Starting /dee2/code/volunteer_pipeline.sh SRR7180121 current disk space = 3056250544128 free memory = 1257405204 SRR7180121 SRAfilesize 05e9e1c0568db2d69434f962b32e4ba5 SRR7180121.sra SRR7180121.sra file validated SRR7180121 is paired end SRR7180121 is conventional basespace SRR7180121 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180121_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.0965 18.0 18.0 32.0 18.0 33.0 2 23.56925 18.0 18.0 30.0 18.0 33.0 3 27.12275 27.0 25.0 30.0 18.0 31.0 4 29.17075 32.0 27.0 32.0 25.0 33.0 5 31.30325 32.0 32.0 33.0 27.0 33.0 6 34.8295 37.0 34.0 38.0 29.0 38.0 7 36.654 38.0 37.0 38.0 34.0 38.0 8 37.369 38.0 38.0 38.0 37.0 38.0 9 37.42625 38.0 38.0 38.0 37.0 38.0 10-14 37.49425 38.0 38.0 38.0 37.0 38.0 15-19 37.57805 38.0 38.0 38.0 37.8 38.0 20-24 37.539699999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.5295 38.0 38.0 38.0 38.0 38.0 30-34 37.50745 38.0 38.0 38.0 38.0 38.0 35-39 37.4736 38.0 38.0 38.0 37.8 38.0 40-44 37.468 38.0 38.0 38.0 37.4 38.0 45-49 37.499 38.0 38.0 38.0 37.6 38.0 50-54 37.3691 38.0 38.0 38.0 37.0 38.0 55-59 37.30475 38.0 38.0 38.0 36.8 38.0 60-64 37.25505 38.0 38.0 38.0 37.0 38.0 65-69 36.7958 38.0 38.0 38.0 36.0 38.0 70-74 36.685649999999995 38.0 38.0 38.0 35.6 38.0 75-79 36.92355 38.0 38.0 38.0 35.6 38.0 80-84 36.9936 38.0 38.0 38.0 35.8 38.0 85-89 36.88105 38.0 38.0 38.0 35.6 38.0 90-94 36.66615 38.0 38.0 38.0 34.4 38.0 95-99 36.63675 38.0 38.0 38.0 34.6 38.0 100-104 36.31945 38.0 37.8 38.0 33.8 38.0 105-109 36.267700000000005 38.0 37.8 38.0 33.8 38.0 110-114 35.9426 38.0 37.2 38.0 32.8 38.0 115-119 35.86155 38.0 37.0 38.0 32.0 38.0 120-124 35.55285 38.0 36.2 38.0 31.0 38.0 125-129 35.340199999999996 38.0 36.0 38.0 30.0 38.0 130-134 35.109700000000004 38.0 35.4 38.0 28.6 38.0 135-139 34.62315 38.0 35.0 38.0 26.2 38.0 140-144 34.205349999999996 38.0 34.6 38.0 24.0 38.0 145-149 32.7397 38.0 33.2 38.0 15.6 38.0 150-151 28.148375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 2.0 18 1.0 19 2.0 20 4.0 21 3.0 22 4.0 23 5.0 24 12.0 25 5.0 26 24.0 27 20.0 28 29.0 29 30.0 30 45.0 31 60.0 32 92.0 33 129.0 34 189.0 35 393.0 36 1028.0 37 1919.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.95346509882412 10.883162371778834 13.960470352764572 37.20290217663248 2 22.825 14.075 38.9 24.2 3 20.775 23.150000000000002 25.424999999999997 30.65 4 23.325000000000003 29.4 23.525 23.75 5 22.85 30.65 27.224999999999998 19.275000000000002 6 18.25 33.275 26.375 22.1 7 13.700000000000001 24.625 43.45 18.224999999999998 8 17.175 24.325 30.825000000000003 27.675 9 16.7 24.175 34.975 24.15 10-14 20.555 29.520000000000003 26.44 23.485 15-19 19.91 28.939999999999998 27.500000000000004 23.65 20-24 20.40520260130065 28.049024512256125 28.52926463231616 23.016508254127064 25-29 20.205000000000002 28.605000000000004 27.96 23.23 30-34 19.8 28.499999999999996 27.85 23.849999999999998 35-39 19.8 28.405 27.755000000000003 24.04 40-44 20.24 28.910000000000004 27.6 23.25 45-49 20.200000000000003 28.51 27.325 23.965 50-54 19.925 28.249999999999996 27.605 24.22 55-59 20.075000000000003 28.15 27.435 24.34 60-64 20.129090363254278 28.44991494045832 27.489242469728808 23.931752226558594 65-69 20.098163234326773 28.199160046551636 27.860142690887013 23.84253402823458 70-74 20.374671783478085 28.55988689153706 26.96929913148859 24.096142193496263 75-79 20.25 27.639999999999997 28.155 23.955000000000002 80-84 20.03 28.165000000000003 27.845 23.96 85-89 20.89 28.060000000000002 27.215 23.835 90-94 20.52 27.985 26.875 24.62 95-99 20.47 27.55 28.065 23.915 100-104 20.46932852997098 28.630041028720104 26.883818673071147 24.016811768237766 105-109 20.849999999999998 27.54 27.295 24.315 110-114 20.708992589625474 27.6036451031444 27.458441818545964 24.228920488684157 115-119 20.5 28.144999999999996 27.555000000000003 23.799999999999997 120-124 20.775 27.785 27.195000000000004 24.245 125-129 21.38 28.315 26.655 23.65 130-134 20.685000000000002 28.689999999999998 26.66 23.965 135-139 20.93 28.535 26.55 23.985 140-144 20.919999999999998 27.98 26.82 24.279999999999998 145-149 21.349999999999998 28.78 25.405 24.465 150-151 20.8875 27.6625 26.9125 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 0.5 24 2.0 25 4.0 26 6.0 27 8.0 28 12.0 29 19.5 30 25.0 31 32.0 32 36.5 33 38.5 34 47.5 35 68.0 36 80.5 37 87.5 38 116.5 39 137.5 40 181.0 41 216.5 42 224.5 43 266.0 44 280.0 45 267.5 46 265.5 47 255.5 48 240.5 49 213.0 50 177.5 51 148.5 52 129.0 53 111.0 54 82.5 55 56.5 56 42.5 57 34.0 58 25.5 59 18.0 60 11.5 61 7.5 62 4.5 63 4.5 64 4.5 65 2.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.05 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.06999999999999999 65-69 1.185 70-74 0.98 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 0.0 110-114 0.13999999999999999 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.8250000000000002 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.5125 0.0 0.0 0.0 0.0 122-123 3.95 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.9375 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 5.95 0.0 0.0 0.0 0.0 132-133 6.525 0.0 0.0 0.0 0.0 134-135 7.2625 0.0 0.0 0.0 0.0 136-137 7.85 0.0 0.0 0.0 0.0 138-139 8.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCCTT 10 0.006830828 145.0 6 TCTCCCT 10 0.006830828 145.0 5 >>END_MODULE SRR7180121 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180121_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.732 34.0 33.0 34.0 32.0 34.0 2 32.824 34.0 33.0 34.0 32.0 34.0 3 32.8635 34.0 33.0 34.0 32.0 34.0 4 32.8735 34.0 33.0 34.0 33.0 34.0 5 32.812 34.0 33.0 34.0 33.0 34.0 6 36.991 38.0 38.0 38.0 37.0 38.0 7 37.04175 38.0 38.0 38.0 38.0 38.0 8 37.00575 38.0 38.0 38.0 37.0 38.0 9 36.827 38.0 38.0 38.0 37.0 38.0 10-14 36.795100000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.0865 38.0 38.0 38.0 37.0 38.0 20-24 37.14665 38.0 38.0 38.0 36.8 38.0 25-29 37.17215 38.0 38.0 38.0 37.0 38.0 30-34 37.169 38.0 38.0 38.0 37.0 38.0 35-39 37.1049 38.0 38.0 38.0 37.0 38.0 40-44 37.009550000000004 38.0 38.0 38.0 36.8 38.0 45-49 37.03060000000001 38.0 38.0 38.0 36.8 38.0 50-54 36.952549999999995 38.0 38.0 38.0 36.4 38.0 55-59 36.91485 38.0 38.0 38.0 36.4 38.0 60-64 36.8161 38.0 38.0 38.0 35.8 38.0 65-69 36.68840000000001 38.0 38.0 38.0 35.4 38.0 70-74 36.7238 38.0 38.0 38.0 36.0 38.0 75-79 36.70795 38.0 38.0 38.0 35.6 38.0 80-84 36.525850000000005 38.0 38.0 38.0 34.8 38.0 85-89 36.46455 38.0 38.0 38.0 34.6 38.0 90-94 36.343 38.0 38.0 38.0 34.0 38.0 95-99 36.19805 38.0 38.0 38.0 33.8 38.0 100-104 35.99575 38.0 37.8 38.0 33.4 38.0 105-109 35.947799999999994 38.0 37.8 38.0 33.0 38.0 110-114 35.59889999999999 38.0 37.0 38.0 31.2 38.0 115-119 35.43125 38.0 37.0 38.0 30.6 38.0 120-124 35.24835 38.0 36.4 38.0 29.8 38.0 125-129 34.99835 38.0 36.0 38.0 28.0 38.0 130-134 34.649 38.0 35.6 38.0 26.6 38.0 135-139 33.91275 38.0 33.4 38.0 22.6 38.0 140-144 33.4856 38.0 33.4 38.0 19.4 38.0 145-149 32.661 38.0 33.0 38.0 12.4 38.0 150-151 27.171125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 6.0 5 2.0 6 2.0 7 2.0 8 1.0 9 1.0 10 1.0 11 5.0 12 3.0 13 2.0 14 0.0 15 5.0 16 1.0 17 2.0 18 7.0 19 4.0 20 9.0 21 9.0 22 9.0 23 10.0 24 7.0 25 6.0 26 20.0 27 30.0 28 28.0 29 36.0 30 45.0 31 70.0 32 79.0 33 120.0 34 169.0 35 277.0 36 635.0 37 2386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.37815975733064 14.635995955510616 19.48938321536906 31.49646107178969 2 22.91771832407875 24.204946996466433 35.739525492175666 17.137809187279153 3 22.255866767600303 25.662376987130962 30.28009084027252 21.801665404996214 4 25.795053003533567 30.9439676930843 22.31196365471984 20.949015648662293 5 24.90527911088659 35.36246526900732 23.08663803990907 16.64561758019702 6 20.463709677419356 37.34879032258064 23.462701612903224 18.724798387096776 7 20.3530895334174 17.326607818411098 41.6141235813367 20.706179066834803 8 20.015143866733972 22.43816254416961 29.581019687026753 27.96567390206966 9 24.620060790273556 24.44275582573455 28.368794326241137 22.56838905775076 10-14 23.756067961165048 28.241302588996763 25.87479773462783 22.127831715210355 15-19 23.170792698174544 27.806951737934483 26.996749187296825 22.025506376594148 20-24 23.45 28.595 27.334999999999997 20.62 25-29 23.669999999999998 28.395 27.265 20.669999999999998 30-34 23.07 28.410000000000004 27.365000000000002 21.154999999999998 35-39 23.96 27.779999999999998 27.415 20.845 40-44 24.060000000000002 27.925 26.775 21.240000000000002 45-49 23.724999999999998 27.61 27.785 20.880000000000003 50-54 23.825 27.92 27.37 20.885 55-59 24.015 27.750000000000004 27.46 20.775 60-64 23.945 28.01 27.04 21.005 65-69 24.13 27.99 27.37 20.51 70-74 24.32 27.779999999999998 27.01 20.89 75-79 24.147414741474147 27.177717771777175 27.93779377937794 20.737073707370737 80-84 24.41563641823915 27.343710896441266 27.744131337904797 20.496521347414788 85-89 24.039615846338535 28.011204481792717 27.385954381752704 20.563225290116048 90-94 24.07 27.735 27.439999999999998 20.755000000000003 95-99 23.810000000000002 28.22 27.35 20.62 100-104 24.279999999999998 28.055000000000003 27.134999999999998 20.53 105-109 24.48 27.894999999999996 27.33 20.294999999999998 110-114 23.86 27.445000000000004 28.199999999999996 20.495 115-119 24.595 27.589999999999996 27.515 20.3 120-124 25.215 27.76 26.915 20.11 125-129 24.365000000000002 27.85 27.405 20.380000000000003 130-134 24.79 28.02 26.85 20.34 135-139 25.424999999999997 27.88 26.605 20.09 140-144 25.095 28.07 26.83 20.005 145-149 25.77 27.834999999999997 26.455000000000002 19.939999999999998 150-151 26.2125 28.1375 25.474999999999998 20.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 2.0 23 2.5 24 0.5 25 1.5 26 2.5 27 3.5 28 6.5 29 8.0 30 7.5 31 12.0 32 17.5 33 25.0 34 31.0 35 38.0 36 56.5 37 83.5 38 126.0 39 155.0 40 177.5 41 214.0 42 241.5 43 274.0 44 281.0 45 279.0 46 302.0 47 283.0 48 245.0 49 233.0 50 199.0 51 153.0 52 128.0 53 108.5 54 78.5 55 49.0 56 39.0 57 30.0 58 21.5 59 19.0 60 15.5 61 12.0 62 8.0 63 5.5 64 4.5 65 4.5 66 3.0 67 0.5 68 0.5 69 0.5 70 0.5 71 1.0 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.95 3 0.9249999999999999 4 0.95 5 1.0250000000000001 6 0.8 7 0.8750000000000001 8 0.95 9 1.3 10-14 1.1199999999999999 15-19 0.025 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.105 85-89 0.04 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.8250000000000002 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.5375 0.0 0.0 0.0 0.0 122-123 3.9749999999999996 0.0 0.0 0.0 0.0 124-125 4.4875 0.0 0.0 0.0 0.0 126-127 4.975 0.0 0.0 0.0 0.0 128-129 5.574999999999999 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 7.375 0.0 0.0 0.0 0.0 136-137 8.0 0.0 0.0 0.0 0.0 138-139 8.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGATG 10 0.006830828 145.0 145 >>END_MODULE Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742634 spots for SRR7180121.sra Written 742634 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra Read 742632 spots for SRR7180121.sra Written 742632 spots for SRR7180121.sra SRR ids: ['SRR7180121.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a6z_1ivx SRR7180121.sra spots: 14852642 blocks: [[1, 742632], [742633, 1485264], [1485265, 2227896], [2227897, 2970528], [2970529, 3713160], [3713161, 4455792], [4455793, 5198424], [5198425, 5941056], [5941057, 6683688], [6683689, 7426320], [7426321, 8168952], [8168953, 8911584], [8911585, 9654216], [9654217, 10396848], [10396849, 11139480], [11139481, 11882112], [11882113, 12624744], [12624745, 13367376], [13367377, 14110008], [14110009, 14852642]] SRR7180121 file size 5011372 SRR7180121 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180121 SRR7180121_1.fastq SRR7180121_2.fastq Input file: SRR7180121_1.fastq Paired file: SRR7180121_2.fastq trimmed: SRR7180121-trimmed-pair1.fastq, SRR7180121-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:50:47 2025 >> started Mon Feb 10 20:51:03 2025 >> done (15.987s) 14852642 read pairs processed; of these: 22515 ( 0.15%) short read pairs filtered out after trimming by size control 22623 ( 0.15%) empty read pairs filtered out after trimming by size control 14807504 (99.70%) read pairs available; of these: 7931709 (53.57%) trimmed read pairs available after processing 6875795 (46.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 4 0.00% 21 7 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 4 0.00% 26 10 0.00% 27 3 0.00% 28 6 0.00% 29 5 0.00% 30 4 0.00% 31 4 0.00% 32 6 0.00% 33 4 0.00% 34 8 0.00% 35 5 0.00% 36 1 0.00% 37 8 0.00% 38 13 0.00% 39 10 0.00% 40 3 0.00% 41 7 0.00% 42 6 0.00% 43 8 0.00% 44 9 0.00% 45 13 0.00% 46 15 0.00% 47 16 0.00% 48 24 0.00% 49 22 0.00% 50 23 0.00% 51 43 0.00% 52 35 0.00% 53 42 0.00% 54 59 0.00% 55 56 0.00% 56 64 0.00% 57 75 0.00% 58 79 0.00% 59 101 0.00% 60 101 0.00% 61 151 0.00% 62 155 0.00% 63 161 0.00% 64 189 0.00% 65 230 0.00% 66 246 0.00% 67 299 0.00% 68 357 0.00% 69 376 0.00% 70 398 0.00% 71 472 0.00% 72 636 0.00% 73 690 0.00% 74 821 0.01% 75 919 0.01% 76 1138 0.01% 77 1212 0.01% 78 1347 0.01% 79 1560 0.01% 80 1798 0.01% 81 2035 0.01% 82 2267 0.02% 83 2677 0.02% 84 4131 0.03% 85 4970 0.03% 86 5600 0.04% 87 6073 0.04% 88 6299 0.04% 89 6437 0.04% 90 6915 0.05% 91 7201 0.05% 92 7913 0.05% 93 8495 0.06% 94 9226 0.06% 95 9875 0.07% 96 10857 0.07% 97 11683 0.08% 98 12478 0.08% 99 13280 0.09% 100 14143 0.10% 101 14981 0.10% 102 15807 0.11% 103 16761 0.11% 104 17797 0.12% 105 18995 0.13% 106 20581 0.14% 107 21681 0.15% 108 22864 0.15% 109 24031 0.16% 110 25368 0.17% 111 26647 0.18% 112 27839 0.19% 113 29260 0.20% 114 30669 0.21% 115 32050 0.22% 116 33291 0.22% 117 34600 0.23% 118 36383 0.25% 119 37850 0.26% 120 39103 0.26% 121 40801 0.28% 122 42432 0.29% 123 43742 0.30% 124 45951 0.31% 125 47391 0.32% 126 49225 0.33% 127 51087 0.35% 128 53420 0.36% 129 55806 0.38% 130 57568 0.39% 131 59921 0.40% 132 62553 0.42% 133 65781 0.44% 134 68343 0.46% 135 71374 0.48% 136 74304 0.50% 137 77474 0.52% 138 82181 0.55% 139 88191 0.60% 140 94587 0.64% 141 101722 0.69% 142 111097 0.75% 143 124042 0.84% 144 141569 0.96% 145 165750 1.12% 146 207411 1.40% 147 296194 2.00% 148 453763 3.06% 149 784112 5.30% 150 3620729 24.45% 151 6875795 46.43% 14807504 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=28 prefix-density=0.49 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=31 fanout-score=374.84 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=32.5 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=29 prefix-density=0.42 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.14 sequence-density-rank=15 fanout-score=22.24 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=9.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7180121 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:51:54 Started mapping on | Feb 10 20:51:54 Finished on | Feb 10 20:53:43 Mapping speed, Million of reads per hour | 489.06 Number of input reads | 14807504 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13884548 Uniquely mapped reads % | 93.77% Average mapped length | 292.35 Number of splices: Total | 13439110 Number of splices: Annotated (sjdb) | 13192780 Number of splices: GT/AG | 13219918 Number of splices: GC/AG | 169904 Number of splices: AT/AC | 11262 Number of splices: Non-canonical | 38026 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383466 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 38785 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 558146 558146 558146 N_multimapping 383466 383466 383466 N_noFeature 309084 13736962 376111 N_ambiguous 147316 947 66210 UnstrandedReadsAssigned:13428148 PositiveStrandReadsAssigned:146639 NegativeStrandReadsAssigned:13442227 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7180121 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180121-trimmed-pair1.fastq SRR7180121-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,807,504 reads, 13,355,741 reads pseudoaligned [quant] estimated average fragment length: 221.004 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52401 SRR7180121.ke.tsv 34699 SRR7180121.se.tsv 87100 total ==> SRR7180121.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798 864 31.6236 Potri.005G024800.1.v4.1 1035 814.996 181 14.6154 Potri.004G059700.1.v4.1 961 741.012 27 2.39787 Potri.007G009000.2.v4.1 1416 1196 0 0 Potri.003G141000.2.v4.1 2943 2723 520.172 12.5715 Potri.016G087400.1.v4.1 270 86.251 1280 976.636 Potri.015G069301.1.v4.1 564 346.135 0 0 Potri.010G195200.1.v4.1 1773 1553 262 11.1024 Potri.012G127500.1.v4.1 977 757.007 3684 320.263 ==> SRR7180121.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 90 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 525 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 219 SRR7180121 completed mapping pipeline successfully