Starting /dee2/code/volunteer_pipeline.sh SRR7180117 current disk space = 3056237223936 free memory = 1141319516 SRR7180117 SRAfilesize 92603e06c4dc4a97f3021cb7b1f363c3 SRR7180117.sra SRR7180117.sra file validated SRR7180117 is paired end SRR7180117 is conventional basespace SRR7180117 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180117_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.1935 33.0 32.0 34.0 18.0 34.0 2 32.416 33.0 33.0 34.0 28.0 34.0 3 32.9065 34.0 33.0 34.0 32.0 34.0 4 32.66375 33.0 33.0 34.0 31.0 34.0 5 33.06875 34.0 33.0 34.0 32.0 34.0 6 37.021 38.0 37.0 38.0 36.0 38.0 7 37.37125 38.0 38.0 38.0 37.0 38.0 8 37.40275 38.0 38.0 38.0 37.0 38.0 9 37.508 38.0 38.0 38.0 37.0 38.0 10-14 37.488150000000005 38.0 38.0 38.0 37.6 38.0 15-19 37.4961 38.0 38.0 38.0 37.6 38.0 20-24 37.51445 38.0 38.0 38.0 37.6 38.0 25-29 37.44925 38.0 38.0 38.0 37.2 38.0 30-34 37.472699999999996 38.0 38.0 38.0 37.4 38.0 35-39 37.4199 38.0 38.0 38.0 37.0 38.0 40-44 37.4103 38.0 38.0 38.0 37.0 38.0 45-49 37.35475 38.0 38.0 38.0 37.0 38.0 50-54 37.33055 38.0 38.0 38.0 37.0 38.0 55-59 37.2367 38.0 38.0 38.0 37.0 38.0 60-64 37.220349999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.187650000000005 38.0 38.0 38.0 36.2 38.0 70-74 37.1344 38.0 38.0 38.0 36.0 38.0 75-79 37.09925 38.0 38.0 38.0 36.0 38.0 80-84 37.03275 38.0 38.0 38.0 36.0 38.0 85-89 36.98065 38.0 38.0 38.0 36.0 38.0 90-94 36.846149999999994 38.0 38.0 38.0 35.4 38.0 95-99 36.8187 38.0 38.0 38.0 35.0 38.0 100-104 36.7095 38.0 38.0 38.0 35.0 38.0 105-109 36.625800000000005 38.0 38.0 38.0 34.6 38.0 110-114 36.439800000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.4329 38.0 38.0 38.0 34.0 38.0 120-124 36.22555 38.0 37.8 38.0 33.8 38.0 125-129 36.101150000000004 38.0 37.8 38.0 33.4 38.0 130-134 35.782849999999996 38.0 37.0 38.0 32.0 38.0 135-139 35.622400000000006 38.0 36.0 38.0 31.0 38.0 140-144 35.3506 38.0 36.0 38.0 31.0 38.0 145-149 34.8949 38.0 36.0 38.0 29.2 38.0 150-151 32.087125 36.5 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 5.0 23 7.0 24 8.0 25 11.0 26 19.0 27 14.0 28 15.0 29 28.0 30 30.0 31 40.0 32 58.0 33 90.0 34 128.0 35 226.0 36 523.0 37 2785.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.311632870864464 15.55496264674493 13.420490928495196 36.71291355389541 2 19.625 21.575 39.15 19.650000000000002 3 18.9 26.5 27.875 26.724999999999998 4 22.1 34.699999999999996 21.9 21.3 5 19.85 37.3 24.075 18.775 6 17.125 35.625 27.075 20.175 7 13.0 21.25 45.85 19.900000000000002 8 17.8 23.525 30.4 28.275 9 16.725 22.8 33.2 27.275 10-14 19.96 28.854999999999997 27.175 24.01 15-19 19.77 28.494999999999997 28.694999999999997 23.04 20-24 19.395 28.71 28.360000000000003 23.535 25-29 19.835 28.560000000000002 28.43 23.175 30-34 19.53 29.099999999999998 27.845 23.525 35-39 19.895 28.665000000000003 28.349999999999998 23.09 40-44 19.625 28.449999999999996 27.884999999999998 24.04 45-49 20.064999999999998 28.425 27.825 23.685000000000002 50-54 19.945 28.749999999999996 27.725 23.580000000000002 55-59 19.759999999999998 28.825 28.08 23.335 60-64 19.38 28.455000000000002 28.444999999999997 23.72 65-69 19.48 28.165000000000003 28.505000000000003 23.849999999999998 70-74 20.0 28.655 27.889999999999997 23.455000000000002 75-79 20.305 27.88 28.265 23.549999999999997 80-84 19.384999999999998 28.62 27.800000000000004 24.195 85-89 19.6 28.77 27.450000000000003 24.18 90-94 20.09 28.275 28.015 23.62 95-99 19.515 28.345 28.449999999999996 23.69 100-104 19.73 28.52 27.875 23.875 105-109 20.905 28.335 27.544999999999998 23.215 110-114 19.845 28.035 27.905 24.215 115-119 20.055 27.965 28.1 23.880000000000003 120-124 20.16 28.505000000000003 27.465 23.87 125-129 19.985 28.51 27.605 23.9 130-134 20.555 28.754999999999995 27.384999999999998 23.305 135-139 20.53 27.665 28.139999999999997 23.665 140-144 20.57 27.735 28.325 23.369999999999997 145-149 20.54 27.715 27.255000000000003 24.490000000000002 150-151 20.6875 27.35 28.075 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 2.0 22 0.5 23 0.0 24 0.5 25 2.0 26 4.5 27 9.0 28 9.5 29 7.5 30 20.0 31 34.5 32 37.0 33 40.0 34 56.0 35 76.0 36 100.0 37 123.0 38 149.5 39 180.5 40 208.0 41 237.0 42 264.5 43 290.5 44 283.5 45 282.0 46 278.5 47 250.5 48 229.0 49 190.0 50 140.0 51 117.0 52 102.0 53 73.5 54 50.0 55 40.5 56 33.5 57 21.0 58 14.0 59 7.5 60 6.0 61 6.5 62 5.0 63 4.0 64 3.0 65 1.5 66 0.0 67 1.5 68 2.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2125 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.3875000000000002 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 2.025 0.0 0.0 0.0 0.0 130-131 2.125 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.7125 0.0 0.0 0.0 0.0 138-139 3.0374999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAACT 10 0.0056249425 154.6 1 >>END_MODULE SRR7180117 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180117_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88175 33.0 33.0 34.0 32.0 34.0 2 32.99 34.0 33.0 34.0 32.0 34.0 3 33.088 34.0 33.0 34.0 32.0 34.0 4 33.04675 34.0 33.0 34.0 32.0 34.0 5 33.004 34.0 33.0 34.0 32.0 34.0 6 37.25375 38.0 38.0 38.0 37.0 38.0 7 37.24525 38.0 38.0 38.0 37.0 38.0 8 37.049 38.0 38.0 38.0 37.0 38.0 9 37.18075 38.0 38.0 38.0 37.0 38.0 10-14 37.192899999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.167950000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.15025000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.140600000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.05575 38.0 38.0 38.0 36.8 38.0 35-39 36.98735 38.0 38.0 38.0 36.4 38.0 40-44 37.00915 38.0 38.0 38.0 36.8 38.0 45-49 37.02655 38.0 38.0 38.0 36.4 38.0 50-54 37.0169 38.0 38.0 38.0 36.2 38.0 55-59 36.93425 38.0 38.0 38.0 36.0 38.0 60-64 36.89115 38.0 38.0 38.0 36.0 38.0 65-69 36.83495 38.0 38.0 38.0 36.0 38.0 70-74 36.78595 38.0 38.0 38.0 35.8 38.0 75-79 36.8181 38.0 38.0 38.0 36.0 38.0 80-84 36.70085 38.0 38.0 38.0 35.2 38.0 85-89 36.526149999999994 38.0 38.0 38.0 34.4 38.0 90-94 36.5198 38.0 38.0 38.0 34.6 38.0 95-99 36.381899999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.1958 38.0 38.0 38.0 33.8 38.0 105-109 35.971199999999996 38.0 37.6 38.0 33.2 38.0 110-114 36.007799999999996 38.0 38.0 38.0 33.6 38.0 115-119 35.933350000000004 38.0 37.4 38.0 33.2 38.0 120-124 35.7705 38.0 37.0 38.0 32.2 38.0 125-129 35.5157 38.0 36.8 38.0 31.0 38.0 130-134 35.2004 38.0 36.2 38.0 29.4 38.0 135-139 34.883799999999994 38.0 35.8 38.0 28.4 38.0 140-144 34.554249999999996 38.0 35.4 38.0 27.4 38.0 145-149 33.92105 38.0 35.0 38.0 23.8 38.0 150-151 30.558625 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 0.0 5 2.0 6 1.0 7 2.0 8 2.0 9 1.0 10 1.0 11 0.0 12 2.0 13 2.0 14 0.0 15 6.0 16 5.0 17 2.0 18 3.0 19 4.0 20 8.0 21 9.0 22 10.0 23 9.0 24 3.0 25 8.0 26 23.0 27 23.0 28 23.0 29 29.0 30 34.0 31 51.0 32 72.0 33 92.0 34 146.0 35 234.0 36 567.0 37 2615.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.574999999999996 17.075000000000003 15.925 28.425 2 25.025 21.9 35.225 17.849999999999998 3 21.6 26.724999999999998 31.65 20.025000000000002 4 23.075000000000003 34.65 22.650000000000002 19.625 5 23.625 35.525 23.95 16.900000000000002 6 18.725 36.975 23.775 20.525 7 18.95 16.975 41.925000000000004 22.15 8 20.875 24.075 27.500000000000004 27.55 9 21.925 24.5 29.7 23.875 10-14 23.445 28.415000000000003 26.290000000000003 21.85 15-19 22.725 27.750000000000004 28.405 21.12 20-24 22.58516332349557 28.097643939772897 28.292731729278174 21.024461007453354 25-29 22.7404664197778 28.966069462516263 27.534781303172856 20.75868281453308 30-34 23.17824410276957 28.48199529223218 27.92106976511243 20.418690839885812 35-39 23.70570841477472 27.80033077732672 27.55976544880469 20.93419535909387 40-44 23.162483090335186 27.501377824540306 28.73390450423368 20.602234580890826 45-49 23.071149804863406 28.019613729610725 27.81947363154208 21.089762833983787 50-54 23.071921576472942 28.423527058117436 27.87336200860258 20.63118935680704 55-59 23.149629925985195 28.170634126825366 27.850570114022805 20.829165833166634 60-64 23.13 27.839999999999996 28.325 20.705000000000002 65-69 23.405 27.884999999999998 28.410000000000004 20.3 70-74 23.84 27.805000000000003 28.07 20.285 75-79 23.44 27.98 28.4 20.18 80-84 23.474999999999998 28.415000000000003 27.650000000000002 20.46 85-89 23.71 28.244999999999997 28.09 19.955000000000002 90-94 23.630000000000003 27.439999999999998 28.615000000000002 20.315 95-99 23.189999999999998 28.215 28.4 20.195 100-104 23.445 27.975 28.505000000000003 20.075000000000003 105-109 23.605 27.675 28.299999999999997 20.419999999999998 110-114 23.69 28.155 28.285 19.869999999999997 115-119 23.810000000000002 28.13 28.139999999999997 19.919999999999998 120-124 23.89 28.000000000000004 27.705000000000002 20.405 125-129 23.385 28.255000000000003 28.325 20.035 130-134 23.845 28.18 27.49 20.485 135-139 23.925 28.07 28.535 19.470000000000002 140-144 23.93 28.34 27.715 20.015 145-149 23.865 28.21 28.360000000000003 19.564999999999998 150-151 23.680920230057513 28.794698674668666 28.257064266066518 19.2673168292073 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 2.5 24 2.0 25 2.0 26 2.0 27 4.5 28 9.0 29 9.5 30 9.5 31 13.0 32 18.0 33 25.0 34 37.0 35 59.5 36 77.0 37 102.5 38 135.0 39 166.0 40 216.5 41 245.5 42 275.0 43 307.0 44 302.0 45 286.0 46 276.0 47 265.0 48 246.5 49 212.5 50 159.0 51 122.5 52 99.5 53 88.5 54 67.0 55 35.5 56 26.5 57 21.0 58 15.5 59 9.5 60 7.0 61 8.5 62 8.5 63 5.5 64 3.5 65 3.5 66 1.5 67 0.5 68 1.0 69 1.0 70 0.5 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.045 25-29 0.09 30-34 0.165 35-39 0.23500000000000001 40-44 0.20500000000000002 45-49 0.06999999999999999 50-54 0.03 55-59 0.02 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2125 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.7375 0.0 0.0 0.0 0.0 128-129 1.975 0.0 0.0 0.0 0.0 130-131 2.0999999999999996 0.0 0.0 0.0 0.0 132-133 2.2875 0.0 0.0 0.0 0.0 134-135 2.5 0.0 0.0 0.0 0.0 136-137 2.6875 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra Read 918747 spots for SRR7180117.sra Written 918747 spots for SRR7180117.sra SRR ids: ['SRR7180117.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8nq0trzk SRR7180117.sra spots: 18374940 blocks: [[1, 918747], [918748, 1837494], [1837495, 2756241], [2756242, 3674988], [3674989, 4593735], [4593736, 5512482], [5512483, 6431229], [6431230, 7349976], [7349977, 8268723], [8268724, 9187470], [9187471, 10106217], [10106218, 11024964], [11024965, 11943711], [11943712, 12862458], [12862459, 13781205], [13781206, 14699952], [14699953, 15618699], [15618700, 16537446], [16537447, 17456193], [17456194, 18374940]] SRR7180117 file size 6204963 SRR7180117 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180117 SRR7180117_1.fastq SRR7180117_2.fastq Input file: SRR7180117_1.fastq Paired file: SRR7180117_2.fastq trimmed: SRR7180117-trimmed-pair1.fastq, SRR7180117-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:15:56 2025 >> started Mon Feb 10 20:16:20 2025 >> done (24.663s) 18374940 read pairs processed; of these: 19046 ( 0.10%) short read pairs filtered out after trimming by size control 16994 ( 0.09%) empty read pairs filtered out after trimming by size control 18338900 (99.80%) read pairs available; of these: 6272651 (34.20%) trimmed read pairs available after processing 12066249 (65.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 2 0.00% 22 1 0.00% 23 4 0.00% 24 2 0.00% 25 5 0.00% 26 1 0.00% 27 5 0.00% 28 3 0.00% 29 1 0.00% 30 1 0.00% 31 5 0.00% 32 4 0.00% 33 3 0.00% 34 2 0.00% 35 5 0.00% 36 5 0.00% 37 4 0.00% 38 8 0.00% 39 5 0.00% 40 7 0.00% 41 10 0.00% 42 15 0.00% 43 10 0.00% 44 8 0.00% 45 16 0.00% 46 12 0.00% 47 20 0.00% 48 15 0.00% 49 25 0.00% 50 10 0.00% 51 24 0.00% 52 28 0.00% 53 21 0.00% 54 32 0.00% 55 32 0.00% 56 51 0.00% 57 48 0.00% 58 60 0.00% 59 73 0.00% 60 98 0.00% 61 89 0.00% 62 111 0.00% 63 88 0.00% 64 124 0.00% 65 160 0.00% 66 156 0.00% 67 199 0.00% 68 193 0.00% 69 219 0.00% 70 277 0.00% 71 312 0.00% 72 379 0.00% 73 392 0.00% 74 470 0.00% 75 538 0.00% 76 659 0.00% 77 790 0.00% 78 761 0.00% 79 900 0.00% 80 909 0.00% 81 1128 0.01% 82 1297 0.01% 83 1370 0.01% 84 2428 0.01% 85 3056 0.02% 86 3434 0.02% 87 3617 0.02% 88 3854 0.02% 89 3940 0.02% 90 4104 0.02% 91 4147 0.02% 92 4522 0.02% 93 4931 0.03% 94 5175 0.03% 95 5400 0.03% 96 5791 0.03% 97 6113 0.03% 98 6427 0.04% 99 6697 0.04% 100 7309 0.04% 101 7562 0.04% 102 7998 0.04% 103 8537 0.05% 104 9198 0.05% 105 9595 0.05% 106 10414 0.06% 107 10908 0.06% 108 11580 0.06% 109 12089 0.07% 110 12983 0.07% 111 13430 0.07% 112 14210 0.08% 113 14795 0.08% 114 15758 0.09% 115 16717 0.09% 116 17807 0.10% 117 18459 0.10% 118 19822 0.11% 119 21157 0.12% 120 23554 0.13% 121 23241 0.13% 122 23678 0.13% 123 24775 0.14% 124 25561 0.14% 125 27373 0.15% 126 28207 0.15% 127 29718 0.16% 128 31210 0.17% 129 32893 0.18% 130 34836 0.19% 131 36123 0.20% 132 38778 0.21% 133 41413 0.23% 134 43530 0.24% 135 46259 0.25% 136 49519 0.27% 137 52787 0.29% 138 57188 0.31% 139 61352 0.33% 140 66110 0.36% 141 72899 0.40% 142 81130 0.44% 143 91658 0.50% 144 106306 0.58% 145 124065 0.68% 146 152727 0.83% 147 204076 1.11% 148 310251 1.69% 149 594597 3.24% 150 3390663 18.49% 151 12066249 65.80% 18338900 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.60 fanout-score-rank=22 prefix-density=0.35 prefix-fanout=3.4 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=29.71 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=9.6 sequence=TTGTTGAAGATGAT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.3 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=151.26 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.7 sequence=TTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGATC SRR7180117 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:17:05 Started mapping on | Feb 10 20:17:05 Finished on | Feb 10 20:19:11 Mapping speed, Million of reads per hour | 523.97 Number of input reads | 18338900 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 17223413 Uniquely mapped reads % | 93.92% Average mapped length | 296.84 Number of splices: Total | 16625983 Number of splices: Annotated (sjdb) | 16291382 Number of splices: GT/AG | 16360074 Number of splices: GC/AG | 207394 Number of splices: AT/AC | 12251 Number of splices: Non-canonical | 46264 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443006 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 43645 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 691157 691157 691157 N_multimapping 443006 443006 443006 N_noFeature 465128 17061242 528519 N_ambiguous 200873 1481 101269 UnstrandedReadsAssigned:16557412 PositiveStrandReadsAssigned:160690 NegativeStrandReadsAssigned:16593625 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180117 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180117-trimmed-pair1.fastq SRR7180117-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,338,900 reads, 16,475,371 reads pseudoaligned [quant] estimated average fragment length: 260.9 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52401 SRR7180117.ke.tsv 34699 SRR7180117.se.tsv 87100 total ==> SRR7180117.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.1 2956 107.156 Potri.005G024800.1.v4.1 1035 775.1 779 64.0525 Potri.004G059700.1.v4.1 961 701.125 33 2.99968 Potri.007G009000.2.v4.1 1416 1156.1 0 0 Potri.003G141000.2.v4.1 2943 2683.1 891.801 21.183 Potri.016G087400.1.v4.1 270 71.3883 791 706.164 Potri.015G069301.1.v4.1 564 310.429 0 0 Potri.010G195200.1.v4.1 1773 1513.1 329 13.8575 Potri.012G127500.1.v4.1 977 717.119 8010 711.865 ==> SRR7180117.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 65 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 658 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 175 SRR7180117 completed mapping pipeline successfully