Starting /dee2/code/volunteer_pipeline.sh SRR7180125 current disk space = 3056995643392 free memory = 1509403020 SRR7180125 SRAfilesize ed7b9246ee63ce691a5b35853e630483 SRR7180125.sra SRR7180125.sra file validated SRR7180125 is paired end SRR7180125 is conventional basespace SRR7180125 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180125_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.72375 32.0 18.0 33.0 18.0 33.0 2 29.548 32.0 27.0 33.0 18.0 34.0 3 29.941 31.0 29.0 33.0 25.0 33.0 4 31.6475 33.0 32.0 33.0 30.0 33.0 5 31.8545 33.0 32.0 33.0 31.0 33.0 6 36.767 38.0 37.0 38.0 35.0 38.0 7 37.36025 38.0 38.0 38.0 37.0 38.0 8 37.58675 38.0 38.0 38.0 38.0 38.0 9 37.6635 38.0 38.0 38.0 38.0 38.0 10-14 37.6205 38.0 38.0 38.0 38.0 38.0 15-19 37.648250000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5791 38.0 38.0 38.0 38.0 38.0 25-29 37.64035 38.0 38.0 38.0 38.0 38.0 30-34 37.58785 38.0 38.0 38.0 38.0 38.0 35-39 37.5827 38.0 38.0 38.0 38.0 38.0 40-44 37.543549999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.554550000000006 38.0 38.0 38.0 38.0 38.0 50-54 37.45925 38.0 38.0 38.0 37.4 38.0 55-59 37.39085 38.0 38.0 38.0 37.0 38.0 60-64 37.3994 38.0 38.0 38.0 37.0 38.0 65-69 37.018950000000004 38.0 38.0 38.0 36.6 38.0 70-74 36.95445 38.0 38.0 38.0 36.0 38.0 75-79 37.13605 38.0 38.0 38.0 36.2 38.0 80-84 37.1853 38.0 38.0 38.0 36.2 38.0 85-89 37.1127 38.0 38.0 38.0 36.0 38.0 90-94 36.871700000000004 38.0 38.0 38.0 35.4 38.0 95-99 36.778200000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.575849999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.556200000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.197649999999996 38.0 37.4 38.0 33.6 38.0 115-119 36.15765 38.0 37.0 38.0 33.2 38.0 120-124 35.908550000000005 38.0 36.8 38.0 32.4 38.0 125-129 35.66745 38.0 36.0 38.0 30.6 38.0 130-134 35.34644999999999 38.0 36.0 38.0 29.8 38.0 135-139 35.0112 38.0 35.0 38.0 28.0 38.0 140-144 34.67725 38.0 34.8 38.0 27.0 38.0 145-149 33.222750000000005 38.0 34.0 38.0 18.4 38.0 150-151 28.236625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 0.0 19 0.0 20 0.0 21 4.0 22 6.0 23 4.0 24 10.0 25 5.0 26 7.0 27 21.0 28 27.0 29 25.0 30 34.0 31 44.0 32 69.0 33 102.0 34 159.0 35 328.0 36 890.0 37 2261.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.262828535669588 16.39549436795995 11.889862327909889 41.45181476846058 2 18.425 20.775 37.25 23.549999999999997 3 18.925 23.775 25.8 31.5 4 21.475 31.55 22.725 24.25 5 21.525 33.5 24.224999999999998 20.75 6 18.2 33.775 26.75 21.275 7 14.7 23.674999999999997 42.375 19.25 8 18.15 22.900000000000002 29.799999999999997 29.15 9 17.875 23.525 32.75 25.85 10-14 19.615 28.585 26.985 24.815 15-19 19.925 27.93 28.08 24.065 20-24 20.350087521880468 28.042010502625658 28.31707926981745 23.29082270567642 25-29 19.885 28.810000000000002 27.455000000000002 23.849999999999998 30-34 19.585 27.46 27.97 24.985 35-39 19.81 28.720000000000002 27.810000000000002 23.66 40-44 19.985 28.199999999999996 27.994999999999997 23.82 45-49 19.74 27.665 28.199999999999996 24.395 50-54 20.125 28.255000000000003 27.655 23.965 55-59 20.31 27.71 27.775 24.205 60-64 19.31289693454018 27.62414362154323 28.239235885382808 24.823723558533782 65-69 20.476094411942707 27.23925761549324 28.202541859995968 24.082106112568084 70-74 19.944640161046802 28.3241066935078 27.775541016607953 23.955712128837444 75-79 19.86 27.985 27.85 24.305 80-84 20.165 27.825 27.725 24.285 85-89 20.169999999999998 28.095 27.644999999999996 24.09 90-94 20.32 26.700000000000003 28.310000000000002 24.67 95-99 20.43 27.54 27.750000000000004 24.279999999999998 100-104 20.67827130852341 27.2108843537415 27.956182472989195 24.1546618647459 105-109 20.3 27.32 27.66 24.72 110-114 21.322057646116892 26.9515612489992 27.476981585268213 24.249399519615693 115-119 20.635 28.299999999999997 27.12 23.945 120-124 20.705000000000002 28.050000000000004 27.794999999999998 23.45 125-129 21.086054302715134 27.85639281964098 27.251362568128407 23.806190309515475 130-134 20.785 28.09 27.125 24.0 135-139 21.43 27.485 27.555000000000003 23.53 140-144 21.175 27.705000000000002 27.18 23.94 145-149 21.884999999999998 27.165 27.435 23.515 150-151 20.9 27.500000000000004 26.9125 24.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 3.5 27 7.5 28 10.0 29 13.0 30 21.0 31 29.5 32 32.0 33 37.0 34 54.0 35 72.0 36 85.0 37 101.0 38 117.5 39 144.0 40 178.0 41 212.0 42 254.0 43 276.0 44 280.0 45 276.5 46 251.5 47 246.5 48 258.5 49 221.5 50 164.5 51 129.0 52 104.0 53 80.5 54 63.0 55 56.0 56 43.0 57 36.0 58 30.0 59 21.0 60 19.0 61 14.0 62 11.5 63 11.5 64 8.0 65 5.0 66 4.5 67 3.0 68 3.0 69 3.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.025 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.015 65-69 0.86 70-74 0.65 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.08 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.2249999999999996 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.5374999999999996 0.0 0.0 0.0 0.0 128-129 4.0 0.0 0.0 0.0 0.0 130-131 4.4625 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 6.199999999999999 0.0 0.0 0.0 0.0 138-139 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAAT 10 0.0068573058 144.8125 7 >>END_MODULE SRR7180125 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180125_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7375 34.0 33.0 34.0 32.0 34.0 2 32.9065 34.0 33.0 34.0 32.0 34.0 3 32.9215 34.0 33.0 34.0 32.0 34.0 4 32.84875 34.0 33.0 34.0 32.0 34.0 5 32.9045 34.0 33.0 34.0 33.0 34.0 6 36.9865 38.0 38.0 38.0 37.0 38.0 7 37.03975 38.0 38.0 38.0 37.0 38.0 8 37.0485 38.0 38.0 38.0 38.0 38.0 9 36.9575 38.0 38.0 38.0 37.0 38.0 10-14 36.9251 38.0 38.0 38.0 37.0 38.0 15-19 37.101099999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.07685 38.0 38.0 38.0 36.8 38.0 25-29 37.10985 38.0 38.0 38.0 37.0 38.0 30-34 37.11245 38.0 38.0 38.0 37.0 38.0 35-39 37.0367 38.0 38.0 38.0 37.0 38.0 40-44 36.962250000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.03485 38.0 38.0 38.0 37.0 38.0 50-54 36.9654 38.0 38.0 38.0 36.8 38.0 55-59 36.95435 38.0 38.0 38.0 36.6 38.0 60-64 36.798 38.0 38.0 38.0 36.0 38.0 65-69 36.690349999999995 38.0 38.0 38.0 35.6 38.0 70-74 36.7476 38.0 38.0 38.0 36.0 38.0 75-79 36.7416 38.0 38.0 38.0 36.0 38.0 80-84 36.5484 38.0 38.0 38.0 35.0 38.0 85-89 36.48175 38.0 38.0 38.0 34.6 38.0 90-94 36.37915 38.0 38.0 38.0 34.2 38.0 95-99 36.154650000000004 38.0 38.0 38.0 33.8 38.0 100-104 36.07645 38.0 38.0 38.0 33.6 38.0 105-109 36.0497 38.0 38.0 38.0 33.6 38.0 110-114 35.648649999999996 38.0 37.2 38.0 31.8 38.0 115-119 35.52125 38.0 37.0 38.0 31.0 38.0 120-124 35.3104 38.0 36.6 38.0 30.4 38.0 125-129 35.05065 38.0 36.0 38.0 28.8 38.0 130-134 34.83555 38.0 35.6 38.0 27.6 38.0 135-139 34.11165 38.0 33.6 38.0 23.4 38.0 140-144 33.730999999999995 38.0 33.4 38.0 22.4 38.0 145-149 32.81205 38.0 33.0 38.0 15.0 38.0 150-151 27.370624999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 5.0 5 3.0 6 3.0 7 1.0 8 0.0 9 2.0 10 1.0 11 1.0 12 3.0 13 2.0 14 3.0 15 2.0 16 1.0 17 2.0 18 8.0 19 7.0 20 5.0 21 7.0 22 10.0 23 13.0 24 10.0 25 14.0 26 22.0 27 24.0 28 27.0 29 37.0 30 28.0 31 64.0 32 58.0 33 107.0 34 187.0 35 264.0 36 629.0 37 2436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.72869389813414 15.88502269288956 17.221381744831064 31.164901664145233 2 23.086606243705944 22.885196374622357 36.37965760322256 17.648539778449145 3 22.552227535867104 26.050843191542917 30.279385854517997 21.117543418071985 4 24.420946626384694 32.90533736153072 22.658610271903324 20.01510574018127 5 24.60337446487031 35.00377738604886 22.46285570385293 17.929992445227903 6 18.22300528567833 36.77321922980116 24.540649383337527 20.463126101182986 7 19.6073496098666 17.795117040020138 41.42965013843443 21.16788321167883 8 20.99169393405487 22.19984898061918 27.485527309338032 29.322929775987916 9 23.189502901842037 23.64370426444613 28.387585162755492 24.779207670956346 10-14 23.877437887416217 27.924205009323188 25.716877488283025 22.481479614977573 15-19 23.33350002500375 28.739310896634496 27.309096364454668 20.618092713907085 20-24 23.935000000000002 28.03 27.11 20.925 25-29 23.335 28.299999999999997 27.57 20.794999999999998 30-34 23.835 28.444999999999997 26.900000000000002 20.82 35-39 24.16 27.939999999999998 26.700000000000003 21.2 40-44 23.84 28.299999999999997 26.955000000000002 20.905 45-49 23.51 27.35 28.139999999999997 21.0 50-54 24.19 27.655 27.355 20.8 55-59 23.549999999999997 27.834999999999997 27.61 21.005 60-64 24.07 27.955000000000002 27.27 20.705000000000002 65-69 24.310000000000002 27.85 26.77 21.07 70-74 24.34 27.860000000000003 27.125 20.674999999999997 75-79 24.42 27.54 27.505000000000003 20.535 80-84 24.12603150787697 28.08202050512628 27.22680670167542 20.56514128532133 85-89 23.801190059502975 28.626431321566077 27.28636431821591 20.286014300715035 90-94 24.005000000000003 28.084999999999997 27.215 20.695 95-99 23.605 28.475 27.445000000000004 20.474999999999998 100-104 24.255 27.91 27.779999999999998 20.055 105-109 24.19 27.775 27.384999999999998 20.65 110-114 24.55 28.105000000000004 26.87 20.474999999999998 115-119 24.529999999999998 27.825 27.384999999999998 20.26 120-124 24.685000000000002 28.34 27.185 19.79 125-129 24.965 28.794999999999998 26.1 20.14 130-134 24.875 28.025 26.685 20.415 135-139 24.685000000000002 28.16 26.905 20.25 140-144 25.355 27.54 27.089999999999996 20.015 145-149 25.635 27.71 27.205000000000002 19.45 150-151 26.8375 27.287499999999998 27.1125 18.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 2.5 23 2.0 24 1.0 25 1.5 26 3.0 27 3.5 28 5.0 29 8.0 30 9.0 31 13.0 32 17.0 33 24.5 34 40.0 35 47.0 36 66.5 37 98.0 38 123.5 39 154.0 40 177.5 41 202.0 42 237.0 43 265.0 44 293.5 45 292.0 46 286.0 47 293.5 48 247.5 49 191.5 50 171.5 51 144.0 52 117.5 53 102.0 54 79.5 55 61.5 56 49.5 57 37.0 58 23.5 59 22.5 60 21.0 61 11.5 62 9.5 63 10.5 64 7.5 65 4.5 66 4.0 67 5.0 68 3.5 69 1.5 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.7000000000000001 3 0.675 4 0.7000000000000001 5 0.7250000000000001 6 0.675 7 0.675 8 0.675 9 0.9249999999999999 10-14 0.7849999999999999 15-19 0.015 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.025 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 1.8875000000000002 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.6625 0.0 0.0 0.0 0.0 124-125 2.975 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.425 0.0 0.0 0.0 0.0 132-133 4.862500000000001 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 6.1625 0.0 0.0 0.0 0.0 138-139 6.675000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGCAG 10 0.006830828 145.0 1 TATCACT 10 0.006830828 145.0 9 >>END_MODULE Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra Read 676755 spots for SRR7180125.sra Written 676755 spots for SRR7180125.sra SRR ids: ['SRR7180125.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pakqgn1v SRR7180125.sra spots: 13535100 blocks: [[1, 676755], [676756, 1353510], [1353511, 2030265], [2030266, 2707020], [2707021, 3383775], [3383776, 4060530], [4060531, 4737285], [4737286, 5414040], [5414041, 6090795], [6090796, 6767550], [6767551, 7444305], [7444306, 8121060], [8121061, 8797815], [8797816, 9474570], [9474571, 10151325], [10151326, 10828080], [10828081, 11504835], [11504836, 12181590], [12181591, 12858345], [12858346, 13535100]] SRR7180125 file size 4564900 SRR7180125 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180125 SRR7180125_1.fastq SRR7180125_2.fastq Input file: SRR7180125_1.fastq Paired file: SRR7180125_2.fastq trimmed: SRR7180125-trimmed-pair1.fastq, SRR7180125-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:36:24 2025 >> started Mon Feb 10 21:36:38 2025 >> done (14.698s) 13535100 read pairs processed; of these: 17130 ( 0.13%) short read pairs filtered out after trimming by size control 15420 ( 0.11%) empty read pairs filtered out after trimming by size control 13502550 (99.76%) read pairs available; of these: 7107252 (52.64%) trimmed read pairs available after processing 6395298 (47.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 4 0.00% 21 3 0.00% 22 1 0.00% 23 4 0.00% 24 2 0.00% 25 3 0.00% 26 4 0.00% 27 6 0.00% 28 3 0.00% 29 4 0.00% 30 5 0.00% 31 2 0.00% 32 2 0.00% 33 1 0.00% 34 3 0.00% 35 1 0.00% 36 3 0.00% 37 5 0.00% 38 2 0.00% 39 12 0.00% 40 6 0.00% 41 5 0.00% 42 8 0.00% 43 6 0.00% 44 10 0.00% 45 6 0.00% 46 18 0.00% 47 13 0.00% 48 8 0.00% 49 22 0.00% 50 19 0.00% 51 24 0.00% 52 28 0.00% 53 27 0.00% 54 28 0.00% 55 40 0.00% 56 44 0.00% 57 54 0.00% 58 54 0.00% 59 57 0.00% 60 78 0.00% 61 82 0.00% 62 94 0.00% 63 123 0.00% 64 130 0.00% 65 137 0.00% 66 169 0.00% 67 163 0.00% 68 196 0.00% 69 242 0.00% 70 267 0.00% 71 334 0.00% 72 350 0.00% 73 430 0.00% 74 521 0.00% 75 561 0.00% 76 680 0.01% 77 753 0.01% 78 796 0.01% 79 976 0.01% 80 1130 0.01% 81 1316 0.01% 82 1492 0.01% 83 1817 0.01% 84 2651 0.02% 85 3454 0.03% 86 3648 0.03% 87 3989 0.03% 88 4210 0.03% 89 4350 0.03% 90 4499 0.03% 91 4954 0.04% 92 5169 0.04% 93 5636 0.04% 94 6051 0.04% 95 6676 0.05% 96 7087 0.05% 97 7774 0.06% 98 8198 0.06% 99 9125 0.07% 100 9662 0.07% 101 10438 0.08% 102 10950 0.08% 103 11610 0.09% 104 12205 0.09% 105 13462 0.10% 106 14548 0.11% 107 15473 0.11% 108 16156 0.12% 109 17250 0.13% 110 18325 0.14% 111 19016 0.14% 112 20103 0.15% 113 21231 0.16% 114 22702 0.17% 115 23473 0.17% 116 24739 0.18% 117 25830 0.19% 118 27180 0.20% 119 28556 0.21% 120 29750 0.22% 121 31217 0.23% 122 32950 0.24% 123 34177 0.25% 124 35554 0.26% 125 37224 0.28% 126 38902 0.29% 127 40856 0.30% 128 42716 0.32% 129 44394 0.33% 130 47189 0.35% 131 49091 0.36% 132 51517 0.38% 133 54464 0.40% 134 57113 0.42% 135 60035 0.44% 136 63046 0.47% 137 66390 0.49% 138 71204 0.53% 139 76504 0.57% 140 83141 0.62% 141 89413 0.66% 142 98860 0.73% 143 110452 0.82% 144 127870 0.95% 145 150290 1.11% 146 188342 1.39% 147 280621 2.08% 148 419188 3.10% 149 728458 5.39% 150 3402558 25.20% 151 6395298 47.36% 13502550 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=19 prefix-density=0.39 prefix-fanout=2.3 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=21.86 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.1 sequence=CTTCACAGCAAAGAGCACTTGCTGGATTACAAAATACATCAATAACTAAAGACAGAAGCAAGCTAACAAGAAACAATTACTTGGGAGGTTCCTGGATGCCCTACCAGTGCACAAACCAATAACTTATTTCTTCAATATATTTAAGAAAGCTGAACGGTAGAGTCATAAGCAATCCCAGCCTTCCAATCACTCGGTATAACATTTGCTGCTTGGGCCCAATATGTGACGCCTGCACTGCCACTTACTTGGAACCTCAAGCTGATGGCACCCTTAGGTGGGTTAGGCATATCCCACACTGCCCCATAGGCTCTTCTCATGCCTCTCCATTCCTTGCAATCCTCCTGCCATAACTCCACAGCTAAAATTTCATTTTGGCCAGCTTGGTACAAGAGAATTATAGCCAAGTAATCAGGAAACCTGCTATGCTCATGGACCTTGAACATGAGATTATAACCGGAGTAACGGCAAGGGATCCTCCGGAATTCTACATCGACAACACCGTACGCAATCA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=22 prefix-density=0.34 prefix-fanout=2.7 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=56.55 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=12.3 sequence=GCAGCAGCAGCAA SRR7180125 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:37:28 Started mapping on | Feb 10 21:37:28 Finished on | Feb 10 21:40:16 Mapping speed, Million of reads per hour | 289.34 Number of input reads | 13502550 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12106502 Uniquely mapped reads % | 89.66% Average mapped length | 293.67 Number of splices: Total | 11539174 Number of splices: Annotated (sjdb) | 11275474 Number of splices: GT/AG | 11350781 Number of splices: GC/AG | 145322 Number of splices: AT/AC | 9207 Number of splices: Non-canonical | 33864 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306667 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 45389 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.61% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1102665 1102665 1102665 N_multimapping 306667 306667 306667 N_noFeature 331331 11978497 389580 N_ambiguous 129634 596 59569 UnstrandedReadsAssigned:11645537 PositiveStrandReadsAssigned:127409 NegativeStrandReadsAssigned:11657353 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7180125 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180125-trimmed-pair1.fastq SRR7180125-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,502,550 reads, 11,615,467 reads pseudoaligned [quant] estimated average fragment length: 227.68 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7180125.ke.tsv 34699 SRR7180125.se.tsv 87100 total ==> SRR7180125.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.32 1325 60.9803 Potri.005G024800.1.v4.1 1035 808.32 2606 265.79 Potri.004G059700.1.v4.1 961 734.326 0 0 Potri.007G009000.2.v4.1 1416 1189.32 0 0 Potri.003G141000.2.v4.1 2943 2716.32 623 18.9084 Potri.016G087400.1.v4.1 270 82.0514 1599.69 1607.3 Potri.015G069301.1.v4.1 564 339.532 0 0 Potri.010G195200.1.v4.1 1773 1546.32 779.955 41.5832 Potri.012G127500.1.v4.1 977 750.32 1340 147.233 ==> SRR7180125.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 388 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 228 SRR7180125 completed mapping pipeline successfully