Starting /dee2/code/volunteer_pipeline.sh SRR7180123 current disk space = 2818724450304 free memory = 1580982004 SRR7180123 SRAfilesize a823c49a518ad26f95bb41f476dc8b34 SRR7180123.sra SRR7180123.sra file validated SRR7180123 is paired end SRR7180123 is conventional basespace SRR7180123 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180123_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56725 33.0 33.0 33.0 31.0 34.0 2 31.90975 33.0 32.0 33.0 28.0 34.0 3 32.123 33.0 33.0 33.0 29.0 34.0 4 31.664 33.0 31.0 33.0 29.0 34.0 5 31.63475 33.0 31.0 33.0 29.0 34.0 6 36.35 38.0 37.0 38.0 34.0 38.0 7 37.06825 38.0 37.0 38.0 35.0 38.0 8 37.35325 38.0 38.0 38.0 36.0 38.0 9 37.48525 38.0 38.0 38.0 37.0 38.0 10-14 37.61310000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.647850000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.6548 38.0 38.0 38.0 38.0 38.0 25-29 37.6366 38.0 38.0 38.0 38.0 38.0 30-34 37.62835 38.0 38.0 38.0 38.0 38.0 35-39 37.649699999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.575100000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.55985 38.0 38.0 38.0 38.0 38.0 50-54 37.53365 38.0 38.0 38.0 38.0 38.0 55-59 37.50665 38.0 38.0 38.0 37.6 38.0 60-64 37.474000000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.419650000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.34245 38.0 38.0 38.0 37.0 38.0 75-79 37.31795 38.0 38.0 38.0 37.0 38.0 80-84 37.2667 38.0 38.0 38.0 37.0 38.0 85-89 37.26455 38.0 38.0 38.0 37.0 38.0 90-94 37.18625 38.0 38.0 38.0 36.4 38.0 95-99 37.16415000000001 38.0 38.0 38.0 36.0 38.0 100-104 37.08915 38.0 38.0 38.0 36.0 38.0 105-109 36.96665 38.0 38.0 38.0 36.0 38.0 110-114 36.8953 38.0 38.0 38.0 35.2 38.0 115-119 36.8418 38.0 38.0 38.0 35.0 38.0 120-124 36.67954999999999 38.0 38.0 38.0 35.0 38.0 125-129 36.646699999999996 38.0 38.0 38.0 34.6 38.0 130-134 36.33095 38.0 38.0 38.0 33.8 38.0 135-139 36.130399999999995 38.0 37.4 38.0 33.4 38.0 140-144 36.019600000000004 38.0 37.4 38.0 33.4 38.0 145-149 35.65115 38.0 36.2 38.0 32.6 38.0 150-151 32.70325 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 5.0 24 7.0 25 10.0 26 12.0 27 4.0 28 11.0 29 18.0 30 27.0 31 34.0 32 41.0 33 60.0 34 78.0 35 193.0 36 479.0 37 3015.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.876606683804628 18.817480719794343 9.125964010282777 50.17994858611825 2 13.825000000000001 25.5 29.9 30.775000000000002 3 18.15 25.7 24.425 31.724999999999998 4 20.25 35.3 19.075 25.374999999999996 5 18.9 37.724999999999994 21.675 21.7 6 15.825 37.4 26.875 19.900000000000002 7 12.85 24.0 43.15 20.0 8 18.0 24.099999999999998 29.925 27.975 9 16.625 25.95 32.0 25.424999999999997 10-14 19.439999999999998 29.86 26.25 24.45 15-19 18.709999999999997 29.349999999999998 27.565 24.375 20-24 19.185 29.044999999999998 28.139999999999997 23.630000000000003 25-29 18.884999999999998 28.925 27.845 24.345 30-34 18.705 28.89 28.044999999999998 24.36 35-39 18.665000000000003 29.020000000000003 28.134999999999998 24.18 40-44 19.470000000000002 29.04 27.565 23.925 45-49 19.485 28.405 28.15 23.96 50-54 19.314999999999998 29.165000000000003 27.625 23.895 55-59 19.919999999999998 29.220000000000002 27.439999999999998 23.419999999999998 60-64 19.74 28.32 28.035 23.905 65-69 19.53 28.525 27.900000000000002 24.044999999999998 70-74 19.485 28.555000000000003 27.02 24.94 75-79 19.555 28.51 27.975 23.96 80-84 19.555 28.095 27.865000000000002 24.485 85-89 19.68 27.855 28.255000000000003 24.21 90-94 19.99 27.815 27.965 24.23 95-99 19.6 28.655 27.375 24.37 100-104 19.564999999999998 28.139999999999997 28.28 24.015 105-109 20.119999999999997 28.025 27.55 24.305 110-114 20.49 27.544999999999998 27.97 23.995 115-119 20.185 28.62 27.295 23.9 120-124 20.419999999999998 27.46 27.46 24.66 125-129 20.43 28.105000000000004 27.779999999999998 23.685000000000002 130-134 19.895 28.49 27.145000000000003 24.47 135-139 20.150000000000002 27.87 27.67 24.310000000000002 140-144 20.560000000000002 27.88 27.46 24.099999999999998 145-149 20.7 27.750000000000004 27.200000000000003 24.349999999999998 150-151 20.4625 28.262500000000003 27.325 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 2.0 24 4.0 25 6.5 26 8.5 27 8.0 28 8.0 29 9.5 30 14.5 31 24.0 32 37.0 33 51.5 34 61.5 35 75.0 36 103.0 37 117.5 38 127.5 39 159.5 40 185.0 41 220.5 42 252.5 43 269.0 44 290.0 45 288.0 46 273.0 47 249.0 48 224.0 49 196.0 50 162.0 51 140.5 52 113.5 53 90.0 54 70.0 55 45.5 56 29.5 57 22.5 58 17.0 59 10.0 60 9.0 61 6.5 62 3.0 63 4.0 64 3.0 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.5625 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.7125 0.0 0.0 0.0 0.0 132-133 5.0375 0.0 0.0 0.0 0.0 134-135 5.55 0.0 0.0 0.0 0.0 136-137 6.175000000000001 0.0 0.0 0.0 0.0 138-139 6.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACGTG 10 0.006836113 144.9625 8 >>END_MODULE SRR7180123 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180123_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13725 33.0 33.0 34.0 33.0 34.0 2 33.22625 34.0 33.0 34.0 33.0 34.0 3 33.21225 34.0 33.0 34.0 33.0 34.0 4 33.29125 34.0 33.0 34.0 33.0 34.0 5 33.2935 34.0 33.0 34.0 33.0 34.0 6 37.43275 38.0 38.0 38.0 38.0 38.0 7 37.36675 38.0 38.0 38.0 38.0 38.0 8 37.321 38.0 38.0 38.0 37.0 38.0 9 37.4 38.0 38.0 38.0 38.0 38.0 10-14 37.4057 38.0 38.0 38.0 38.0 38.0 15-19 37.31585 38.0 38.0 38.0 37.2 38.0 20-24 37.33775000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.29655 38.0 38.0 38.0 37.4 38.0 30-34 37.27315 38.0 38.0 38.0 37.4 38.0 35-39 37.20195 38.0 38.0 38.0 37.0 38.0 40-44 37.167100000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.19725 38.0 38.0 38.0 37.0 38.0 50-54 37.172000000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.118449999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.062999999999995 38.0 38.0 38.0 36.8 38.0 65-69 37.0253 38.0 38.0 38.0 36.2 38.0 70-74 36.9744 38.0 38.0 38.0 36.0 38.0 75-79 36.96535 38.0 38.0 38.0 36.0 38.0 80-84 36.90465 38.0 38.0 38.0 36.0 38.0 85-89 36.85195 38.0 38.0 38.0 36.0 38.0 90-94 36.747350000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.6456 38.0 38.0 38.0 35.0 38.0 100-104 36.4302 38.0 38.0 38.0 34.2 38.0 105-109 36.31105 38.0 38.0 38.0 34.0 38.0 110-114 36.24649999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.121849999999995 38.0 37.8 38.0 33.6 38.0 120-124 35.8952 38.0 37.0 38.0 33.0 38.0 125-129 35.7543 38.0 36.8 38.0 32.4 38.0 130-134 35.403 38.0 36.0 38.0 31.0 38.0 135-139 35.3414 38.0 36.0 38.0 31.0 38.0 140-144 34.82685 38.0 35.2 38.0 28.6 38.0 145-149 34.321600000000004 38.0 35.0 38.0 26.8 38.0 150-151 30.782249999999998 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 1.0 5 2.0 6 1.0 7 1.0 8 2.0 9 2.0 10 2.0 11 1.0 12 2.0 13 1.0 14 4.0 15 1.0 16 1.0 17 4.0 18 2.0 19 1.0 20 6.0 21 3.0 22 10.0 23 6.0 24 4.0 25 11.0 26 14.0 27 21.0 28 20.0 29 24.0 30 43.0 31 28.0 32 55.0 33 75.0 34 112.0 35 232.0 36 565.0 37 2738.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.525 15.45 18.875 30.15 2 23.849999999999998 23.375 34.449999999999996 18.325 3 22.725 26.525 30.45 20.3 4 25.974999999999998 34.175 20.95 18.9 5 24.3 36.775000000000006 22.1 16.825000000000003 6 18.534267133566786 37.26863431715858 25.362681340670335 18.8344172086043 7 18.63431715857929 18.48424212106053 41.67083541770886 21.210605302651324 8 21.630407601900476 22.73068267066767 28.457114278569644 27.181795448862218 9 22.575 24.65 29.375 23.400000000000002 10-14 23.9407733480066 28.822970336651494 25.726576959631835 21.50967935571007 15-19 23.716858429214607 28.299149574787393 27.6088044022011 20.3751875937969 20-24 23.496720572773246 29.09928403344515 27.011465478395834 20.392529915385772 25-29 23.667334669338675 28.717434869739478 27.364729458917836 20.25050100200401 30-34 23.7245665029568 28.811265911596674 26.806655307206572 20.65751227823995 35-39 23.644110275689222 28.501253132832083 27.012531328320804 20.842105263157894 40-44 24.586466165413533 28.225563909774436 27.37844611528822 19.80952380952381 45-49 23.55092430238966 28.550673813937177 27.44852462301488 20.449877260658283 50-54 23.746807551705142 28.313886524112377 27.47258250287946 20.46672342130302 55-59 24.429315178213855 28.083700440528638 27.11253504205046 20.37444933920705 60-64 23.73229213595635 28.372628522801218 27.39650598187916 20.498573359363267 65-69 23.97136850535589 28.4212633897287 27.22995294824307 20.377415156672342 70-74 24.584584584584583 28.41841841841842 27.102102102102105 19.894894894894897 75-79 24.67974379503603 28.437750200160128 27.126701361088873 19.75580464371497 80-84 24.338121215154395 27.61123066913568 27.92152544917672 20.129122666533206 85-89 24.219375500400318 27.797237790232188 27.982385908726982 20.00100080064051 90-94 24.32459475685411 28.01681008605163 27.68160896537923 19.976986191715028 95-99 24.437331199359807 28.21346403921176 27.69330799239772 19.655896769030708 100-104 24.20831457301516 28.22052128670769 27.3250287658212 20.24613537445595 105-109 24.316079019754937 28.29707426856714 27.376844211052763 20.010002500625156 110-114 24.688703305495824 28.189228384257635 27.49412411861779 19.627944191628742 115-119 24.15224567370211 27.813344003200964 28.14344303290987 19.890967290187056 120-124 24.81364750612837 28.11046075341438 27.094902196207915 19.980989544249336 125-129 25.02126807786619 27.953760696592106 27.528399139268377 19.496572086273332 130-134 24.907416675007507 27.739965969372438 28.04023621259133 19.312381143028727 135-139 24.981237804572974 27.898133786961527 27.73802971931756 19.382598689147944 140-144 25.724148281554854 27.69022962629446 27.490119565761166 19.095502526389517 145-149 26.15069041424855 27.55153091855113 27.301380828497095 18.99639783870322 150-151 25.735754539762052 27.91484032561052 27.45147150907952 18.897933625547903 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.5 22 1.0 23 0.5 24 1.5 25 1.5 26 2.0 27 4.0 28 5.0 29 6.0 30 12.0 31 15.0 32 13.0 33 23.0 34 34.0 35 51.5 36 73.0 37 83.5 38 112.5 39 162.5 40 200.5 41 228.5 42 259.5 43 291.0 44 316.5 45 304.5 46 281.0 47 265.5 48 243.5 49 217.0 50 184.5 51 152.5 52 111.5 53 84.0 54 68.5 55 45.5 56 34.0 57 28.5 58 19.5 59 15.5 60 12.0 61 7.0 62 6.5 63 4.0 64 1.5 65 1.0 66 2.0 67 2.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.025 9 0.0 10-14 0.045 15-19 0.05 20-24 0.135 25-29 0.2 30-34 0.22999999999999998 35-39 0.25 40-44 0.25 45-49 0.19499999999999998 50-54 0.155 55-59 0.12 60-64 0.11499999999999999 65-69 0.11 70-74 0.1 75-79 0.08 80-84 0.095 85-89 0.08 90-94 0.06 95-99 0.03 100-104 0.055 105-109 0.025 110-114 0.015 115-119 0.03 120-124 0.055 125-129 0.08499999999999999 130-134 0.09 135-139 0.065 140-144 0.055 145-149 0.06 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.8875000000000002 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.3375000000000004 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.699999999999999 0.0 0.0 0.0 0.0 132-133 5.012499999999999 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 6.1375 0.0 0.0 0.0 0.0 138-139 6.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAATA 10 0.006830828 145.0 2 >>END_MODULE Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819424 spots for SRR7180123.sra Written 819424 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra Read 819419 spots for SRR7180123.sra Written 819419 spots for SRR7180123.sra SRR ids: ['SRR7180123.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8gq0h1qq SRR7180123.sra spots: 16388385 blocks: [[1, 819419], [819420, 1638838], [1638839, 2458257], [2458258, 3277676], [3277677, 4097095], [4097096, 4916514], [4916515, 5735933], [5735934, 6555352], [6555353, 7374771], [7374772, 8194190], [8194191, 9013609], [9013610, 9833028], [9833029, 10652447], [10652448, 11471866], [11471867, 12291285], [12291286, 13110704], [13110705, 13930123], [13930124, 14749542], [14749543, 15568961], [15568962, 16388385]] SRR7180123 file size 5531785 SRR7180123 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180123 SRR7180123_1.fastq SRR7180123_2.fastq Input file: SRR7180123_1.fastq Paired file: SRR7180123_2.fastq trimmed: SRR7180123-trimmed-pair1.fastq, SRR7180123-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 16:02:11 2025 >> started Thu Apr 10 16:02:28 2025 >> done (16.739s) 16388385 read pairs processed; of these: 24791 ( 0.15%) short read pairs filtered out after trimming by size control 15123 ( 0.09%) empty read pairs filtered out after trimming by size control 16348471 (99.76%) read pairs available; of these: 6101613 (37.32%) trimmed read pairs available after processing 10246858 (62.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 4 0.00% 22 5 0.00% 23 6 0.00% 24 2 0.00% 25 8 0.00% 26 2 0.00% 27 6 0.00% 28 3 0.00% 29 1 0.00% 30 9 0.00% 31 2 0.00% 32 3 0.00% 33 5 0.00% 34 5 0.00% 35 6 0.00% 36 19 0.00% 37 14 0.00% 38 15 0.00% 39 8 0.00% 40 32 0.00% 41 23 0.00% 42 15 0.00% 43 12 0.00% 44 18 0.00% 45 48 0.00% 46 42 0.00% 47 75 0.00% 48 46 0.00% 49 54 0.00% 50 50 0.00% 51 90 0.00% 52 29 0.00% 53 42 0.00% 54 61 0.00% 55 134 0.00% 56 55 0.00% 57 71 0.00% 58 69 0.00% 59 102 0.00% 60 113 0.00% 61 108 0.00% 62 142 0.00% 63 157 0.00% 64 158 0.00% 65 197 0.00% 66 217 0.00% 67 266 0.00% 68 340 0.00% 69 339 0.00% 70 424 0.00% 71 510 0.00% 72 571 0.00% 73 713 0.00% 74 785 0.00% 75 864 0.01% 76 1052 0.01% 77 1115 0.01% 78 1359 0.01% 79 1480 0.01% 80 1707 0.01% 81 1897 0.01% 82 2184 0.01% 83 2626 0.02% 84 4023 0.02% 85 4891 0.03% 86 5158 0.03% 87 5597 0.03% 88 5935 0.04% 89 6259 0.04% 90 6665 0.04% 91 6996 0.04% 92 7556 0.05% 93 7846 0.05% 94 8674 0.05% 95 9010 0.06% 96 10012 0.06% 97 10653 0.07% 98 11527 0.07% 99 11989 0.07% 100 12757 0.08% 101 13590 0.08% 102 14281 0.09% 103 15083 0.09% 104 15907 0.10% 105 17004 0.10% 106 18186 0.11% 107 19399 0.12% 108 20374 0.12% 109 21305 0.13% 110 22186 0.14% 111 23513 0.14% 112 24602 0.15% 113 25443 0.16% 114 26347 0.16% 115 28048 0.17% 116 29413 0.18% 117 30652 0.19% 118 32172 0.20% 119 33567 0.21% 120 35175 0.22% 121 37632 0.23% 122 38084 0.23% 123 38905 0.24% 124 40651 0.25% 125 41900 0.26% 126 43459 0.27% 127 44887 0.27% 128 46064 0.28% 129 48054 0.29% 130 49721 0.30% 131 51987 0.32% 132 53874 0.33% 133 55635 0.34% 134 57987 0.35% 135 59772 0.37% 136 62087 0.38% 137 65025 0.40% 138 67810 0.41% 139 72383 0.44% 140 75198 0.46% 141 79632 0.49% 142 86470 0.53% 143 92384 0.57% 144 102247 0.63% 145 114893 0.70% 146 133855 0.82% 147 168641 1.03% 148 239973 1.47% 149 461554 2.82% 150 2948535 18.04% 151 10246858 62.68% 16348471 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.14 fanout-score-rank=21 prefix-density=0.53 prefix-fanout=2.9 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=75.51 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.5 sequence=AACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=33 prefix-density=0.67 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=57.79 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.2 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATGAGGGTGTTGATGACCAAGCTGCCAAGGTTGTTGACATCGTTGACACATTTAGGCTCCAGGAGCAACCTCCATTTGACAAGAAGCAGTTTCTTACACAGATTAAGAAATTTATCAAGAATCTGTCGGAGAAACTTGATGAGGACCAGAAGGAACATTTTAGAAAGAACATTGAGGGAGCAACCAAGTTCTTGCTTTCAAAAATCAAGGACTTGCAATTCTTTGTGGGGGAGAGCATGCATGATGATGGTTGTTTGGTCTTTGCTT SRR7180123 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 16:03:08 Started mapping on | Apr 10 16:03:09 Finished on | Apr 10 16:04:44 Mapping speed, Million of reads per hour | 619.52 Number of input reads | 16348471 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15466200 Uniquely mapped reads % | 94.60% Average mapped length | 294.34 Number of splices: Total | 14753955 Number of splices: Annotated (sjdb) | 14436810 Number of splices: GT/AG | 14505669 Number of splices: GC/AG | 192085 Number of splices: AT/AC | 14080 Number of splices: Non-canonical | 42121 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391947 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 40018 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 510207 510207 510207 N_multimapping 391947 391947 391947 N_noFeature 447098 15296798 520577 N_ambiguous 174987 877 78650 UnstrandedReadsAssigned:14844115 PositiveStrandReadsAssigned:168525 NegativeStrandReadsAssigned:14866973 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180123 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180123-trimmed-pair1.fastq SRR7180123-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,348,471 reads, 14,743,709 reads pseudoaligned [quant] estimated average fragment length: 227.698 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7180123.ke.tsv 34699 SRR7180123.se.tsv 87100 total ==> SRR7180123.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.3 1301 42.7282 Potri.005G024800.1.v4.1 1035 808.302 293 21.3256 Potri.004G059700.1.v4.1 961 734.307 30 2.40353 Potri.007G009000.2.v4.1 1416 1189.3 0 0 Potri.003G141000.2.v4.1 2943 2716.3 512 11.0892 Potri.016G087400.1.v4.1 270 82.5473 1182.49 842.756 Potri.015G069301.1.v4.1 564 339.629 0 0 Potri.010G195200.1.v4.1 1773 1546.3 427.626 16.2696 Potri.012G127500.1.v4.1 977 750.307 14778 1158.73 ==> SRR7180123.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 133 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 686 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 511 SRR7180123 completed mapping pipeline successfully