Starting /dee2/code/volunteer_pipeline.sh SRR7180119 current disk space = 3056024092672 free memory = 1294877808 SRR7180119 SRAfilesize 13cbadecb04b5380200ac1d5eafa7e4a SRR7180119.sra SRR7180119.sra file validated SRR7180119 is paired end SRR7180119 is conventional basespace SRR7180119 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180119_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.45025 30.0 18.0 33.0 18.0 33.0 2 29.362 31.0 27.0 33.0 25.0 33.0 3 30.9335 33.0 30.0 33.0 27.0 33.0 4 32.07675 33.0 32.0 33.0 31.0 33.0 5 32.50225 33.0 33.0 33.0 32.0 34.0 6 36.214 38.0 36.0 38.0 33.0 38.0 7 37.2075 38.0 38.0 38.0 36.0 38.0 8 37.3025 38.0 38.0 38.0 36.0 38.0 9 37.4075 38.0 38.0 38.0 37.0 38.0 10-14 37.4961 38.0 38.0 38.0 37.0 38.0 15-19 37.4926 38.0 38.0 38.0 37.2 38.0 20-24 37.5128 38.0 38.0 38.0 37.4 38.0 25-29 37.46895 38.0 38.0 38.0 37.4 38.0 30-34 37.4302 38.0 38.0 38.0 37.0 38.0 35-39 37.3846 38.0 38.0 38.0 37.0 38.0 40-44 37.33985 38.0 38.0 38.0 37.0 38.0 45-49 37.342650000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.30415 38.0 38.0 38.0 37.0 38.0 55-59 37.292 38.0 38.0 38.0 37.0 38.0 60-64 37.206950000000006 38.0 38.0 38.0 36.4 38.0 65-69 37.168899999999994 38.0 38.0 38.0 36.0 38.0 70-74 37.1079 38.0 38.0 38.0 36.0 38.0 75-79 37.0858 38.0 38.0 38.0 36.0 38.0 80-84 36.959199999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.93125 38.0 38.0 38.0 35.8 38.0 90-94 36.896699999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.7592 38.0 38.0 38.0 35.0 38.0 100-104 36.67495 38.0 38.0 38.0 35.0 38.0 105-109 36.59225 38.0 38.0 38.0 34.4 38.0 110-114 36.45035 38.0 38.0 38.0 34.0 38.0 115-119 36.377 38.0 38.0 38.0 34.0 38.0 120-124 36.11409999999999 38.0 37.4 38.0 33.4 38.0 125-129 35.95265 38.0 37.2 38.0 33.2 38.0 130-134 35.74464999999999 38.0 36.8 38.0 32.2 38.0 135-139 35.531499999999994 38.0 36.0 38.0 31.0 38.0 140-144 35.1965 38.0 36.0 38.0 30.2 38.0 145-149 34.7873 38.0 35.8 38.0 29.0 38.0 150-151 31.66975 36.5 32.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 4.0 20 0.0 21 4.0 22 5.0 23 8.0 24 10.0 25 9.0 26 14.0 27 16.0 28 21.0 29 23.0 30 34.0 31 48.0 32 68.0 33 93.0 34 140.0 35 225.0 36 650.0 37 2621.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.534341023601165 18.191461150888358 12.198355873773535 34.07584195173694 2 21.7 22.15 36.575 19.575 3 17.525 30.4 28.000000000000004 24.075 4 21.7 34.625 21.525 22.15 5 21.025 36.575 24.85 17.549999999999997 6 16.925 35.949999999999996 26.625 20.5 7 13.05 20.7 45.4 20.849999999999998 8 16.8 21.95 30.75 30.5 9 17.625 21.675 32.725 27.975 10-14 19.845 28.63 26.645000000000003 24.88 15-19 20.275000000000002 28.225 27.529999999999998 23.97 20-24 19.975 28.34 27.77 23.915 25-29 20.14 28.93 27.389999999999997 23.54 30-34 20.05 28.825 27.805000000000003 23.32 35-39 19.985 28.71 28.13 23.175 40-44 20.255000000000003 28.449999999999996 27.32 23.974999999999998 45-49 20.244999999999997 28.27 27.735 23.75 50-54 20.395 28.465 27.24 23.9 55-59 19.895 28.43 28.349999999999998 23.325000000000003 60-64 19.955000000000002 28.675 27.900000000000002 23.47 65-69 20.185 28.01 28.13 23.674999999999997 70-74 19.975 28.134999999999998 28.1 23.79 75-79 20.04 28.435 27.884999999999998 23.64 80-84 20.205000000000002 27.884999999999998 27.834999999999997 24.075 85-89 19.62 28.815 27.935 23.630000000000003 90-94 20.24 28.849999999999998 27.365000000000002 23.544999999999998 95-99 20.9 27.994999999999997 27.534999999999997 23.57 100-104 20.27 27.74 28.050000000000004 23.94 105-109 20.169999999999998 27.925 27.595 24.310000000000002 110-114 20.23 28.235 28.084999999999997 23.45 115-119 20.685000000000002 28.08 27.750000000000004 23.485 120-124 20.815 28.185 27.689999999999998 23.31 125-129 20.875 27.810000000000002 27.57 23.745 130-134 20.419999999999998 28.389999999999997 27.825 23.365 135-139 20.244999999999997 28.84 27.310000000000002 23.605 140-144 20.47 27.834999999999997 27.529999999999998 24.165 145-149 20.794999999999998 28.055000000000003 27.485 23.665 150-151 20.45 28.1625 27.0875 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 4.5 26 5.0 27 5.5 28 9.0 29 12.5 30 16.5 31 21.0 32 24.0 33 37.0 34 54.0 35 73.5 36 95.5 37 116.0 38 138.0 39 168.0 40 209.0 41 229.0 42 250.5 43 275.0 44 294.0 45 284.5 46 252.5 47 242.5 48 222.0 49 187.5 50 168.0 51 149.5 52 122.0 53 89.5 54 62.0 55 47.0 56 36.5 57 29.0 58 15.5 59 8.5 60 8.0 61 8.5 62 6.5 63 2.5 64 3.0 65 3.0 66 1.5 67 1.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.7250000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.05 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.7000000000000002 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 3.0625 0.0 0.0 0.0 0.0 128-129 3.2625 0.0 0.0 0.0 0.0 130-131 3.6624999999999996 0.0 0.0 0.0 0.0 132-133 4.1 0.0 0.0 0.0 0.0 134-135 4.575 0.0 0.0 0.0 0.0 136-137 4.925 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180119 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180119_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74 33.0 33.0 34.0 32.0 34.0 2 32.88525 33.0 33.0 34.0 32.0 34.0 3 32.839 34.0 33.0 34.0 32.0 34.0 4 32.75925 34.0 33.0 34.0 32.0 34.0 5 32.82875 34.0 33.0 34.0 32.0 34.0 6 36.90875 38.0 38.0 38.0 36.0 38.0 7 37.0925 38.0 38.0 38.0 37.0 38.0 8 36.99275 38.0 38.0 38.0 36.0 38.0 9 37.01725 38.0 38.0 38.0 37.0 38.0 10-14 37.06675 38.0 38.0 38.0 36.6 38.0 15-19 36.9686 38.0 38.0 38.0 36.0 38.0 20-24 36.92465 38.0 38.0 38.0 36.0 38.0 25-29 36.93595 38.0 38.0 38.0 36.0 38.0 30-34 36.92355 38.0 38.0 38.0 36.0 38.0 35-39 36.873000000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.84495 38.0 38.0 38.0 36.0 38.0 45-49 36.8117 38.0 38.0 38.0 36.0 38.0 50-54 36.83435000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.744 38.0 38.0 38.0 35.4 38.0 60-64 36.6674 38.0 38.0 38.0 35.0 38.0 65-69 36.64425 38.0 38.0 38.0 35.0 38.0 70-74 36.63035000000001 38.0 38.0 38.0 34.8 38.0 75-79 36.61605 38.0 38.0 38.0 35.0 38.0 80-84 36.504549999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.37265 38.0 38.0 38.0 34.0 38.0 90-94 36.30285 38.0 38.0 38.0 34.0 38.0 95-99 36.19815 38.0 38.0 38.0 33.6 38.0 100-104 35.91414999999999 38.0 37.6 38.0 32.8 38.0 105-109 35.77935 38.0 37.0 38.0 31.8 38.0 110-114 35.872949999999996 38.0 37.0 38.0 33.0 38.0 115-119 35.74715 38.0 37.0 38.0 31.8 38.0 120-124 35.45745 38.0 36.8 38.0 30.6 38.0 125-129 35.16525 38.0 36.0 38.0 29.0 38.0 130-134 34.83795 38.0 35.6 38.0 27.6 38.0 135-139 34.602250000000005 38.0 35.6 38.0 26.8 38.0 140-144 34.21274999999999 38.0 35.0 38.0 23.8 38.0 145-149 33.469849999999994 38.0 34.8 38.0 18.0 38.0 150-151 29.776249999999997 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 2.0 5 0.0 6 1.0 7 1.0 8 1.0 9 0.0 10 2.0 11 0.0 12 0.0 13 5.0 14 1.0 15 3.0 16 3.0 17 6.0 18 5.0 19 5.0 20 5.0 21 9.0 22 14.0 23 11.0 24 11.0 25 20.0 26 17.0 27 29.0 28 32.0 29 36.0 30 44.0 31 61.0 32 93.0 33 93.0 34 165.0 35 258.0 36 576.0 37 2479.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.085021255313826 15.728932233058265 16.60415103775944 27.581895473868467 2 25.831457864466117 20.580145036259065 35.13378344586147 18.454613653413354 3 20.424999999999997 26.35 31.324999999999996 21.9 4 23.7 34.425 22.85 19.025 5 24.10602650662666 37.684421105276314 20.68017004251063 17.5293823455864 6 17.554388597149288 38.45961490372593 24.10602650662666 19.879969992498125 7 18.754688672168044 17.479369842460617 42.5856464116029 21.180295073768445 8 19.900000000000002 23.775 28.199999999999996 28.125 9 20.655163790947736 25.98149537384346 29.132283070767688 24.23105776444111 10-14 23.385 27.400000000000002 26.72 22.495 15-19 22.777277727772777 28.222822282228222 27.927792779277926 21.07210721072107 20-24 22.465726008205746 28.78514960472331 27.108976283398377 21.640148103672573 25-29 23.202843412094513 27.71325590708851 27.843412094513415 21.240488586303563 30-34 23.148194520959585 28.657284519457104 27.986177192367407 20.208343767215904 35-39 22.578543869319038 27.980157338277294 28.230695996392242 21.210602796011425 40-44 22.58177628612934 28.137053549065772 28.026849671893 21.254320492911887 45-49 23.332499374530897 28.13109832374281 28.04103077307981 20.495371528646487 50-54 23.08961792358472 28.065613122624526 27.955591118223644 20.889177835567114 55-59 23.68118405920296 28.191409570478527 27.956397819890995 20.171008550427523 60-64 23.36616830841542 28.136406820341016 27.94139706985349 20.55602780139007 65-69 23.599999999999998 28.225 27.794999999999998 20.380000000000003 70-74 23.945 28.4 26.96 20.695 75-79 23.325000000000003 28.165000000000003 28.1 20.41 80-84 23.665 28.1 28.425 19.81 85-89 23.73 28.345 27.74 20.185 90-94 22.855 28.505000000000003 27.750000000000004 20.89 95-99 23.365 27.905 28.16 20.57 100-104 24.08 27.584999999999997 27.744999999999997 20.59 105-109 24.12 27.529999999999998 27.744999999999997 20.605 110-114 23.71 27.975 27.810000000000002 20.505000000000003 115-119 24.415 27.575 27.939999999999998 20.07 120-124 24.015 28.000000000000004 27.685 20.3 125-129 24.41 28.345 27.315 19.93 130-134 23.945 28.395 27.46 20.200000000000003 135-139 24.12 28.165000000000003 27.48 20.235 140-144 24.365000000000002 28.044999999999998 27.925 19.665 145-149 24.455 27.865000000000002 27.384999999999998 20.294999999999998 150-151 24.590573821727716 28.478559819977495 27.55344418052256 19.37742217777222 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.5 26 4.0 27 3.0 28 2.5 29 8.5 30 15.5 31 15.5 32 22.5 33 34.5 34 50.5 35 64.0 36 83.5 37 105.5 38 135.5 39 172.0 40 205.5 41 239.5 42 253.5 43 260.5 44 282.0 45 296.0 46 283.5 47 254.5 48 227.5 49 210.5 50 181.0 51 143.0 52 106.0 53 83.0 54 64.0 55 49.0 56 40.0 57 28.5 58 19.0 59 15.5 60 13.0 61 6.5 62 5.0 63 5.0 64 2.5 65 0.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.0 4 0.0 5 0.025 6 0.025 7 0.025 8 0.0 9 0.025 10-14 0.0 15-19 0.01 20-24 0.06999999999999999 25-29 0.12 30-34 0.165 35-39 0.215 40-44 0.185 45-49 0.075 50-54 0.02 55-59 0.005 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.37716872014080965 0.75 3 0.10057832537088257 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.05 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.6749999999999998 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.15 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 4.0625 0.0 0.0 0.0 0.0 134-135 4.5 0.0 0.0 0.0 0.0 136-137 4.825 0.0 0.0 0.0 0.0 138-139 5.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGTTA 10 0.00668174 146.05064 145 TTTGTTG 10 0.00668174 146.05064 2 >>END_MODULE Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948925 spots for SRR7180119.sra Written 948925 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra Read 948917 spots for SRR7180119.sra Written 948917 spots for SRR7180119.sra SRR ids: ['SRR7180119.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ijk5oy5o SRR7180119.sra spots: 18978348 blocks: [[1, 948917], [948918, 1897834], [1897835, 2846751], [2846752, 3795668], [3795669, 4744585], [4744586, 5693502], [5693503, 6642419], [6642420, 7591336], [7591337, 8540253], [8540254, 9489170], [9489171, 10438087], [10438088, 11387004], [11387005, 12335921], [12335922, 13284838], [13284839, 14233755], [14233756, 15182672], [15182673, 16131589], [16131590, 17080506], [17080507, 18029423], [18029424, 18978348]] SRR7180119 file size 6409439 SRR7180119 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180119 SRR7180119_1.fastq SRR7180119_2.fastq Input file: SRR7180119_1.fastq Paired file: SRR7180119_2.fastq trimmed: SRR7180119-trimmed-pair1.fastq, SRR7180119-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:36:21 2025 >> started Mon Feb 10 20:36:42 2025 >> done (21.120s) 18978348 read pairs processed; of these: 20915 ( 0.11%) short read pairs filtered out after trimming by size control 20433 ( 0.11%) empty read pairs filtered out after trimming by size control 18937000 (99.78%) read pairs available; of these: 7411003 (39.14%) trimmed read pairs available after processing 11525997 (60.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 1 0.00% 23 4 0.00% 24 4 0.00% 25 7 0.00% 26 5 0.00% 27 4 0.00% 28 5 0.00% 29 2 0.00% 30 5 0.00% 31 4 0.00% 32 7 0.00% 33 6 0.00% 34 3 0.00% 35 4 0.00% 36 4 0.00% 37 24 0.00% 38 6 0.00% 39 6 0.00% 40 29 0.00% 41 31 0.00% 42 9 0.00% 43 7 0.00% 44 31 0.00% 45 104 0.00% 46 67 0.00% 47 32 0.00% 48 36 0.00% 49 77 0.00% 50 145 0.00% 51 70 0.00% 52 56 0.00% 53 58 0.00% 54 113 0.00% 55 171 0.00% 56 58 0.00% 57 58 0.00% 58 87 0.00% 59 247 0.00% 60 131 0.00% 61 103 0.00% 62 140 0.00% 63 164 0.00% 64 178 0.00% 65 199 0.00% 66 199 0.00% 67 284 0.00% 68 280 0.00% 69 338 0.00% 70 386 0.00% 71 438 0.00% 72 515 0.00% 73 655 0.00% 74 745 0.00% 75 778 0.00% 76 947 0.01% 77 1129 0.01% 78 1242 0.01% 79 1287 0.01% 80 1480 0.01% 81 1696 0.01% 82 1963 0.01% 83 2380 0.01% 84 3363 0.02% 85 4131 0.02% 86 4553 0.02% 87 5009 0.03% 88 5451 0.03% 89 5525 0.03% 90 5941 0.03% 91 6408 0.03% 92 6873 0.04% 93 7071 0.04% 94 7907 0.04% 95 8361 0.04% 96 8876 0.05% 97 9430 0.05% 98 9787 0.05% 99 10463 0.06% 100 11063 0.06% 101 11699 0.06% 102 12755 0.07% 103 13498 0.07% 104 14011 0.07% 105 15133 0.08% 106 16058 0.08% 107 17153 0.09% 108 18315 0.10% 109 19018 0.10% 110 19417 0.10% 111 20679 0.11% 112 22078 0.12% 113 23407 0.12% 114 24289 0.13% 115 25925 0.14% 116 27208 0.14% 117 28049 0.15% 118 29864 0.16% 119 31306 0.17% 120 31904 0.17% 121 34548 0.18% 122 35534 0.19% 123 36576 0.19% 124 38302 0.20% 125 38922 0.21% 126 41046 0.22% 127 42174 0.22% 128 44234 0.23% 129 45931 0.24% 130 48324 0.26% 131 50001 0.26% 132 52820 0.28% 133 55210 0.29% 134 58160 0.31% 135 61409 0.32% 136 64579 0.34% 137 68429 0.36% 138 72263 0.38% 139 76710 0.41% 140 82034 0.43% 141 89174 0.47% 142 98106 0.52% 143 109005 0.58% 144 124077 0.66% 145 145857 0.77% 146 179539 0.95% 147 236130 1.25% 148 352672 1.86% 149 683096 3.61% 150 3784910 19.99% 151 11525997 60.86% 18937000 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=14 prefix-density=0.52 prefix-fanout=3.1 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=16 fanout-score=24.51 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=9.5 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=31 prefix-density=0.72 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=18.28 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=8.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7180119 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:37:31 Started mapping on | Feb 10 20:37:31 Finished on | Feb 10 20:40:04 Mapping speed, Million of reads per hour | 445.58 Number of input reads | 18937000 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17500313 Uniquely mapped reads % | 92.41% Average mapped length | 295.33 Number of splices: Total | 17560354 Number of splices: Annotated (sjdb) | 17227800 Number of splices: GT/AG | 17276974 Number of splices: GC/AG | 223037 Number of splices: AT/AC | 13613 Number of splices: Non-canonical | 46730 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 448901 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 36020 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.98% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1007476 1007476 1007476 N_multimapping 448901 448901 448901 N_noFeature 452841 17334357 522512 N_ambiguous 193439 1299 96320 UnstrandedReadsAssigned:16854033 PositiveStrandReadsAssigned:164657 NegativeStrandReadsAssigned:16881481 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180119 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180119-trimmed-pair1.fastq SRR7180119-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,937,000 reads, 16,724,299 reads pseudoaligned [quant] estimated average fragment length: 249.965 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7180119.ke.tsv 34699 SRR7180119.se.tsv 87100 total ==> SRR7180119.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.03 1337 42.9054 Potri.005G024800.1.v4.1 1035 786.035 233 16.828 Potri.004G059700.1.v4.1 961 712.047 38 3.02965 Potri.007G009000.2.v4.1 1416 1167.03 0 0 Potri.003G141000.2.v4.1 2943 2694.03 778.212 16.3988 Potri.016G087400.1.v4.1 270 79.1897 1191 853.807 Potri.015G069301.1.v4.1 564 322.03 0 0 Potri.010G195200.1.v4.1 1773 1524.03 482.879 17.9871 Potri.012G127500.1.v4.1 977 728.047 6835 532.962 ==> SRR7180119.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 88 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 626 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 351 SRR7180119 completed mapping pipeline successfully