-44 21.08 27.87 27.889999999999997 23.16 45-49 21.099999999999998 27.634999999999998 27.529999999999998 23.735 50-54 20.905 27.865000000000002 27.485 23.745 55-59 20.560000000000002 27.735 27.97 23.735 60-64 20.96 27.83 27.515 23.695 65-69 20.645 27.925 27.950000000000003 23.48 70-74 20.830000000000002 27.79 27.860000000000003 23.52 75-79 20.77 27.685 27.525 24.02 80-84 21.0 27.73 27.265 24.005000000000003 85-89 20.57 27.49 28.435 23.505000000000003 90-94 21.46 27.485 27.800000000000004 23.255 95-99 20.875 27.465 27.93 23.73 100-104 21.02 27.944999999999997 27.515 23.52 105-109 21.310000000000002 27.49 27.534999999999997 23.665 110-114 21.02 27.705000000000002 27.88 23.395 115-119 21.404999999999998 28.060000000000002 26.834999999999997 23.7 120-124 21.695 27.894999999999996 26.93 23.48 125-129 21.55 27.495000000000005 26.66 24.295 130-134 21.015 27.894999999999996 26.735 24.355 135-139 21.615000000000002 27.345000000000002 26.655 24.385 140-144 21.834999999999997 28.29 25.814999999999998 24.060000000000002 145-149 21.195 27.785 26.115 24.905 150-151 21.811576046103735 27.22375344525182 26.45953395139063 24.50513655725382 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 1.0 5 1.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.5 18 2.0 19 2.0 20 0.5 21 1.0 22 2.0 23 2.0 24 3.5 25 4.0 26 5.0 27 7.0 28 10.0 29 12.5 30 11.5 31 20.5 32 30.0 33 42.0 34 54.0 35 64.5 36 82.5 37 96.0 38 115.5 39 149.0 40 175.5 41 188.5 42 221.5 43 246.5 44 260.5 45 260.0 46 268.0 47 276.0 48 249.0 49 219.0 50 179.0 51 140.0 52 122.0 53 100.5 54 71.0 55 60.5 56 50.0 57 42.0 58 33.0 59 21.5 60 18.5 61 15.5 62 14.5 63 13.0 64 10.0 65 7.0 66 4.0 67 3.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.3 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 3.1 0.0 0.0 0.0 0.0 112-113 3.625 0.0 0.0 0.0 0.0 114-115 4.125 0.0 0.0 0.0 0.0 116-117 4.6875 0.0 0.0 0.0 0.0 118-119 5.3 0.0 0.0 0.0 0.0 120-121 5.9625 0.0 0.0 0.0 0.0 122-123 6.65 0.0 0.0 0.0 0.0 124-125 7.3125 0.0 0.0 0.0 0.0 126-127 7.8875 0.0 0.0 0.0 0.0 128-129 8.5625 0.0 0.0 0.0 0.0 130-131 9.225 0.0 0.0 0.0 0.0 132-133 9.9875 0.0 0.0 0.0 0.0 134-135 10.75 0.0 0.0 0.0 0.0 136-137 11.4375 0.0 0.0 0.0 0.0 138-139 12.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTATTC 10 0.0068343505 144.975 6 ACACGTC 35 0.003150469 62.918625 145 >>END_MODULE SRR7180116 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180116_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.047 33.0 33.0 34.0 32.0 34.0 2 33.1595 34.0 33.0 34.0 33.0 34.0 3 33.197 34.0 33.0 34.0 33.0 34.0 4 33.09225 34.0 33.0 34.0 33.0 34.0 5 33.0995 34.0 33.0 34.0 33.0 34.0 6 37.1535 38.0 38.0 38.0 37.0 38.0 7 37.23 38.0 38.0 38.0 38.0 38.0 8 37.199 38.0 38.0 38.0 38.0 38.0 9 37.23175 38.0 38.0 38.0 37.0 38.0 10-14 37.16615 38.0 38.0 38.0 37.2 38.0 15-19 37.047 38.0 38.0 38.0 37.0 38.0 20-24 37.060050000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.0636 38.0 38.0 38.0 37.0 38.0 30-34 37.01595 38.0 38.0 38.0 37.0 38.0 35-39 36.8811 38.0 38.0 38.0 37.0 38.0 40-44 36.8838 38.0 38.0 38.0 37.0 38.0 45-49 36.9114 38.0 38.0 38.0 37.0 38.0 50-54 36.90415 38.0 38.0 38.0 37.0 38.0 55-59 36.899 38.0 38.0 38.0 37.0 38.0 60-64 36.868399999999994 38.0 38.0 38.0 36.4 38.0 65-69 36.773849999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.7124 38.0 38.0 38.0 36.0 38.0 75-79 36.6779 38.0 38.0 38.0 36.0 38.0 80-84 36.6637 38.0 38.0 38.0 36.0 38.0 85-89 36.5304 38.0 38.0 38.0 35.4 38.0 90-94 36.437400000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.43920000000001 38.0 38.0 38.0 35.0 38.0 100-104 36.2047 38.0 38.0 38.0 34.0 38.0 105-109 36.0189 38.0 38.0 38.0 33.6 38.0 110-114 35.97345 38.0 38.0 38.0 33.8 38.0 115-119 35.7583 38.0 38.0 38.0 33.0 38.0 120-124 35.669650000000004 38.0 37.4 38.0 32.6 38.0 125-129 35.362049999999996 38.0 36.8 38.0 30.6 38.0 130-134 35.20694999999999 38.0 36.0 38.0 31.0 38.0 135-139 34.76365 38.0 35.8 38.0 27.4 38.0 140-144 34.41145 38.0 35.2 38.0 26.0 38.0 145-149 33.7907 38.0 34.6 38.0 22.6 38.0 150-151 30.088375 36.5 28.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 9.0 4 4.0 5 2.0 6 1.0 7 2.0 8 3.0 9 3.0 10 1.0 11 1.0 12 0.0 13 4.0 14 3.0 15 5.0 16 4.0 17 3.0 18 4.0 19 8.0 20 9.0 21 9.0 22 14.0 23 9.0 24 10.0 25 12.0 26 10.0 27 15.0 28 15.0 29 32.0 30 26.0 31 40.0 32 59.0 33 82.0 34 101.0 35 219.0 36 498.0 37 2770.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.76276276276276 17.26726726726727 18.993993993993993 25.975975975975974 2 24.125 23.7 31.974999999999998 20.200000000000003 3 21.475 26.3 30.349999999999998 21.875 4 25.724999999999998 32.475 21.675 20.125 5 24.099999999999998 35.05 23.125 17.724999999999998 6 18.625 36.7 24.45 20.225 7 19.334667333666832 19.834917458729365 38.76938469234617 22.061030515257627 8 21.71628721541156 22.86715036277208 27.595696772579437 27.820865649236925 9 21.275 25.275 29.7 23.75 10-14 23.505000000000003 27.950000000000003 26.284999999999997 22.259999999999998 15-19 23.185796449112278 28.262065516379092 27.026756689172295 21.525381345336335 20-24 23.237075221460387 28.411991391822234 27.325959661678596 21.024973725038787 25-29 23.561808441395886 28.122966004105542 27.191708806889302 21.123516747609273 30-34 23.479611261396656 28.023244163911432 26.645626690712355 21.85151788397956 35-39 23.559789420907496 27.941840060165458 26.888944597643523 21.609425921283528 40-44 23.324477417414407 28.021454709509246 27.28457566795328 21.369492205123063 45-49 22.89319513294277 28.961994892594262 26.73376395773872 21.41104601672425 50-54 23.33783580969533 28.065435989794384 27.00485266896793 21.59187553154235 55-59 23.73661563094166 27.71440008005604 26.95887120984689 21.590113079155408 60-64 23.3370011003301 28.203461038311495 27.083124937481244 21.376412923877165 65-69 23.573250637723202 27.839743910368632 26.484269494323016 22.102735957585153 70-74 23.598539780967144 27.86417962694404 27.05905885882882 21.47822173325999 75-79 24.015 27.589999999999996 27.395000000000003 21.0 80-84 23.893584037605642 27.859178876831525 27.159073861079165 21.088163224483672 85-89 24.075 28.199999999999996 27.18 20.544999999999998 90-94 23.805 27.865000000000002 27.310000000000002 21.02 95-99 23.455000000000002 27.775 27.12 21.65 100-104 24.03 28.105000000000004 27.175 20.69 105-109 24.654999999999998 27.42 27.455000000000002 20.47 110-114 23.895 28.199999999999996 27.18 20.724999999999998 115-119 24.845 28.095 26.735 20.325 120-124 24.745 28.499999999999996 26.56 20.195 125-129 25.025 28.439999999999998 26.465 20.07 130-134 25.564999999999998 28.000000000000004 26.474999999999998 19.96 135-139 25.97 27.305 27.24 19.485 140-144 25.75 28.125 26.685 19.439999999999998 145-149 27.08 27.6 26.35 18.970000000000002 150-151 26.83569725116104 27.425630726747833 26.873352579389987 18.865319442701143 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 0.5 22 1.0 23 1.5 24 1.0 25 3.0 26 3.5 27 2.5 28 4.0 29 6.5 30 7.0 31 11.5 32 18.5 33 26.0 34 33.0 35 42.5 36 61.5 37 87.5 38 110.5 39 143.5 40 183.5 41 203.5 42 240.0 43 287.0 44 299.0 45 295.5 46 280.5 47 268.5 48 248.0 49 195.0 50 169.0 51 149.0 52 116.5 53 93.5 54 85.5 55 74.5 56 56.5 57 47.5 58 30.5 59 22.5 60 19.5 61 12.5 62 11.5 63 10.0 64 6.5 65 6.0 66 4.0 67 2.5 68 2.5 69 2.0 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.05 8 0.075 9 0.0 10-14 0.0 15-19 0.025 20-24 0.095 25-29 0.135 30-34 0.19 35-39 0.27499999999999997 40-44 0.255 45-49 0.145 50-54 0.055 55-59 0.06999999999999999 60-64 0.03 65-69 0.034999999999999996 70-74 0.015 75-79 0.0 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.41250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.8875000000000002 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.675 0.0 0.0 0.0 0.0 110-111 3.175 0.0 0.0 0.0 0.0 112-113 3.7 0.0 0.0 0.0 0.0 114-115 4.25 0.0 0.0 0.0 0.0 116-117 4.85 0.0 0.0 0.0 0.0 118-119 5.4375 0.0 0.0 0.0 0.0 120-121 6.1 0.0 0.0 0.0 0.0 122-123 6.8125 0.0 0.0 0.0 0.0 124-125 7.5125 0.0 0.0 0.0 0.0 126-127 8.075 0.0 0.0 0.0 0.0 128-129 8.75 0.0 0.0 0.0 0.0 130-131 9.4375 0.0 0.0 0.0 0.0 132-133 10.2625 0.0 0.0 0.0 0.0 134-135 11.1375 0.0 0.0 0.0 0.0 136-137 11.8625 0.0 0.0 0.0 0.0 138-139 12.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGTGT 40 0.004822775 56.478897 145 GGGGGGG 30 0.0014459731 24.160418 70-74 >>END_MODULE Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771662 spots for SRR7180116.sra Written 771662 spots for SRR7180116.sra Read 771663 spots for SRR7180116.sra Written 771663 spots for SRR7180116.sra SRR ids: ['SRR7180116.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r3hvnbrk SRR7180116.sra spots: 15433241 blocks: [[1, 771662], [771663, 1543324], [1543325, 2314986], [2314987, 3086648], [3086649, 3858310], [3858311, 4629972], [4629973, 5401634], [5401635, 6173296], [6173297, 6944958], [6944959, 7716620], [7716621, 8488282], [8488283, 9259944], [9259945, 10031606], [10031607, 10803268], [10803269, 11574930], [11574931, 12346592], [12346593, 13118254], [13118255, 13889916], [13889917, 14661578], [14661579, 15433241]] SRR7180116 file size 5208118 SRR7180116 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180116 SRR7180116_1.fastq SRR7180116_2.fastq Input file: SRR7180116_1.fastq Paired file: SRR7180116_2.fastq trimmed: SRR7180116-trimmed-pair1.fastq, SRR7180116-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:19:21 2025 >> started Mon Feb 10 20:19:44 2025 >> done (22.583s) 15433241 read pairs processed; of these: 38259 ( 0.25%) short read pairs filtered out after trimming by size control 27345 ( 0.18%) empty read pairs filtered out after trimming by size control 15367637 (99.57%) read pairs available; of these: 6755408 (43.96%) trimmed read pairs available after processing 8612229 (56.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 3 0.00% 21 5 0.00% 22 6 0.00% 23 9 0.00% 24 2 0.00% 25 7 0.00% 26 11 0.00% 27 15 0.00% 28 11 0.00% 29 3 0.00% 30 9 0.00% 31 6 0.00% 32 7 0.00% 33 8 0.00% 34 7 0.00% 35 5 0.00% 36 8 0.00% 37 6 0.00% 38 7 0.00% 39 12 0.00% 40 11 0.00% 41 10 0.00% 42 9 0.00% 43 13 0.00% 44 23 0.00% 45 13 0.00% 46 24 0.00% 47 26 0.00% 48 28 0.00% 49 28 0.00% 50 47 0.00% 51 45 0.00% 52 54 0.00% 53 57 0.00% 54 52 0.00% 55 54 0.00% 56 74 0.00% 57 114 0.00% 58 106 0.00% 59 173 0.00% 60 155 0.00% 61 187 0.00% 62 225 0.00% 63 278 0.00% 64 295 0.00% 65 327 0.00% 66 386 0.00% 67 426 0.00% 68 530 0.00% 69 601 0.00% 70 744 0.00% 71 840 0.01% 72 1031 0.01% 73 1222 0.01% 74 1377 0.01% 75 1647 0.01% 76 2003 0.01% 77 2212 0.01% 78 2484 0.02% 79 2838 0.02% 80 3086 0.02% 81 3722 0.02% 82 4229 0.03% 83 4747 0.03% 84 6706 0.04% 85 8676 0.06% 86 9242 0.06% 87 10432 0.07% 88 11291 0.07% 89 11997 0.08% 90 12705 0.08% 91 13366 0.09% 92 14335 0.09% 93 15198 0.10% 94 16408 0.11% 95 17436 0.11% 96 19017 0.12% 97 19788 0.13% 98 20929 0.14% 99 22642 0.15% 100 24043 0.16% 101 25426 0.17% 102 26403 0.17% 103 28337 0.18% 104 29635 0.19% 105 31845 0.21% 106 33857 0.22% 107 35183 0.23% 108 36630 0.24% 109 38462 0.25% 110 40190 0.26% 111 41895 0.27% 112 44161 0.29% 113 45837 0.30% 114 47822 0.31% 115 49733 0.32% 116 51681 0.34% 117 52733 0.34% 118 54676 0.36% 119 55929 0.36% 120 58146 0.38% 121 60374 0.39% 122 61901 0.40% 123 63459 0.41% 124 65522 0.43% 125 66744 0.43% 126 68450 0.45% 127 70481 0.46% 128 70567 0.46% 129 72489 0.47% 130 74245 0.48% 131 76252 0.50% 132 78777 0.51% 133 81888 0.53% 134 84231 0.55% 135 86282 0.56% 136 87920 0.57% 137 89618 0.58% 138 90938 0.59% 139 93220 0.61% 140 95921 0.62% 141 99997 0.65% 142 105738 0.69% 143 111652 0.73% 144 121292 0.79% 145 131939 0.86% 146 148286 0.96% 147 179058 1.17% 148 242044 1.58% 149 437575 2.85% 150 2519046 16.39% 151 8612229 56.04% 15367637 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=19 prefix-density=0.56 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.16 sequence-density-rank=7 fanout-score=30.45 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=11.3 sequence=TTCTTCAACCATCTCCAAGGGGAAATGAGGAGACCCCCGAGGGCAAAAGATAACCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCTCGAAGGGTCATCCTGGGGATAGCTGTAAGAAGTAGGGCACCTATCCTTAAAAAACCTTGAGAAATAGGTAGGGCCACAGCTCCCCTGCCCATTAGTGCAGCAATATTCGTTAGTTTTAAACACAGTGCATGGGTTATTACACCCACCAGGAGCCCTCAATTCATTAGGACATTGCCCATTAATATCTGCTGTGCAGAGAAGCGCTTG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=88.06 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=12.1 sequence=AGGAGAAGAAATGGCATCTATCTGTCAAGGTAAGAGTTCATGGCC SRR7180116 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:20:37 Started mapping on | Feb 10 20:20:37 Finished on | Feb 10 20:24:13 Mapping speed, Million of reads per hour | 256.13 Number of input reads | 15367637 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13442461 Uniquely mapped reads % | 87.47% Average mapped length | 289.85 Number of splices: Total | 12182743 Number of splices: Annotated (sjdb) | 11951267 Number of splices: GT/AG | 11975616 Number of splices: GC/AG | 160067 Number of splices: AT/AC | 10922 Number of splices: Non-canonical | 36138 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 392033 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 50561 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.55% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1564175 1564175 1564175 N_multimapping 392033 392033 392033 N_noFeature 346150 13316822 410804 N_ambiguous 128122 908 66546 UnstrandedReadsAssigned:12968189 PositiveStrandReadsAssigned:124731 NegativeStrandReadsAssigned:12965111 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7180116 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180116-trimmed-pair1.fastq SRR7180116-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,367,637 reads, 12,945,299 reads pseudoaligned [quant] estimated average fragment length: 207.786 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7180116.ke.tsv 34699 SRR7180116.se.tsv 87100 total ==> SRR7180116.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.21 1666 70.4415 Potri.005G024800.1.v4.1 1035 828.214 389 35.9692 Potri.004G059700.1.v4.1 961 754.219 36 3.65534 Potri.007G009000.2.v4.1 1416 1209.21 0 0 Potri.003G141000.2.v4.1 2943 2736.21 492 13.7701 Potri.016G087400.1.v4.1 270 94.4655 726.534 588.987 Potri.015G069301.1.v4.1 564 359.12 0 0 Potri.010G195200.1.v4.1 1773 1566.21 817.876 39.9908 Potri.012G127500.1.v4.1 977 770.219 11243 1117.87 ==> SRR7180116.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 849 SRR7180116 completed mapping pipeline successfully