Starting /dee2/code/volunteer_pipeline.sh SRR7180124 current disk space = 3056945266688 free memory = 1462433124 SRR7180124 SRAfilesize 9e6e9699c8accb3d1cfb17413988f705 SRR7180124.sra SRR7180124.sra file validated SRR7180124 is paired end SRR7180124 is conventional basespace SRR7180124 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180124_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.349 32.0 18.0 33.0 18.0 33.0 2 29.017 32.0 27.0 33.0 18.0 34.0 3 29.532 31.0 29.0 33.0 18.0 33.0 4 31.6345 33.0 32.0 33.0 30.0 33.0 5 32.662 33.0 33.0 33.0 32.0 34.0 6 37.004 38.0 37.0 38.0 35.0 38.0 7 37.51575 38.0 38.0 38.0 37.0 38.0 8 37.47975 38.0 38.0 38.0 37.0 38.0 9 37.556 38.0 38.0 38.0 38.0 38.0 10-14 37.667649999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.651599999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.622049999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.621 38.0 38.0 38.0 38.0 38.0 30-34 37.60205 38.0 38.0 38.0 38.0 38.0 35-39 37.563 38.0 38.0 38.0 38.0 38.0 40-44 37.53785 38.0 38.0 38.0 38.0 38.0 45-49 37.5126 38.0 38.0 38.0 38.0 38.0 50-54 37.461800000000004 38.0 38.0 38.0 37.4 38.0 55-59 37.343599999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.34805 38.0 38.0 38.0 37.0 38.0 65-69 36.98485 38.0 38.0 38.0 37.0 38.0 70-74 36.94555 38.0 38.0 38.0 36.2 38.0 75-79 37.092600000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.08095 38.0 38.0 38.0 36.0 38.0 85-89 37.006600000000006 38.0 38.0 38.0 36.0 38.0 90-94 36.867900000000006 38.0 38.0 38.0 35.4 38.0 95-99 36.81385 38.0 38.0 38.0 35.0 38.0 100-104 36.5774 38.0 38.0 38.0 34.2 38.0 105-109 36.5854 38.0 38.0 38.0 34.6 38.0 110-114 36.23085 38.0 37.4 38.0 33.8 38.0 115-119 36.1754 38.0 37.4 38.0 33.6 38.0 120-124 35.8776 38.0 37.0 38.0 31.8 38.0 125-129 35.73115 38.0 36.6 38.0 31.8 38.0 130-134 35.39365 38.0 36.0 38.0 30.2 38.0 135-139 35.07375 38.0 35.4 38.0 28.6 38.0 140-144 34.66915 38.0 34.6 38.0 27.8 38.0 145-149 33.4015 38.0 33.8 38.0 21.0 38.0 150-151 28.867375000000003 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 5.0 19 0.0 20 0.0 21 1.0 22 5.0 23 3.0 24 5.0 25 10.0 26 12.0 27 15.0 28 25.0 29 27.0 30 37.0 31 36.0 32 77.0 33 87.0 34 165.0 35 315.0 36 807.0 37 2361.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.21442885771543 17.81062124248497 12.5250501002004 37.4498997995992 2 18.0 21.875 36.325 23.799999999999997 3 18.625 24.975 25.424999999999997 30.975 4 20.125 32.125 23.150000000000002 24.6 5 21.6 33.6 24.175 20.625 6 17.299999999999997 37.15 24.5 21.05 7 13.950000000000001 24.325 42.575 19.15 8 16.35 23.875 33.025 26.75 9 16.975 24.275 33.5 25.25 10-14 19.475 29.849999999999998 26.674999999999997 24.0 15-19 19.134999999999998 29.69 27.255000000000003 23.919999999999998 20-24 19.39969984992496 29.189594797398698 27.878939469734863 23.53176588294147 25-29 19.105 29.32 27.700000000000003 23.875 30-34 19.49 29.485 27.639999999999997 23.385 35-39 19.18 28.884999999999998 28.18 23.755000000000003 40-44 19.74 29.82 27.584999999999997 22.855 45-49 19.52 28.21 28.025 24.245 50-54 19.775000000000002 28.854999999999997 27.400000000000002 23.97 55-59 19.77 28.64 27.639999999999997 23.95 60-64 19.277530394756592 28.458498023715418 28.438485015259918 23.825486566268076 65-69 19.52364131806025 28.732906090730182 27.89524145935308 23.848211131856488 70-74 19.751095883508842 28.60885776187837 27.923615659797452 23.716430694815337 75-79 19.8 28.325 27.675 24.2 80-84 19.945 27.93 28.33 23.794999999999998 85-89 19.939999999999998 27.91 27.689999999999998 24.46 90-94 20.06 28.16 27.884999999999998 23.895 95-99 19.900000000000002 27.685 28.475 23.94 100-104 20.02300920368147 28.306322529011606 27.901160464185676 23.769507803121247 105-109 20.24 28.000000000000004 27.744999999999997 24.015 110-114 20.52847562806526 27.920128115303772 27.93013712341107 23.621259133219898 115-119 20.369999999999997 28.865000000000002 26.889999999999997 23.875 120-124 20.424999999999997 28.27 26.86 24.445 125-129 20.49 27.985 27.29 24.235 130-134 20.595 27.815 27.125 24.465 135-139 20.095 27.615000000000002 27.905 24.385 140-144 20.990000000000002 27.71 27.0 24.3 145-149 20.87 27.68 27.315 24.135 150-151 20.025000000000002 27.525 27.150000000000002 25.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.5 18 1.5 19 1.0 20 0.0 21 0.0 22 0.5 23 3.0 24 3.5 25 4.5 26 8.0 27 11.0 28 12.5 29 17.0 30 24.0 31 30.0 32 44.5 33 52.0 34 60.5 35 79.0 36 102.5 37 123.5 38 137.5 39 176.0 40 200.0 41 204.5 42 230.5 43 273.0 44 291.5 45 271.0 46 253.0 47 237.0 48 212.0 49 199.5 50 164.0 51 128.0 52 109.0 53 78.5 54 60.5 55 51.5 56 36.0 57 23.5 58 23.5 59 16.5 60 10.0 61 7.0 62 6.5 63 4.5 64 1.5 65 3.0 66 4.0 67 2.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.05 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.065 65-69 0.915 70-74 0.765 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.09 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.9125 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.5625 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.75 0.0 0.0 0.0 0.0 126-127 5.199999999999999 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 6.1375 0.0 0.0 0.0 0.0 132-133 6.725 0.0 0.0 0.0 0.0 134-135 7.1875 0.0 0.0 0.0 0.0 136-137 7.75 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180124 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180124_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.799 34.0 33.0 34.0 32.0 34.0 2 32.912 34.0 33.0 34.0 33.0 34.0 3 32.9125 34.0 33.0 34.0 33.0 34.0 4 32.87575 34.0 33.0 34.0 33.0 34.0 5 32.9225 34.0 33.0 34.0 33.0 34.0 6 37.06325 38.0 38.0 38.0 38.0 38.0 7 37.0245 38.0 38.0 38.0 38.0 38.0 8 37.00625 38.0 38.0 38.0 38.0 38.0 9 36.90875 38.0 38.0 38.0 38.0 38.0 10-14 36.847699999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.06205 38.0 38.0 38.0 37.2 38.0 20-24 37.1065 38.0 38.0 38.0 37.4 38.0 25-29 37.1485 38.0 38.0 38.0 37.8 38.0 30-34 37.152750000000005 38.0 38.0 38.0 37.6 38.0 35-39 37.071349999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.0323 38.0 38.0 38.0 37.0 38.0 45-49 37.030950000000004 38.0 38.0 38.0 37.0 38.0 50-54 36.976150000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.9246 38.0 38.0 38.0 36.6 38.0 60-64 36.81275 38.0 38.0 38.0 36.4 38.0 65-69 36.6823 38.0 38.0 38.0 35.8 38.0 70-74 36.737249999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.7188 38.0 38.0 38.0 36.0 38.0 80-84 36.58505 38.0 38.0 38.0 35.6 38.0 85-89 36.51615 38.0 38.0 38.0 35.2 38.0 90-94 36.44595 38.0 38.0 38.0 34.8 38.0 95-99 36.26005 38.0 38.0 38.0 34.2 38.0 100-104 36.18935 38.0 38.0 38.0 34.0 38.0 105-109 36.1092 38.0 38.0 38.0 34.0 38.0 110-114 35.813 38.0 37.8 38.0 33.0 38.0 115-119 35.7418 38.0 37.6 38.0 32.6 38.0 120-124 35.58 38.0 37.0 38.0 31.4 38.0 125-129 35.31155 38.0 36.2 38.0 30.6 38.0 130-134 35.024950000000004 38.0 35.8 38.0 29.8 38.0 135-139 34.3082 38.0 34.2 38.0 25.0 38.0 140-144 34.005500000000005 38.0 33.6 38.0 24.0 38.0 145-149 33.0106 38.0 33.0 38.0 15.0 38.0 150-151 27.9465 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 6.0 4 3.0 5 3.0 6 1.0 7 2.0 8 3.0 9 2.0 10 1.0 11 3.0 12 3.0 13 2.0 14 5.0 15 0.0 16 3.0 17 5.0 18 4.0 19 4.0 20 4.0 21 6.0 22 8.0 23 8.0 24 8.0 25 13.0 26 18.0 27 10.0 28 30.0 29 24.0 30 35.0 31 51.0 32 73.0 33 92.0 34 154.0 35 264.0 36 568.0 37 2567.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.28499369482976 16.14123581336696 18.209331651954603 27.364438839848678 2 24.93067809427779 22.435089488278294 35.34156793546761 17.292664481976306 3 22.379032258064516 26.73891129032258 30.317540322580644 20.56451612903226 4 25.510461305772626 34.358457272498114 21.855306276783466 18.2757751449458 5 24.300478951348627 35.543231661204935 23.342576254096294 16.813713133350138 6 20.246789221858474 36.11181062704608 23.696801813145303 19.94459833795014 7 18.74527588813303 19.223985890652557 40.06046863189721 21.97026958931721 8 21.3007310310058 22.964456768338795 28.686664986135618 27.04814721451979 9 21.93336698637052 26.047450782433113 28.697627460878344 23.32155477031802 10-14 24.741331449048605 27.81002372179882 25.528693282188463 21.919951546964114 15-19 23.613264642624916 27.694693142599906 27.914770169559343 20.777272045215824 20-24 23.455000000000002 27.675 27.985 20.885 25-29 23.635 28.185 27.689999999999998 20.49 30-34 24.08 28.749999999999996 26.36 20.810000000000002 35-39 23.925 28.015 27.66 20.4 40-44 24.490000000000002 28.515 26.665 20.330000000000002 45-49 24.02 27.98 27.400000000000002 20.599999999999998 50-54 24.224999999999998 28.105000000000004 27.325 20.345 55-59 24.355 27.88 27.67 20.095 60-64 24.005000000000003 28.07 27.474999999999998 20.45 65-69 24.51 28.360000000000003 26.995 20.135 70-74 24.675 27.965 27.634999999999998 19.725 75-79 23.81357203580537 27.69415412311847 27.704155623343503 20.78811821773266 80-84 24.315531307873268 27.323689874368085 27.939336303118274 20.421442514640372 85-89 24.024609843937576 28.38635454181673 27.300920368147256 20.28811524609844 90-94 24.04 28.225 27.29 20.445 95-99 24.5 28.17 27.325 20.005 100-104 24.485 27.735 27.49 20.29 105-109 24.32 27.83 27.655 20.195 110-114 24.255 28.134999999999998 27.474999999999998 20.135 115-119 23.990000000000002 28.83 27.935 19.245 120-124 24.635 28.000000000000004 27.455000000000002 19.91 125-129 24.94 28.125 27.105 19.830000000000002 130-134 25.005 28.125 27.42 19.45 135-139 24.455 28.384999999999998 27.555000000000003 19.605 140-144 24.88 27.534999999999997 27.62 19.965 145-149 25.53 27.915 27.005000000000003 19.55 150-151 25.45 28.5625 27.400000000000002 18.587500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 0.5 25 1.0 26 0.5 27 1.0 28 4.5 29 7.0 30 7.5 31 12.0 32 20.0 33 23.5 34 23.0 35 38.0 36 73.5 37 103.5 38 115.5 39 138.5 40 186.0 41 226.0 42 273.0 43 297.5 44 293.0 45 300.5 46 288.5 47 265.0 48 247.5 49 218.5 50 182.0 51 149.0 52 119.0 53 92.5 54 69.5 55 55.5 56 42.0 57 30.5 58 24.0 59 17.5 60 13.5 61 11.5 62 7.5 63 3.5 64 3.0 65 3.0 66 2.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.8250000000000001 3 0.8 4 0.8250000000000001 5 0.8250000000000001 6 0.7250000000000001 7 0.775 8 0.8250000000000001 9 0.95 10-14 0.935 15-19 0.034999999999999996 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.015 80-84 0.105 85-89 0.04 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64806435394671 99.1 2 0.22624434389140274 0.44999999999999996 3 0.10055304172951231 0.3 4 0.0 0.0 5 0.0 0.0 6 0.025138260432378077 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.3375 0.0 0.0 0.0 0.0 120-121 3.6500000000000004 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.8125 0.0 0.0 0.0 0.0 126-127 5.275 0.0 0.0 0.0 0.0 128-129 5.775 0.0 0.0 0.0 0.0 130-131 6.2875 0.0 0.0 0.0 0.0 132-133 6.8625 0.0 0.0 0.0 0.0 134-135 7.3375 0.0 0.0 0.0 0.0 136-137 7.9125 0.0 0.0 0.0 0.0 138-139 8.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614673 spots for SRR7180124.sra Written 614673 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra Read 614658 spots for SRR7180124.sra Written 614658 spots for SRR7180124.sra SRR ids: ['SRR7180124.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_85f554yg SRR7180124.sra spots: 12293175 blocks: [[1, 614658], [614659, 1229316], [1229317, 1843974], [1843975, 2458632], [2458633, 3073290], [3073291, 3687948], [3687949, 4302606], [4302607, 4917264], [4917265, 5531922], [5531923, 6146580], [6146581, 6761238], [6761239, 7375896], [7375897, 7990554], [7990555, 8605212], [8605213, 9219870], [9219871, 9834528], [9834529, 10449186], [10449187, 11063844], [11063845, 11678502], [11678503, 12293175]] SRR7180124 file size 4144053 SRR7180124 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180124 SRR7180124_1.fastq SRR7180124_2.fastq Input file: SRR7180124_1.fastq Paired file: SRR7180124_2.fastq trimmed: SRR7180124-trimmed-pair1.fastq, SRR7180124-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:21:07 2025 >> started Mon Feb 10 21:21:20 2025 >> done (12.612s) 12293175 read pairs processed; of these: 23300 ( 0.19%) short read pairs filtered out after trimming by size control 23701 ( 0.19%) empty read pairs filtered out after trimming by size control 12246174 (99.62%) read pairs available; of these: 6371357 (52.03%) trimmed read pairs available after processing 5874817 (47.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 2 0.00% 21 2 0.00% 22 6 0.00% 23 6 0.00% 24 9 0.00% 25 9 0.00% 26 6 0.00% 27 5 0.00% 28 4 0.00% 29 6 0.00% 30 5 0.00% 31 0 0.00% 32 3 0.00% 33 4 0.00% 34 4 0.00% 35 1 0.00% 36 3 0.00% 37 2 0.00% 38 8 0.00% 39 3 0.00% 40 8 0.00% 41 11 0.00% 42 4 0.00% 43 5 0.00% 44 9 0.00% 45 17 0.00% 46 10 0.00% 47 13 0.00% 48 12 0.00% 49 20 0.00% 50 19 0.00% 51 23 0.00% 52 26 0.00% 53 28 0.00% 54 39 0.00% 55 43 0.00% 56 45 0.00% 57 48 0.00% 58 64 0.00% 59 65 0.00% 60 88 0.00% 61 92 0.00% 62 99 0.00% 63 131 0.00% 64 139 0.00% 65 158 0.00% 66 190 0.00% 67 178 0.00% 68 199 0.00% 69 274 0.00% 70 329 0.00% 71 389 0.00% 72 435 0.00% 73 502 0.00% 74 552 0.00% 75 580 0.00% 76 725 0.01% 77 876 0.01% 78 990 0.01% 79 1063 0.01% 80 1245 0.01% 81 1368 0.01% 82 1732 0.01% 83 1939 0.02% 84 3251 0.03% 85 4113 0.03% 86 4433 0.04% 87 4572 0.04% 88 4788 0.04% 89 4937 0.04% 90 5303 0.04% 91 5457 0.04% 92 5820 0.05% 93 6326 0.05% 94 6801 0.06% 95 7309 0.06% 96 7918 0.06% 97 8657 0.07% 98 9147 0.07% 99 9766 0.08% 100 10613 0.09% 101 11254 0.09% 102 11943 0.10% 103 12605 0.10% 104 13558 0.11% 105 14692 0.12% 106 15479 0.13% 107 16415 0.13% 108 17312 0.14% 109 18148 0.15% 110 19199 0.16% 111 20443 0.17% 112 21489 0.18% 113 22040 0.18% 114 23287 0.19% 115 24755 0.20% 116 25550 0.21% 117 26600 0.22% 118 28211 0.23% 119 29223 0.24% 120 30035 0.25% 121 32012 0.26% 122 33126 0.27% 123 34008 0.28% 124 35789 0.29% 125 37299 0.30% 126 38792 0.32% 127 39938 0.33% 128 41779 0.34% 129 44018 0.36% 130 45607 0.37% 131 47049 0.38% 132 49835 0.41% 133 52360 0.43% 134 54350 0.44% 135 57035 0.47% 136 58676 0.48% 137 62460 0.51% 138 65288 0.53% 139 70019 0.57% 140 75112 0.61% 141 80635 0.66% 142 87733 0.72% 143 98155 0.80% 144 111456 0.91% 145 130221 1.06% 146 161952 1.32% 147 237127 1.94% 148 353444 2.89% 149 612032 5.00% 150 2997727 24.48% 151 5874817 47.97% 12246174 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=31 prefix-density=0.69 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=73.20 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.3 sequence=AAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=34 prefix-density=0.87 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=212.66 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=12.1 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT SRR7180124 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:22:02 Started mapping on | Feb 10 21:22:03 Finished on | Feb 10 21:23:33 Mapping speed, Million of reads per hour | 489.85 Number of input reads | 12246174 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11441841 Uniquely mapped reads % | 93.43% Average mapped length | 292.73 Number of splices: Total | 10755713 Number of splices: Annotated (sjdb) | 10534248 Number of splices: GT/AG | 10578695 Number of splices: GC/AG | 136396 Number of splices: AT/AC | 8575 Number of splices: Non-canonical | 32047 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 315015 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 28362 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.68% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 508252 508252 508252 N_multimapping 315015 315015 315015 N_noFeature 289022 11316523 337776 N_ambiguous 135802 711 58942 UnstrandedReadsAssigned:11017017 PositiveStrandReadsAssigned:124607 NegativeStrandReadsAssigned:11045123 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7180124 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180124-trimmed-pair1.fastq SRR7180124-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,246,174 reads, 10,983,078 reads pseudoaligned [quant] estimated average fragment length: 219.819 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52401 SRR7180124.ke.tsv 34699 SRR7180124.se.tsv 87100 total ==> SRR7180124.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.18 1056 44.7051 Potri.005G024800.1.v4.1 1035 816.181 313 29.2096 Potri.004G059700.1.v4.1 961 742.195 10 1.02624 Potri.007G009000.2.v4.1 1416 1197.18 0 0 Potri.003G141000.2.v4.1 2943 2724.18 515.249 14.4062 Potri.016G087400.1.v4.1 270 84.4836 1415 1275.71 Potri.015G069301.1.v4.1 564 346.724 0 0 Potri.010G195200.1.v4.1 1773 1554.18 495.923 24.3042 Potri.012G127500.1.v4.1 977 758.191 3829 384.658 ==> SRR7180124.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 36 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 462 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 256 SRR7180124 completed mapping pipeline successfully