Starting /dee2/code/volunteer_pipeline.sh SRR7180120 current disk space = 3056264749056 free memory = 1411107640 SRR7180120 SRAfilesize 50fadebd7bcb3f1075d05ec4580c4a53 SRR7180120.sra SRR7180120.sra file validated SRR7180120 is paired end SRR7180120 is conventional basespace SRR7180120 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180120_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.00725 32.0 18.0 33.0 18.0 33.0 2 29.42475 32.0 27.0 33.0 18.0 34.0 3 30.0625 31.0 29.0 33.0 25.0 33.0 4 31.54975 33.0 32.0 33.0 28.0 33.0 5 31.268 33.0 32.0 33.0 28.0 33.0 6 36.136 38.0 36.0 38.0 33.0 38.0 7 36.72925 38.0 37.0 38.0 34.0 38.0 8 37.467 38.0 38.0 38.0 37.0 38.0 9 37.52 38.0 38.0 38.0 37.0 38.0 10-14 37.5574 38.0 38.0 38.0 37.8 38.0 15-19 37.606300000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.61 38.0 38.0 38.0 38.0 38.0 25-29 37.6062 38.0 38.0 38.0 38.0 38.0 30-34 37.59325 38.0 38.0 38.0 38.0 38.0 35-39 37.56535 38.0 38.0 38.0 38.0 38.0 40-44 37.53189999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.50915 38.0 38.0 38.0 38.0 38.0 50-54 37.4403 38.0 38.0 38.0 37.4 38.0 55-59 37.37495 38.0 38.0 38.0 37.0 38.0 60-64 37.34770000000001 38.0 38.0 38.0 37.0 38.0 65-69 36.99165 38.0 38.0 38.0 36.6 38.0 70-74 36.97725 38.0 38.0 38.0 36.4 38.0 75-79 37.083600000000004 38.0 38.0 38.0 36.2 38.0 80-84 37.0872 38.0 38.0 38.0 36.0 38.0 85-89 37.0162 38.0 38.0 38.0 36.0 38.0 90-94 36.84974999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.721000000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.58815 38.0 38.0 38.0 34.2 38.0 105-109 36.54915 38.0 38.0 38.0 34.4 38.0 110-114 36.222500000000004 38.0 37.6 38.0 33.6 38.0 115-119 36.14595 38.0 37.6 38.0 33.4 38.0 120-124 35.89020000000001 38.0 37.0 38.0 33.0 38.0 125-129 35.73245 38.0 36.8 38.0 31.0 38.0 130-134 35.48415 38.0 36.2 38.0 30.6 38.0 135-139 35.14775 38.0 36.0 38.0 28.6 38.0 140-144 34.7307 38.0 35.2 38.0 27.8 38.0 145-149 33.37435 38.0 34.0 38.0 18.8 38.0 150-151 28.757125000000002 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 2.0 17 1.0 18 0.0 19 4.0 20 2.0 21 3.0 22 6.0 23 7.0 24 5.0 25 18.0 26 10.0 27 20.0 28 23.0 29 18.0 30 33.0 31 54.0 32 71.0 33 79.0 34 151.0 35 300.0 36 806.0 37 2383.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.56070087609512 16.270337922403 12.740926157697121 42.428035043804755 2 17.349999999999998 20.8 36.05 25.8 3 18.775 22.725 25.074999999999996 33.425 4 20.45 30.95 21.425 27.175 5 19.625 34.599999999999994 24.95 20.825 6 18.7 34.225 26.900000000000002 20.175 7 14.299999999999999 26.325 41.475 17.9 8 16.8 25.775 32.4 25.025 9 16.85 26.224999999999998 32.975 23.95 10-14 18.595 30.525000000000002 27.589999999999996 23.29 15-19 18.495 29.785 28.199999999999996 23.52 20-24 18.735620686205863 29.42882864859458 28.06842052615785 23.76713013904171 25-29 19.265 29.755 27.71 23.27 30-34 18.805 30.25 27.685 23.26 35-39 19.37 29.62 27.3 23.71 40-44 19.025 29.25 28.38 23.345 45-49 19.23 28.715000000000003 27.62 24.435000000000002 50-54 19.564999999999998 29.720000000000002 27.224999999999998 23.49 55-59 19.49 29.34 27.655 23.515 60-64 19.410823246974093 29.143743122936883 27.673301990597178 23.772131639491846 65-69 18.870016632226196 29.207197217882165 27.957260218738977 23.965525931152666 70-74 19.46443851613228 28.972668243821413 27.34182312377309 24.221070116273218 75-79 19.425 28.77 27.800000000000004 24.005000000000003 80-84 19.705000000000002 28.67 27.6 24.025 85-89 19.925 28.345 27.715 24.015 90-94 19.994999999999997 28.77 27.52 23.715 95-99 20.015 28.560000000000002 27.49 23.935000000000002 100-104 20.01901330931652 28.57500250175122 27.504252977083958 23.901731211848293 105-109 19.925 28.71 27.185 24.18 110-114 20.09212436789666 28.848946077204225 27.4620737996295 23.596855755269612 115-119 20.064999999999998 28.68 27.389999999999997 23.865 120-124 20.07 28.744999999999997 26.82 24.365000000000002 125-129 20.356017800890044 28.561428071403572 27.066353317665882 24.016200810040502 130-134 20.95 27.644999999999996 27.58 23.825 135-139 20.94 27.425 27.060000000000002 24.575 140-144 20.7 27.735 27.045 24.52 145-149 20.915 27.884999999999998 26.82 24.38 150-151 21.3625 28.0875 26.3 24.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 3.5 23 2.5 24 1.0 25 5.5 26 13.0 27 15.0 28 17.0 29 21.5 30 32.0 31 41.5 32 54.0 33 61.0 34 69.5 35 88.0 36 102.5 37 126.0 38 157.5 39 180.5 40 196.0 41 200.5 42 226.5 43 259.0 44 258.5 45 256.5 46 252.0 47 252.5 48 217.5 49 173.5 50 142.5 51 112.5 52 107.5 53 91.0 54 68.0 55 53.5 56 38.0 57 21.5 58 14.5 59 16.5 60 13.5 61 9.5 62 6.5 63 3.5 64 3.5 65 1.5 66 0.5 67 2.0 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.03 65-69 0.795 70-74 0.6649999999999999 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 0.0 110-114 0.135 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 2.0875000000000004 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.2249999999999996 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 4.4125 0.0 0.0 0.0 0.0 120-121 5.0125 0.0 0.0 0.0 0.0 122-123 5.6 0.0 0.0 0.0 0.0 124-125 6.15 0.0 0.0 0.0 0.0 126-127 6.775 0.0 0.0 0.0 0.0 128-129 7.2125 0.0 0.0 0.0 0.0 130-131 8.0125 0.0 0.0 0.0 0.0 132-133 8.712499999999999 0.0 0.0 0.0 0.0 134-135 9.6 0.0 0.0 0.0 0.0 136-137 10.375 0.0 0.0 0.0 0.0 138-139 11.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTCCA 10 0.0068537686 144.8375 6 >>END_MODULE SRR7180120 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180120_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.829 34.0 33.0 34.0 32.0 34.0 2 32.934 34.0 33.0 34.0 32.0 34.0 3 32.94475 34.0 33.0 34.0 32.0 34.0 4 32.88975 34.0 33.0 34.0 33.0 34.0 5 32.8775 34.0 33.0 34.0 33.0 34.0 6 37.039 38.0 38.0 38.0 37.0 38.0 7 36.97425 38.0 38.0 38.0 37.0 38.0 8 37.02225 38.0 38.0 38.0 38.0 38.0 9 36.858 38.0 38.0 38.0 37.0 38.0 10-14 36.86775 38.0 38.0 38.0 37.0 38.0 15-19 37.0231 38.0 38.0 38.0 37.2 38.0 20-24 37.02975 38.0 38.0 38.0 37.2 38.0 25-29 37.029849999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.06685 38.0 38.0 38.0 37.6 38.0 35-39 36.9865 38.0 38.0 38.0 37.2 38.0 40-44 36.9385 38.0 38.0 38.0 37.0 38.0 45-49 36.98685 38.0 38.0 38.0 37.0 38.0 50-54 36.855650000000004 38.0 38.0 38.0 36.6 38.0 55-59 36.8726 38.0 38.0 38.0 36.8 38.0 60-64 36.75320000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.58265 38.0 38.0 38.0 35.4 38.0 70-74 36.62595 38.0 38.0 38.0 36.0 38.0 75-79 36.62179999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.540150000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.41115 38.0 38.0 38.0 35.0 38.0 90-94 36.33435 38.0 38.0 38.0 34.8 38.0 95-99 36.138200000000005 38.0 38.0 38.0 34.0 38.0 100-104 35.982749999999996 38.0 38.0 38.0 33.6 38.0 105-109 35.97675 38.0 38.0 38.0 33.8 38.0 110-114 35.59755 38.0 37.4 38.0 31.8 38.0 115-119 35.444849999999995 38.0 37.0 38.0 31.0 38.0 120-124 35.401300000000006 38.0 36.8 38.0 30.6 38.0 125-129 34.97255 38.0 36.0 38.0 27.8 38.0 130-134 34.80135 38.0 35.8 38.0 28.0 38.0 135-139 34.089150000000004 38.0 34.2 38.0 23.4 38.0 140-144 33.6977 38.0 33.4 38.0 22.0 38.0 145-149 32.767450000000004 38.0 33.0 38.0 12.8 38.0 150-151 27.604 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 7.0 4 2.0 5 4.0 6 1.0 7 1.0 8 2.0 9 3.0 10 5.0 11 2.0 12 3.0 13 1.0 14 6.0 15 3.0 16 5.0 17 4.0 18 6.0 19 7.0 20 4.0 21 3.0 22 12.0 23 6.0 24 22.0 25 10.0 26 21.0 27 24.0 28 34.0 29 30.0 30 33.0 31 42.0 32 67.0 33 87.0 34 145.0 35 234.0 36 619.0 37 2527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.88709677419355 16.58266129032258 17.641129032258064 29.889112903225808 2 22.86217303822938 24.245472837022135 36.24245472837022 16.64989939637827 3 21.97083961789844 26.7219708396179 31.573655103066866 19.733534439416793 4 24.163942670354537 32.00905204928338 23.736484787528287 20.090520492833793 5 24.9811320754717 34.64150943396226 22.79245283018868 17.58490566037736 6 19.115800050238633 36.87515699572972 24.868123587038433 19.140919366993216 7 19.85423473234481 19.401859763759738 40.28650414677055 20.457401357124905 8 23.001508295625943 23.42885872297637 28.934137757667173 24.63549522373052 9 23.707440100882724 24.08575031525851 28.07061790668348 24.136191677175283 10-14 24.19403586540399 28.64195043320572 26.00241789240379 21.1615958089865 15-19 23.989797959591918 28.510702140428084 26.87037407481496 20.629125825165033 20-24 24.224999999999998 28.92 27.07 19.785 25-29 24.15 28.27 27.3 20.28 30-34 24.075 28.665000000000003 27.255000000000003 20.005 35-39 23.155 28.67 27.615000000000002 20.560000000000002 40-44 24.025 29.054999999999996 27.155 19.765 45-49 24.169999999999998 28.185 26.945000000000004 20.7 50-54 24.22 27.935 27.750000000000004 20.095 55-59 23.794999999999998 28.43 28.07 19.705000000000002 60-64 24.01 27.785 28.1 20.105 65-69 24.235 27.41 28.325 20.03 70-74 25.15 28.175 26.534999999999997 20.14 75-79 24.41622081104055 27.86639331966598 28.16140807040352 19.555977798889945 80-84 24.430993947276274 27.72247511380121 27.682457105697566 20.16407383322495 85-89 24.407440744074407 27.632763276327633 28.532853285328535 19.426942694269428 90-94 24.565 27.665 27.76 20.01 95-99 24.279999999999998 27.905 28.244999999999997 19.57 100-104 24.45 28.105000000000004 28.025 19.42 105-109 24.425 27.755000000000003 27.944999999999997 19.875 110-114 24.65 28.315 27.775 19.259999999999998 115-119 24.625 28.095 27.92 19.36 120-124 24.755 27.83 28.255000000000003 19.16 125-129 25.0 28.060000000000002 27.405 19.535 130-134 25.765 27.839999999999996 27.395000000000003 19.0 135-139 25.895000000000003 28.08 27.72 18.305 140-144 26.415 28.01 27.63 17.945 145-149 26.5 27.375 27.99 18.135 150-151 26.387500000000003 27.6125 27.474999999999998 18.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 0.5 26 2.5 27 4.0 28 6.5 29 9.5 30 10.5 31 15.0 32 22.0 33 32.5 34 45.0 35 58.5 36 72.5 37 100.5 38 132.0 39 151.0 40 186.0 41 216.0 42 244.5 43 280.0 44 293.5 45 299.5 46 298.5 47 267.5 48 230.0 49 214.5 50 188.5 51 142.0 52 109.5 53 92.5 54 71.5 55 48.5 56 33.5 57 26.5 58 23.5 59 19.0 60 12.5 61 10.0 62 7.0 63 3.5 64 3.0 65 1.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.6 3 0.5499999999999999 4 0.575 5 0.625 6 0.475 7 0.525 8 0.5499999999999999 9 0.8750000000000001 10-14 0.74 15-19 0.02 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.045 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.7750000000000004 0.0 0.0 0.0 0.0 114-115 3.2125 0.0 0.0 0.0 0.0 116-117 3.7125000000000004 0.0 0.0 0.0 0.0 118-119 4.3125 0.0 0.0 0.0 0.0 120-121 4.9125 0.0 0.0 0.0 0.0 122-123 5.5 0.0 0.0 0.0 0.0 124-125 6.05 0.0 0.0 0.0 0.0 126-127 6.6875 0.0 0.0 0.0 0.0 128-129 7.125 0.0 0.0 0.0 0.0 130-131 7.95 0.0 0.0 0.0 0.0 132-133 8.6875 0.0 0.0 0.0 0.0 134-135 9.625 0.0 0.0 0.0 0.0 136-137 10.412500000000001 0.0 0.0 0.0 0.0 138-139 11.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAGAT 10 0.006590799 146.72151 9 >>END_MODULE Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622019 spots for SRR7180120.sra Written 622019 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra Read 622003 spots for SRR7180120.sra Written 622003 spots for SRR7180120.sra SRR ids: ['SRR7180120.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bvzpy9xt SRR7180120.sra spots: 12440076 blocks: [[1, 622003], [622004, 1244006], [1244007, 1866009], [1866010, 2488012], [2488013, 3110015], [3110016, 3732018], [3732019, 4354021], [4354022, 4976024], [4976025, 5598027], [5598028, 6220030], [6220031, 6842033], [6842034, 7464036], [7464037, 8086039], [8086040, 8708042], [8708043, 9330045], [9330046, 9952048], [9952049, 10574051], [10574052, 11196054], [11196055, 11818057], [11818058, 12440076]] SRR7180120 file size 4193833 SRR7180120 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180120 SRR7180120_1.fastq SRR7180120_2.fastq Input file: SRR7180120_1.fastq Paired file: SRR7180120_2.fastq trimmed: SRR7180120-trimmed-pair1.fastq, SRR7180120-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:12:27 2025 >> started Mon Feb 10 20:12:48 2025 >> done (21.524s) 12440076 read pairs processed; of these: 27788 ( 0.22%) short read pairs filtered out after trimming by size control 23775 ( 0.19%) empty read pairs filtered out after trimming by size control 12388513 (99.59%) read pairs available; of these: 6668392 (53.83%) trimmed read pairs available after processing 5720121 (46.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 1 0.00% 21 6 0.00% 22 4 0.00% 23 5 0.00% 24 11 0.00% 25 5 0.00% 26 7 0.00% 27 7 0.00% 28 6 0.00% 29 8 0.00% 30 6 0.00% 31 4 0.00% 32 4 0.00% 33 7 0.00% 34 3 0.00% 35 5 0.00% 36 7 0.00% 37 9 0.00% 38 5 0.00% 39 7 0.00% 40 4 0.00% 41 10 0.00% 42 11 0.00% 43 6 0.00% 44 14 0.00% 45 18 0.00% 46 17 0.00% 47 23 0.00% 48 17 0.00% 49 26 0.00% 50 26 0.00% 51 35 0.00% 52 35 0.00% 53 47 0.00% 54 45 0.00% 55 60 0.00% 56 84 0.00% 57 82 0.00% 58 81 0.00% 59 110 0.00% 60 105 0.00% 61 134 0.00% 62 156 0.00% 63 170 0.00% 64 198 0.00% 65 221 0.00% 66 237 0.00% 67 288 0.00% 68 304 0.00% 69 385 0.00% 70 444 0.00% 71 526 0.00% 72 589 0.00% 73 679 0.01% 74 807 0.01% 75 944 0.01% 76 1102 0.01% 77 1309 0.01% 78 1428 0.01% 79 1643 0.01% 80 1776 0.01% 81 2107 0.02% 82 2496 0.02% 83 2832 0.02% 84 4101 0.03% 85 5424 0.04% 86 5789 0.05% 87 6123 0.05% 88 6616 0.05% 89 6754 0.05% 90 7236 0.06% 91 7756 0.06% 92 8273 0.07% 93 8877 0.07% 94 9447 0.08% 95 10547 0.09% 96 11196 0.09% 97 11842 0.10% 98 12763 0.10% 99 13757 0.11% 100 14466 0.12% 101 15434 0.12% 102 16270 0.13% 103 17531 0.14% 104 18733 0.15% 105 19948 0.16% 106 21465 0.17% 107 22449 0.18% 108 23469 0.19% 109 24566 0.20% 110 25978 0.21% 111 27122 0.22% 112 28311 0.23% 113 29130 0.24% 114 30855 0.25% 115 32454 0.26% 116 33483 0.27% 117 34815 0.28% 118 36666 0.30% 119 37444 0.30% 120 38782 0.31% 121 40598 0.33% 122 41801 0.34% 123 43756 0.35% 124 45929 0.37% 125 47086 0.38% 126 48458 0.39% 127 50395 0.41% 128 51948 0.42% 129 53715 0.43% 130 55611 0.45% 131 56605 0.46% 132 59784 0.48% 133 62141 0.50% 134 64764 0.52% 135 66154 0.53% 136 68931 0.56% 137 71526 0.58% 138 75396 0.61% 139 79247 0.64% 140 83783 0.68% 141 89055 0.72% 142 95943 0.77% 143 105167 0.85% 144 117909 0.95% 145 135958 1.10% 146 165581 1.34% 147 238277 1.92% 148 347629 2.81% 149 590210 4.76% 150 2907412 23.47% 151 5720121 46.17% 12388513 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=2.4 sequence=ACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=54.43 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.4 sequence=TACCATCAAATAAAGGCACACTACTATTCATTATTGATGTCTGTGATCAAATAACAAAGAGCGTGACGCGACCAAACCCATAGCCACCACCATCTAGTAACAGAACCATATCCTGCA criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=32 prefix-density=0.83 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=144.44 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.5 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7180120 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:14:01 Started mapping on | Feb 10 20:14:02 Finished on | Feb 10 20:16:00 Mapping speed, Million of reads per hour | 377.95 Number of input reads | 12388513 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11728793 Uniquely mapped reads % | 94.67% Average mapped length | 290.88 Number of splices: Total | 10421001 Number of splices: Annotated (sjdb) | 10176144 Number of splices: GT/AG | 10252225 Number of splices: GC/AG | 128205 Number of splices: AT/AC | 8956 Number of splices: Non-canonical | 31615 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 3.08 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283648 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 48309 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.53% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 397331 397331 397331 N_multimapping 283648 283648 283648 N_noFeature 365377 11584139 423803 N_ambiguous 140654 676 54222 UnstrandedReadsAssigned:11222762 PositiveStrandReadsAssigned:143978 NegativeStrandReadsAssigned:11250768 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7180120 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180120-trimmed-pair1.fastq SRR7180120-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,388,513 reads, 11,207,762 reads pseudoaligned [quant] estimated average fragment length: 210.288 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52401 SRR7180120.ke.tsv 34699 SRR7180120.se.tsv 87100 total ==> SRR7180120.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.71 1108 43.6025 Potri.005G024800.1.v4.1 1035 825.712 2028 174.816 Potri.004G059700.1.v4.1 961 751.712 18 1.70436 Potri.007G009000.2.v4.1 1416 1206.71 0 0 Potri.003G141000.2.v4.1 2943 2733.71 605 15.7523 Potri.016G087400.1.v4.1 270 89.7917 1064 843.426 Potri.015G069301.1.v4.1 564 355.836 0 0 Potri.010G195200.1.v4.1 1773 1563.71 295 13.4279 Potri.012G127500.1.v4.1 977 767.712 4145 384.297 ==> SRR7180120.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 570 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 99 SRR7180120 completed mapping pipeline successfully