Starting /dee2/code/volunteer_pipeline.sh SRR7180122 current disk space = 3056134336512 free memory = 985994556 SRR7180122 SRAfilesize c108b88616f9994e56d6e29dbca3c7a7 SRR7180122.sra SRR7180122.sra file validated SRR7180122 is paired end SRR7180122 is conventional basespace SRR7180122 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180122_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.78875 18.0 18.0 27.0 18.0 32.0 2 24.75225 25.0 18.0 32.0 18.0 33.0 3 27.82725 29.0 27.0 31.0 18.0 33.0 4 31.528 32.0 32.0 33.0 27.0 33.0 5 32.38525 33.0 33.0 33.0 32.0 33.0 6 36.9035 38.0 37.0 38.0 35.0 38.0 7 37.33875 38.0 38.0 38.0 37.0 38.0 8 37.43975 38.0 38.0 38.0 37.0 38.0 9 37.39675 38.0 38.0 38.0 37.0 38.0 10-14 37.50935 38.0 38.0 38.0 37.6 38.0 15-19 37.52819999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.43455 38.0 38.0 38.0 37.6 38.0 25-29 37.40405 38.0 38.0 38.0 38.0 38.0 30-34 37.377050000000004 38.0 38.0 38.0 37.2 38.0 35-39 37.33985 38.0 38.0 38.0 37.6 38.0 40-44 37.326899999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.294050000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.17255 38.0 38.0 38.0 37.0 38.0 55-59 37.053999999999995 38.0 38.0 38.0 36.2 38.0 60-64 37.04430000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.740199999999994 38.0 38.0 38.0 35.8 38.0 70-74 36.6612 38.0 38.0 38.0 35.4 38.0 75-79 36.75075 38.0 38.0 38.0 35.2 38.0 80-84 36.738299999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.62835 38.0 38.0 38.0 35.0 38.0 90-94 36.51109999999999 38.0 38.0 38.0 34.6 38.0 95-99 36.355599999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.07935 38.0 37.6 38.0 33.4 38.0 105-109 36.0249 38.0 37.4 38.0 33.2 38.0 110-114 35.73049999999999 38.0 37.0 38.0 32.0 38.0 115-119 35.655150000000006 38.0 36.8 38.0 31.2 38.0 120-124 35.435 38.0 36.0 38.0 30.6 38.0 125-129 35.24615000000001 38.0 36.0 38.0 29.8 38.0 130-134 34.8987 38.0 35.6 38.0 27.8 38.0 135-139 34.41345 38.0 35.0 38.0 25.0 38.0 140-144 34.006150000000005 38.0 34.6 38.0 23.2 38.0 145-149 32.53285000000001 38.0 33.2 38.0 15.0 38.0 150-151 27.812875 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 3.0 7 2.0 8 0.0 9 2.0 10 1.0 11 2.0 12 2.0 13 5.0 14 1.0 15 1.0 16 4.0 17 5.0 18 1.0 19 5.0 20 5.0 21 8.0 22 9.0 23 8.0 24 11.0 25 14.0 26 18.0 27 15.0 28 29.0 29 25.0 30 60.0 31 35.0 32 85.0 33 118.0 34 176.0 35 359.0 36 937.0 37 2054.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.165038817931375 13.5236664162284 14.575507137490609 34.73578762834961 2 19.45 16.325 39.825 24.4 3 19.475 22.0 28.575 29.95 4 20.4 28.7 25.3 25.6 5 21.025 31.374999999999996 26.075 21.525 6 19.025 33.775 27.375 19.825 7 14.274999999999999 25.775 41.75 18.2 8 17.45 26.075 31.574999999999996 24.9 9 18.25 25.55 32.175 24.025 10-14 19.2 30.564999999999998 27.415 22.82 15-19 18.634999999999998 30.099999999999998 27.725 23.54 20-24 18.97379475895179 30.101020204040807 27.89057811562313 23.034606921384277 25-29 19.325 29.575000000000003 27.72 23.380000000000003 30-34 19.17 29.885 27.500000000000004 23.445 35-39 19.6 29.654999999999998 27.400000000000002 23.345 40-44 19.57 30.125 27.025 23.28 45-49 19.39 29.335 27.794999999999998 23.48 50-54 19.675 29.365000000000002 27.755000000000003 23.205000000000002 55-59 19.705000000000002 29.845 27.33 23.119999999999997 60-64 19.7259177753326 29.313794138241473 27.02310693207962 23.937181154346305 65-69 19.74592932399052 29.197963401724053 27.050461259262992 24.005646015022432 70-74 19.167463633160516 29.385412996426236 27.991141088236777 23.455982282176475 75-79 19.645000000000003 29.475 27.35 23.53 80-84 20.265 28.994999999999997 26.755000000000003 23.985 85-89 19.775000000000002 29.134999999999998 27.705000000000002 23.385 90-94 19.935 29.38 27.16 23.525 95-99 19.794999999999998 28.444999999999997 27.084999999999997 24.675 100-104 20.32016008004002 28.67933966983492 27.473736868434216 23.526763381690845 105-109 20.24 27.834999999999997 27.575 24.349999999999998 110-114 20.15015015015015 28.303303303303302 27.64764764764765 23.8988988988989 115-119 20.19 28.904999999999998 26.995 23.91 120-124 20.66 29.125 26.865 23.35 125-129 21.081054052702637 28.54142707135357 26.521326066303313 23.85619280964048 130-134 21.055 28.79 26.16 23.995 135-139 21.18 28.694999999999997 26.185000000000002 23.94 140-144 21.075 28.89 25.840000000000003 24.195 145-149 21.14 28.63 25.56 24.67 150-151 20.75 28.6125 25.9625 24.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 1.0 9 2.0 10 1.0 11 0.5 12 1.5 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 0.5 21 1.5 22 2.5 23 3.5 24 4.5 25 5.0 26 9.5 27 17.5 28 17.0 29 15.5 30 28.5 31 42.5 32 56.5 33 68.5 34 84.0 35 103.0 36 113.5 37 117.5 38 122.0 39 159.0 40 194.0 41 209.5 42 238.5 43 248.5 44 244.5 45 236.0 46 244.0 47 245.0 48 225.5 49 190.0 50 152.5 51 129.0 52 104.5 53 89.0 54 70.5 55 51.5 56 39.0 57 29.5 58 23.5 59 16.0 60 9.0 61 7.5 62 3.0 63 4.0 64 3.5 65 2.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.03 65-69 0.815 70-74 0.6649999999999999 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.0 110-114 0.1 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.8375 0.0 0.0 0.0 0.0 114-115 3.1625 0.0 0.0 0.0 0.0 116-117 3.525 0.0 0.0 0.0 0.0 118-119 3.95 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.737500000000001 0.0 0.0 0.0 0.0 126-127 6.45 0.0 0.0 0.0 0.0 128-129 7.15 0.0 0.0 0.0 0.0 130-131 7.875 0.0 0.0 0.0 0.0 132-133 8.475000000000001 0.0 0.0 0.0 0.0 134-135 9.337499999999999 0.0 0.0 0.0 0.0 136-137 10.1125 0.0 0.0 0.0 0.0 138-139 10.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180122 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180122_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4555 34.0 33.0 34.0 32.0 34.0 2 32.50475 34.0 33.0 34.0 32.0 34.0 3 32.4275 34.0 33.0 34.0 32.0 34.0 4 32.33575 34.0 33.0 34.0 32.0 34.0 5 32.386 34.0 33.0 34.0 32.0 34.0 6 36.353 38.0 38.0 38.0 36.0 38.0 7 36.32275 38.0 38.0 38.0 36.0 38.0 8 36.357 38.0 38.0 38.0 36.0 38.0 9 36.11575 38.0 38.0 38.0 35.0 38.0 10-14 36.198299999999996 38.0 38.0 38.0 35.6 38.0 15-19 36.2925 38.0 38.0 38.0 35.6 38.0 20-24 36.28855 38.0 38.0 38.0 35.6 38.0 25-29 36.2832 38.0 38.0 38.0 36.0 38.0 30-34 36.297399999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.2076 38.0 38.0 38.0 35.6 38.0 40-44 36.14665 38.0 38.0 38.0 35.4 38.0 45-49 36.17165 38.0 38.0 38.0 35.8 38.0 50-54 36.05255 38.0 38.0 38.0 35.0 38.0 55-59 36.0581 38.0 38.0 38.0 35.0 38.0 60-64 35.8877 38.0 38.0 38.0 34.4 38.0 65-69 35.8057 38.0 38.0 38.0 33.8 38.0 70-74 35.8671 38.0 38.0 38.0 34.0 38.0 75-79 35.798649999999995 38.0 38.0 38.0 34.0 38.0 80-84 35.625350000000005 38.0 38.0 38.0 33.6 38.0 85-89 35.512350000000005 38.0 38.0 38.0 32.8 38.0 90-94 35.40840000000001 38.0 38.0 38.0 32.4 38.0 95-99 35.23825000000001 38.0 38.0 38.0 30.6 38.0 100-104 35.013099999999994 38.0 37.6 38.0 29.2 38.0 105-109 34.99830000000001 38.0 37.8 38.0 29.4 38.0 110-114 34.705349999999996 38.0 37.0 38.0 27.6 38.0 115-119 34.44305 38.0 36.2 38.0 25.4 38.0 120-124 34.2434 38.0 36.2 38.0 24.0 38.0 125-129 33.902750000000005 38.0 35.6 38.0 21.0 38.0 130-134 33.6897 38.0 35.2 38.0 19.0 38.0 135-139 32.926050000000004 38.0 33.4 38.0 13.2 38.0 140-144 32.43775 38.0 33.2 38.0 13.2 38.0 145-149 31.6022 38.0 32.4 38.0 6.4 38.0 150-151 26.30925 33.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 59.0 3 17.0 4 7.0 5 8.0 6 10.0 7 5.0 8 4.0 9 4.0 10 7.0 11 5.0 12 6.0 13 10.0 14 7.0 15 12.0 16 7.0 17 2.0 18 8.0 19 8.0 20 11.0 21 5.0 22 17.0 23 12.0 24 13.0 25 15.0 26 16.0 27 23.0 28 21.0 29 29.0 30 37.0 31 54.0 32 72.0 33 96.0 34 147.0 35 234.0 36 610.0 37 2402.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.76008064516129 19.052419354838708 17.918346774193548 24.269153225806452 2 25.84862962031682 24.339954739753583 31.27985919034448 18.531556449585114 3 22.54335260115607 26.5393314903242 30.35938678059814 20.557929127921586 4 25.49019607843137 32.52890899949723 23.17747611865259 18.803418803418804 5 25.377263581488936 33.87826961770624 22.937625754527165 17.806841046277665 6 21.190057745418027 33.36680893798644 26.18629173989455 19.256841576700978 7 20.206081930133198 20.557929127921586 37.72304599145514 21.51294295049007 8 22.292033174164363 24.579039959788894 27.519477255591855 25.609449610454888 9 22.463402322059565 26.95608278647148 28.722867238768302 21.857647652700656 10-14 24.639943599556855 27.72182495719609 26.41252895558465 21.225702487662403 15-19 24.478671800770115 28.219232884932737 27.269090363554533 20.033004950742612 20-24 24.104999999999997 28.395 26.665 20.835 25-29 24.36 28.610000000000003 26.700000000000003 20.330000000000002 30-34 24.255 27.74 27.975 20.03 35-39 24.145 28.255000000000003 27.055 20.544999999999998 40-44 23.93 27.93 27.150000000000002 20.990000000000002 45-49 24.175 28.29 27.089999999999996 20.445 50-54 23.799999999999997 29.154999999999998 26.83 20.215 55-59 23.815 28.310000000000002 27.855 20.02 60-64 24.505 27.01 27.965 20.52 65-69 24.005000000000003 28.15 27.384999999999998 20.46 70-74 24.565 27.615000000000002 27.765 20.055 75-79 23.91119555977799 27.751387569378466 28.066403320166007 20.271013550677534 80-84 23.41936774709884 28.0812324929972 27.906162464985997 20.59323729491797 85-89 24.018602790418562 26.989048357253587 28.68430264539681 20.308046206931042 90-94 24.435000000000002 27.435 28.285 19.845 95-99 24.355 27.37 28.549999999999997 19.725 100-104 23.62 27.529999999999998 28.58 20.27 105-109 24.34 27.655 28.244999999999997 19.759999999999998 110-114 24.345 27.305 28.605000000000004 19.744999999999997 115-119 24.695 27.855 27.77 19.68 120-124 24.825 27.485 28.425 19.265 125-129 25.0 27.400000000000002 28.095 19.505 130-134 25.845000000000002 27.815 27.500000000000004 18.84 135-139 25.430000000000003 27.76 27.310000000000002 19.5 140-144 25.825 27.839999999999996 27.800000000000004 18.535 145-149 26.424999999999997 28.199999999999996 26.845000000000002 18.529999999999998 150-151 27.3625 26.8125 26.9625 18.862499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 2.0 18 1.0 19 1.5 20 1.5 21 0.5 22 0.5 23 1.0 24 1.5 25 4.5 26 4.5 27 6.0 28 8.5 29 10.0 30 10.0 31 11.5 32 17.0 33 26.0 34 38.0 35 54.5 36 73.0 37 85.5 38 121.0 39 156.0 40 178.0 41 205.0 42 234.5 43 274.0 44 290.5 45 309.5 46 309.5 47 265.5 48 245.0 49 216.0 50 174.5 51 157.0 52 127.0 53 90.0 54 65.5 55 53.0 56 44.0 57 32.5 58 24.0 59 13.0 60 9.0 61 9.0 62 9.0 63 7.5 64 4.5 65 4.5 66 3.0 67 0.5 68 2.0 69 2.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.575 3 0.525 4 0.5499999999999999 5 0.6 6 0.42500000000000004 7 0.525 8 0.525 9 0.95 10-14 0.7100000000000001 15-19 0.015 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.04 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.3264691109994977 0.65 3 0.025113008538422906 0.075 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.025 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.8375 0.0 0.0 0.0 0.0 112-113 3.1875 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 3.9375 0.0 0.0 0.0 0.0 118-119 4.3375 0.0 0.0 0.0 0.0 120-121 4.8125 0.0 0.0 0.0 0.0 122-123 5.5 0.0 0.0 0.0 0.0 124-125 6.137499999999999 0.0 0.0 0.0 0.0 126-127 6.9125 0.0 0.0 0.0 0.0 128-129 7.625 0.0 0.0 0.0 0.0 130-131 8.3625 0.0 0.0 0.0 0.0 132-133 9.05 0.0 0.0 0.0 0.0 134-135 9.962499999999999 0.0 0.0 0.0 0.0 136-137 10.7625 0.0 0.0 0.0 0.0 138-139 11.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGCTG 10 0.006830828 145.0 5 GGGGGGG 35 0.0035366106 20.714287 95-99 >>END_MODULE Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522505 spots for SRR7180122.sra Written 522505 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra Read 522495 spots for SRR7180122.sra Written 522495 spots for SRR7180122.sra SRR ids: ['SRR7180122.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b5mie188 SRR7180122.sra spots: 10449910 blocks: [[1, 522495], [522496, 1044990], [1044991, 1567485], [1567486, 2089980], [2089981, 2612475], [2612476, 3134970], [3134971, 3657465], [3657466, 4179960], [4179961, 4702455], [4702456, 5224950], [5224951, 5747445], [5747446, 6269940], [6269941, 6792435], [6792436, 7314930], [7314931, 7837425], [7837426, 8359920], [8359921, 8882415], [8882416, 9404910], [9404911, 9927405], [9927406, 10449910]] SRR7180122 file size 3519431 SRR7180122 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180122 SRR7180122_1.fastq SRR7180122_2.fastq Input file: SRR7180122_1.fastq Paired file: SRR7180122_2.fastq trimmed: SRR7180122-trimmed-pair1.fastq, SRR7180122-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:43:14 2025 >> started Mon Feb 10 20:43:31 2025 >> done (17.303s) 10449910 read pairs processed; of these: 60852 ( 0.58%) short read pairs filtered out after trimming by size control 48136 ( 0.46%) empty read pairs filtered out after trimming by size control 10340922 (98.96%) read pairs available; of these: 5929585 (57.34%) trimmed read pairs available after processing 4411337 (42.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 11 0.00% 20 10 0.00% 21 19 0.00% 22 14 0.00% 23 17 0.00% 24 12 0.00% 25 8 0.00% 26 12 0.00% 27 9 0.00% 28 9 0.00% 29 12 0.00% 30 5 0.00% 31 6 0.00% 32 8 0.00% 33 10 0.00% 34 4 0.00% 35 13 0.00% 36 7 0.00% 37 15 0.00% 38 15 0.00% 39 4 0.00% 40 23 0.00% 41 26 0.00% 42 20 0.00% 43 24 0.00% 44 27 0.00% 45 35 0.00% 46 30 0.00% 47 40 0.00% 48 40 0.00% 49 60 0.00% 50 63 0.00% 51 66 0.00% 52 66 0.00% 53 83 0.00% 54 78 0.00% 55 93 0.00% 56 89 0.00% 57 103 0.00% 58 135 0.00% 59 152 0.00% 60 161 0.00% 61 199 0.00% 62 228 0.00% 63 240 0.00% 64 256 0.00% 65 268 0.00% 66 330 0.00% 67 357 0.00% 68 446 0.00% 69 546 0.01% 70 564 0.01% 71 625 0.01% 72 803 0.01% 73 941 0.01% 74 1128 0.01% 75 1272 0.01% 76 1480 0.01% 77 1713 0.02% 78 1687 0.02% 79 1866 0.02% 80 2225 0.02% 81 2476 0.02% 82 2996 0.03% 83 3562 0.03% 84 6350 0.06% 85 8065 0.08% 86 8096 0.08% 87 8438 0.08% 88 8550 0.08% 89 8408 0.08% 90 8736 0.08% 91 9288 0.09% 92 9964 0.10% 93 10482 0.10% 94 11176 0.11% 95 11741 0.11% 96 12771 0.12% 97 13291 0.13% 98 14130 0.14% 99 15257 0.15% 100 16021 0.15% 101 16670 0.16% 102 18051 0.17% 103 18675 0.18% 104 20448 0.20% 105 21252 0.21% 106 22424 0.22% 107 23243 0.22% 108 24170 0.23% 109 25562 0.25% 110 26896 0.26% 111 27867 0.27% 112 29666 0.29% 113 30927 0.30% 114 32400 0.31% 115 33348 0.32% 116 33907 0.33% 117 35413 0.34% 118 36296 0.35% 119 37240 0.36% 120 38391 0.37% 121 40372 0.39% 122 41810 0.40% 123 43620 0.42% 124 45385 0.44% 125 46728 0.45% 126 47807 0.46% 127 48932 0.47% 128 50194 0.49% 129 51186 0.49% 130 52687 0.51% 131 54776 0.53% 132 57335 0.55% 133 60005 0.58% 134 62557 0.60% 135 64472 0.62% 136 66811 0.65% 137 68503 0.66% 138 70856 0.69% 139 74293 0.72% 140 77490 0.75% 141 82543 0.80% 142 89585 0.87% 143 98142 0.95% 144 110091 1.06% 145 126348 1.22% 146 152826 1.48% 147 211864 2.05% 148 306289 2.96% 149 514365 4.97% 150 2350260 22.73% 151 4411337 42.66% 10340922 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=32 prefix-density=1.11 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=147.82 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=13.9 sequence=TTGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=25 prefix-density=1.38 prefix-fanout=2.1 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.17 sequence-density-rank=19 fanout-score=27.54 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=9.5 sequence=TTGGTGCTGAGA SRR7180122 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:44:21 Started mapping on | Feb 10 20:44:22 Finished on | Feb 10 20:45:33 Mapping speed, Million of reads per hour | 524.33 Number of input reads | 10340922 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 9802499 Uniquely mapped reads % | 94.79% Average mapped length | 288.57 Number of splices: Total | 7819551 Number of splices: Annotated (sjdb) | 7654656 Number of splices: GT/AG | 7693115 Number of splices: GC/AG | 92799 Number of splices: AT/AC | 6737 Number of splices: Non-canonical | 26900 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269364 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 31431 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.23% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 313777 313777 313777 N_multimapping 269364 269364 269364 N_noFeature 258821 9663432 315833 N_ambiguous 128685 799 46324 UnstrandedReadsAssigned:9414993 PositiveStrandReadsAssigned:138268 NegativeStrandReadsAssigned:9440342 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7180122 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180122-trimmed-pair1.fastq SRR7180122-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,340,922 reads, 9,396,047 reads pseudoaligned [quant] estimated average fragment length: 204.959 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52401 SRR7180122.ke.tsv 34699 SRR7180122.se.tsv 87100 total ==> SRR7180122.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1814.04 1253 59.3804 Potri.005G024800.1.v4.1 1035 831.041 568 58.7578 Potri.004G059700.1.v4.1 961 757.048 9 1.02202 Potri.007G009000.2.v4.1 1416 1212.04 0 0 Potri.003G141000.2.v4.1 2943 2739.04 519 16.2895 Potri.016G087400.1.v4.1 270 92.1938 681.546 635.526 Potri.015G069301.1.v4.1 564 361.03 0 0 Potri.010G195200.1.v4.1 1773 1569.04 351 19.2315 Potri.012G127500.1.v4.1 977 773.041 4618 513.56 ==> SRR7180122.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 566 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 147 SRR7180122 completed mapping pipeline successfully