Starting /dee2/code/volunteer_pipeline.sh SRR7180118 current disk space = 3056131821568 free memory = 1526202804 SRR7180118 SRAfilesize 58b4594c139515c43fe1a151f923f3f7 SRR7180118.sra SRR7180118.sra file validated SRR7180118 is paired end SRR7180118 is conventional basespace SRR7180118 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180118_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.371 33.0 31.0 33.0 18.0 34.0 2 29.6815 31.0 29.0 33.0 25.0 33.0 3 31.80925 33.0 32.0 33.0 28.0 33.0 4 32.4315 33.0 33.0 33.0 31.0 34.0 5 32.85125 33.0 33.0 34.0 32.0 34.0 6 36.9945 38.0 37.0 38.0 36.0 38.0 7 37.411 38.0 38.0 38.0 37.0 38.0 8 37.52025 38.0 38.0 38.0 37.0 38.0 9 37.5345 38.0 38.0 38.0 38.0 38.0 10-14 37.57895 38.0 38.0 38.0 38.0 38.0 15-19 37.57175 38.0 38.0 38.0 38.0 38.0 20-24 37.52315 38.0 38.0 38.0 37.8 38.0 25-29 37.484700000000004 38.0 38.0 38.0 37.6 38.0 30-34 37.454350000000005 38.0 38.0 38.0 37.4 38.0 35-39 37.427200000000006 38.0 38.0 38.0 37.2 38.0 40-44 37.429249999999996 38.0 38.0 38.0 37.2 38.0 45-49 37.386100000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.34689999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.3126 38.0 38.0 38.0 37.0 38.0 60-64 37.23715 38.0 38.0 38.0 36.8 38.0 65-69 37.212599999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.1584 38.0 38.0 38.0 36.4 38.0 75-79 37.138549999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.05555 38.0 38.0 38.0 36.0 38.0 85-89 36.92505 38.0 38.0 38.0 36.0 38.0 90-94 36.87415 38.0 38.0 38.0 35.6 38.0 95-99 36.8121 38.0 38.0 38.0 35.4 38.0 100-104 36.6879 38.0 38.0 38.0 34.6 38.0 105-109 36.67145000000001 38.0 38.0 38.0 34.6 38.0 110-114 36.4732 38.0 38.0 38.0 34.0 38.0 115-119 36.31815 38.0 38.0 38.0 34.0 38.0 120-124 36.114000000000004 38.0 37.8 38.0 33.6 38.0 125-129 35.9286 38.0 37.6 38.0 32.6 38.0 130-134 35.7331 38.0 36.6 38.0 31.8 38.0 135-139 35.4176 38.0 36.0 38.0 31.0 38.0 140-144 35.279250000000005 38.0 36.0 38.0 30.4 38.0 145-149 34.773649999999996 38.0 36.0 38.0 28.2 38.0 150-151 31.8775 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 2.0 18 3.0 19 3.0 20 5.0 21 6.0 22 3.0 23 7.0 24 7.0 25 10.0 26 15.0 27 6.0 28 22.0 29 22.0 30 45.0 31 42.0 32 55.0 33 68.0 34 130.0 35 231.0 36 559.0 37 2753.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.67577606792253 13.929424250464315 14.566197930485538 33.82860175112762 2 21.8 18.6 36.5 23.1 3 19.0 25.45 28.749999999999996 26.8 4 21.675 31.424999999999997 24.525 22.375 5 21.5 34.275 25.85 18.375 6 17.325 35.425000000000004 25.674999999999997 21.575 7 13.925 20.974999999999998 44.675 20.424999999999997 8 18.2 22.650000000000002 30.275000000000002 28.875 9 16.475 22.15 34.175 27.200000000000003 10-14 19.805 28.035 27.515 24.645 15-19 19.785 27.685 28.275 24.255 20-24 20.330000000000002 27.58 28.12 23.97 25-29 19.725 28.18 28.13 23.965 30-34 20.145 28.57 27.534999999999997 23.75 35-39 19.575 28.189999999999998 28.68 23.555 40-44 20.52 28.355000000000004 27.965 23.16 45-49 20.03 28.125 28.125 23.72 50-54 20.215 27.860000000000003 27.815 24.11 55-59 19.78 28.395 28.1 23.724999999999998 60-64 19.505 28.199999999999996 27.315 24.98 65-69 20.064999999999998 28.194999999999997 27.889999999999997 23.849999999999998 70-74 20.345 27.310000000000002 28.655 23.69 75-79 20.035 28.065 28.139999999999997 23.76 80-84 20.265 27.834999999999997 27.845 24.055 85-89 20.23 28.425 27.605 23.74 90-94 20.169999999999998 28.095 27.839999999999996 23.895 95-99 20.405 27.605 27.88 24.11 100-104 20.11 27.560000000000002 28.249999999999996 24.08 105-109 20.13 27.435 28.07 24.365000000000002 110-114 20.175 28.22 27.68 23.925 115-119 20.794999999999998 27.950000000000003 27.639999999999997 23.615 120-124 20.69 27.700000000000003 28.025 23.585 125-129 21.055 27.98 27.785 23.18 130-134 20.965 27.76 27.715 23.56 135-139 20.985 27.505000000000003 27.845 23.665 140-144 20.79 28.17 27.310000000000002 23.73 145-149 21.099999999999998 27.944999999999997 27.01 23.945 150-151 21.7875 27.250000000000004 27.0625 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.5 22 1.0 23 2.5 24 3.5 25 1.5 26 3.0 27 5.5 28 8.5 29 11.0 30 12.0 31 19.5 32 26.5 33 32.5 34 46.5 35 62.0 36 81.0 37 105.0 38 132.0 39 153.0 40 184.0 41 219.0 42 246.0 43 281.5 44 293.5 45 297.5 46 281.5 47 257.5 48 250.0 49 220.5 50 173.5 51 132.5 52 105.0 53 90.0 54 73.0 55 53.0 56 42.0 57 28.0 58 14.5 59 7.5 60 7.0 61 6.0 62 6.0 63 6.5 64 4.5 65 3.5 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.575 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.4749999999999996 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.9 0.0 0.0 0.0 0.0 132-133 3.275 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 4.2 0.0 0.0 0.0 0.0 138-139 4.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGAA 10 0.0068396386 144.9375 145 >>END_MODULE SRR7180118 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180118_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79325 33.0 33.0 34.0 32.0 34.0 2 32.96075 33.0 33.0 34.0 32.0 34.0 3 33.045 34.0 33.0 34.0 32.0 34.0 4 33.02325 34.0 33.0 34.0 33.0 34.0 5 32.9755 34.0 33.0 34.0 32.0 34.0 6 37.17325 38.0 38.0 38.0 37.0 38.0 7 37.06075 38.0 38.0 38.0 37.0 38.0 8 37.0315 38.0 38.0 38.0 37.0 38.0 9 37.0425 38.0 38.0 38.0 37.0 38.0 10-14 37.096999999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.05575 38.0 38.0 38.0 36.8 38.0 20-24 37.12045 38.0 38.0 38.0 37.0 38.0 25-29 37.057100000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.000600000000006 38.0 38.0 38.0 36.2 38.0 35-39 36.940749999999994 38.0 38.0 38.0 36.2 38.0 40-44 36.960950000000004 38.0 38.0 38.0 36.4 38.0 45-49 36.99495 38.0 38.0 38.0 36.2 38.0 50-54 37.00285 38.0 38.0 38.0 36.0 38.0 55-59 36.96525 38.0 38.0 38.0 36.0 38.0 60-64 36.8455 38.0 38.0 38.0 36.0 38.0 65-69 36.765699999999995 38.0 38.0 38.0 35.4 38.0 70-74 36.7504 38.0 38.0 38.0 35.6 38.0 75-79 36.7051 38.0 38.0 38.0 35.2 38.0 80-84 36.7209 38.0 38.0 38.0 35.4 38.0 85-89 36.52660000000001 38.0 38.0 38.0 34.4 38.0 90-94 36.50105 38.0 38.0 38.0 34.2 38.0 95-99 36.3643 38.0 38.0 38.0 34.0 38.0 100-104 36.16265 38.0 38.0 38.0 33.8 38.0 105-109 35.96535 38.0 37.6 38.0 32.8 38.0 110-114 36.067499999999995 38.0 37.8 38.0 33.4 38.0 115-119 35.97265 38.0 37.2 38.0 33.0 38.0 120-124 35.7116 38.0 37.0 38.0 31.4 38.0 125-129 35.4925 38.0 36.6 38.0 31.0 38.0 130-134 35.20285 38.0 36.0 38.0 28.8 38.0 135-139 34.84035 38.0 35.6 38.0 28.0 38.0 140-144 34.53025 38.0 35.2 38.0 26.6 38.0 145-149 33.9065 38.0 35.0 38.0 22.4 38.0 150-151 30.501125000000002 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 4.0 5 0.0 6 1.0 7 2.0 8 0.0 9 0.0 10 0.0 11 3.0 12 2.0 13 0.0 14 2.0 15 3.0 16 2.0 17 3.0 18 5.0 19 5.0 20 5.0 21 5.0 22 5.0 23 9.0 24 15.0 25 12.0 26 21.0 27 33.0 28 36.0 29 38.0 30 47.0 31 54.0 32 70.0 33 79.0 34 125.0 35 240.0 36 550.0 37 2617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.75 18.075 16.975 26.200000000000003 2 26.35 22.475 32.975 18.2 3 21.15 26.35 32.275 20.225 4 24.25 34.699999999999996 23.375 17.675 5 25.174999999999997 35.925000000000004 20.95 17.95 6 20.025000000000002 36.725 23.150000000000002 20.1 7 18.575 19.0 41.449999999999996 20.974999999999998 8 21.325 23.549999999999997 27.224999999999998 27.900000000000002 9 21.6 24.975 28.675 24.75 10-14 22.625 28.82 26.405 22.15 15-19 22.5 28.925 27.675 20.9 20-24 22.955329898454305 28.998049122104945 27.237256765544494 20.809364213896252 25-29 23.44962210320837 28.424846088392812 27.418789729215675 20.706742079183144 30-34 22.900801603206414 28.67735470941884 27.364729458917836 21.057114228456914 35-39 23.18796992481203 28.466165413533833 27.56390977443609 20.781954887218046 40-44 23.042998897464166 28.766162172997895 27.08730079182119 21.103538137716747 45-49 23.596236612951657 28.11029926934241 27.97517765989391 20.318286457812032 50-54 23.83214964489347 27.76332899869961 28.298489546864058 20.106031809542863 55-59 23.194638927785558 28.540708141628322 27.510502100420087 20.754150830166033 60-64 23.387338733873385 28.15781578157816 27.487748774877485 20.96709670967097 65-69 23.951197559877993 28.47642382119106 27.501375068753436 20.07100355017751 70-74 24.12 28.165000000000003 27.42 20.294999999999998 75-79 24.02 28.189999999999998 27.445000000000004 20.345 80-84 24.33 27.994999999999997 27.21 20.465 85-89 24.45244524452445 28.38283828382838 27.262726272627262 19.901990199019902 90-94 24.14 28.025 27.735 20.1 95-99 23.435 28.225 27.650000000000002 20.69 100-104 24.255 28.865000000000002 26.945000000000004 19.935 105-109 24.16 28.465 26.76 20.615 110-114 23.985 28.605000000000004 27.13 20.28 115-119 23.865 28.305000000000003 27.46 20.369999999999997 120-124 24.060000000000002 28.175 27.565 20.200000000000003 125-129 24.154999999999998 27.985 27.700000000000003 20.16 130-134 24.205 28.52 27.3 19.975 135-139 24.495 28.075 27.284999999999997 20.145 140-144 24.675 28.515 27.105 19.705000000000002 145-149 25.480000000000004 28.485 26.5 19.535 150-151 24.071526822558457 28.923346254845566 27.84794297861698 19.157183943978993 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 1.0 23 2.5 24 3.5 25 2.0 26 3.5 27 6.5 28 7.0 29 4.5 30 4.5 31 10.5 32 20.5 33 27.0 34 41.5 35 54.5 36 63.5 37 86.5 38 109.5 39 157.0 40 217.5 41 253.0 42 282.0 43 285.5 44 290.0 45 296.5 46 289.5 47 279.0 48 239.0 49 205.5 50 176.0 51 130.5 52 110.0 53 92.5 54 67.5 55 54.5 56 39.0 57 25.5 58 16.5 59 11.5 60 8.0 61 6.5 62 5.0 63 3.5 64 2.5 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.045 25-29 0.105 30-34 0.2 35-39 0.25 40-44 0.22999999999999998 45-49 0.09 50-54 0.03 55-59 0.02 60-64 0.01 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69841668760995 99.175 2 0.20105554159336514 0.4 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.050263885398341285 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.3625 0.0 0.0 0.0 0.0 116-117 1.55 0.0 0.0 0.0 0.0 118-119 1.7000000000000002 0.0 0.0 0.0 0.0 120-121 1.8875 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.4625 0.0 0.0 0.0 0.0 128-129 2.6375 0.0 0.0 0.0 0.0 130-131 2.9 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.725 0.0 0.0 0.0 0.0 136-137 4.25 0.0 0.0 0.0 0.0 138-139 4.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857635 spots for SRR7180118.sra Written 857635 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra Read 857630 spots for SRR7180118.sra Written 857630 spots for SRR7180118.sra SRR ids: ['SRR7180118.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_psv2twgn SRR7180118.sra spots: 17152605 blocks: [[1, 857630], [857631, 1715260], [1715261, 2572890], [2572891, 3430520], [3430521, 4288150], [4288151, 5145780], [5145781, 6003410], [6003411, 6861040], [6861041, 7718670], [7718671, 8576300], [8576301, 9433930], [9433931, 10291560], [10291561, 11149190], [11149191, 12006820], [12006821, 12864450], [12864451, 13722080], [13722081, 14579710], [14579711, 15437340], [15437341, 16294970], [16294971, 17152605]] SRR7180118 file size 5790754 SRR7180118 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180118 SRR7180118_1.fastq SRR7180118_2.fastq Input file: SRR7180118_1.fastq Paired file: SRR7180118_2.fastq trimmed: SRR7180118-trimmed-pair1.fastq, SRR7180118-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:44:55 2025 >> started Mon Feb 10 20:45:15 2025 >> done (20.152s) 17152605 read pairs processed; of these: 20569 ( 0.12%) short read pairs filtered out after trimming by size control 15450 ( 0.09%) empty read pairs filtered out after trimming by size control 17116586 (99.79%) read pairs available; of these: 6229840 (36.40%) trimmed read pairs available after processing 10886746 (63.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 5 0.00% 21 5 0.00% 22 1 0.00% 23 5 0.00% 24 4 0.00% 25 7 0.00% 26 5 0.00% 27 4 0.00% 28 9 0.00% 29 3 0.00% 30 6 0.00% 31 6 0.00% 32 5 0.00% 33 6 0.00% 34 3 0.00% 35 3 0.00% 36 4 0.00% 37 7 0.00% 38 8 0.00% 39 5 0.00% 40 4 0.00% 41 11 0.00% 42 10 0.00% 43 9 0.00% 44 10 0.00% 45 10 0.00% 46 7 0.00% 47 10 0.00% 48 11 0.00% 49 21 0.00% 50 25 0.00% 51 24 0.00% 52 31 0.00% 53 29 0.00% 54 41 0.00% 55 30 0.00% 56 42 0.00% 57 43 0.00% 58 51 0.00% 59 81 0.00% 60 79 0.00% 61 87 0.00% 62 107 0.00% 63 135 0.00% 64 121 0.00% 65 166 0.00% 66 162 0.00% 67 185 0.00% 68 253 0.00% 69 260 0.00% 70 316 0.00% 71 396 0.00% 72 423 0.00% 73 504 0.00% 74 556 0.00% 75 656 0.00% 76 808 0.00% 77 927 0.01% 78 968 0.01% 79 1107 0.01% 80 1294 0.01% 81 1482 0.01% 82 1692 0.01% 83 1922 0.01% 84 3107 0.02% 85 3825 0.02% 86 4022 0.02% 87 4612 0.03% 88 4663 0.03% 89 5095 0.03% 90 5397 0.03% 91 5801 0.03% 92 6156 0.04% 93 6551 0.04% 94 6996 0.04% 95 7513 0.04% 96 7985 0.05% 97 8651 0.05% 98 9043 0.05% 99 9481 0.06% 100 10262 0.06% 101 10679 0.06% 102 11749 0.07% 103 12403 0.07% 104 12904 0.08% 105 14068 0.08% 106 14830 0.09% 107 15496 0.09% 108 16336 0.10% 109 17031 0.10% 110 18240 0.11% 111 19589 0.11% 112 20327 0.12% 113 21066 0.12% 114 22435 0.13% 115 23859 0.14% 116 24554 0.14% 117 26219 0.15% 118 27192 0.16% 119 28876 0.17% 120 30747 0.18% 121 30892 0.18% 122 31588 0.18% 123 33490 0.20% 124 35013 0.20% 125 36168 0.21% 126 37772 0.22% 127 38667 0.23% 128 40168 0.23% 129 42391 0.25% 130 43838 0.26% 131 45638 0.27% 132 48237 0.28% 133 51020 0.30% 134 53316 0.31% 135 56045 0.33% 136 58471 0.34% 137 61828 0.36% 138 65028 0.38% 139 69010 0.40% 140 73535 0.43% 141 78544 0.46% 142 86583 0.51% 143 95798 0.56% 144 108942 0.64% 145 124410 0.73% 146 149702 0.87% 147 195755 1.14% 148 289622 1.69% 149 545072 3.18% 150 3090324 18.05% 151 10886746 63.60% 17116586 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.71 fanout-score-rank=21 prefix-density=0.94 prefix-fanout=1.9 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=331.62 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=21.7 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTT criterion=sequence-density sequence-density=0.97 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=34 prefix-density=0.99 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=51.07 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.9 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATG SRR7180118 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:46:00 Started mapping on | Feb 10 20:46:00 Finished on | Feb 10 20:47:51 Mapping speed, Million of reads per hour | 555.13 Number of input reads | 17116586 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16066923 Uniquely mapped reads % | 93.87% Average mapped length | 295.36 Number of splices: Total | 16827976 Number of splices: Annotated (sjdb) | 16535276 Number of splices: GT/AG | 16560342 Number of splices: GC/AG | 214256 Number of splices: AT/AC | 12383 Number of splices: Non-canonical | 40995 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 413120 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 29719 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 655449 655449 655449 N_multimapping 413120 413120 413120 N_noFeature 349458 15928257 405377 N_ambiguous 160142 587 77164 UnstrandedReadsAssigned:15557323 PositiveStrandReadsAssigned:138079 NegativeStrandReadsAssigned:15584382 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180118 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180118-trimmed-pair1.fastq SRR7180118-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,116,586 reads, 15,420,970 reads pseudoaligned [quant] estimated average fragment length: 246.557 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52401 SRR7180118.ke.tsv 34699 SRR7180118.se.tsv 87100 total ==> SRR7180118.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.44 1258 42.2534 Potri.005G024800.1.v4.1 1035 789.443 199 15.0067 Potri.004G059700.1.v4.1 961 715.471 24 1.99697 Potri.007G009000.2.v4.1 1416 1170.44 0 0 Potri.003G141000.2.v4.1 2943 2697.44 733.216 16.182 Potri.016G087400.1.v4.1 270 79.6577 1330 993.979 Potri.015G069301.1.v4.1 564 323.808 0 0 Potri.010G195200.1.v4.1 1773 1527.44 521 20.3061 Potri.012G127500.1.v4.1 977 731.464 2537 206.481 ==> SRR7180118.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 553 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 573 Potri.001G452600.v4.1 527 SRR7180118 completed mapping pipeline successfully