Starting /dee2/code/volunteer_pipeline.sh SRR7180126 current disk space = 3056982937600 free memory = 1518030776 SRR7180126 SRAfilesize 4f20d8f472ce76f81106c42986691327 SRR7180126.sra SRR7180126.sra file validated SRR7180126 is paired end SRR7180126 is conventional basespace SRR7180126 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180126_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.9845 33.0 25.0 33.0 18.0 34.0 2 31.21225 33.0 29.0 33.0 27.0 34.0 3 31.3655 33.0 31.0 33.0 27.0 34.0 4 32.59125 33.0 33.0 33.0 32.0 34.0 5 33.05725 33.0 33.0 34.0 32.0 34.0 6 36.20325 38.0 36.0 38.0 33.0 38.0 7 37.226 38.0 38.0 38.0 36.0 38.0 8 37.38575 38.0 38.0 38.0 36.0 38.0 9 37.61925 38.0 38.0 38.0 37.0 38.0 10-14 37.682249999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.68485 38.0 38.0 38.0 38.0 38.0 20-24 37.6614 38.0 38.0 38.0 38.0 38.0 25-29 37.65555 38.0 38.0 38.0 38.0 38.0 30-34 37.6138 38.0 38.0 38.0 38.0 38.0 35-39 37.55395 38.0 38.0 38.0 38.0 38.0 40-44 37.533249999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.5309 38.0 38.0 38.0 38.0 38.0 50-54 37.48975 38.0 38.0 38.0 38.0 38.0 55-59 37.41485 38.0 38.0 38.0 37.2 38.0 60-64 37.37865000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.33535 38.0 38.0 38.0 37.0 38.0 70-74 37.299699999999994 38.0 38.0 38.0 37.0 38.0 75-79 37.26649999999999 38.0 38.0 38.0 37.0 38.0 80-84 37.1687 38.0 38.0 38.0 37.0 38.0 85-89 37.14149999999999 38.0 38.0 38.0 36.6 38.0 90-94 37.025800000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.9685 38.0 38.0 38.0 36.0 38.0 100-104 36.8789 38.0 38.0 38.0 36.0 38.0 105-109 36.789750000000005 38.0 38.0 38.0 35.2 38.0 110-114 36.70980000000001 38.0 38.0 38.0 35.0 38.0 115-119 36.591049999999996 38.0 38.0 38.0 35.0 38.0 120-124 36.491499999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.4094 38.0 38.0 38.0 34.0 38.0 130-134 36.15555 38.0 38.0 38.0 34.0 38.0 135-139 35.980450000000005 38.0 37.8 38.0 33.2 38.0 140-144 35.715799999999994 38.0 36.8 38.0 33.0 38.0 145-149 35.39045 38.0 36.2 38.0 31.8 38.0 150-151 32.682125 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 2.0 11 3.0 12 1.0 13 0.0 14 0.0 15 2.0 16 2.0 17 1.0 18 0.0 19 4.0 20 4.0 21 1.0 22 5.0 23 3.0 24 2.0 25 10.0 26 12.0 27 13.0 28 19.0 29 22.0 30 17.0 31 27.0 32 46.0 33 51.0 34 87.0 35 176.0 36 471.0 37 3016.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.514429441355574 13.635160180037067 11.517077045274027 33.33333333333333 2 22.6 16.625 35.6 25.174999999999997 3 20.200000000000003 22.025 27.875 29.9 4 23.400000000000002 29.375 23.150000000000002 24.075 5 21.425 32.875 25.025 20.674999999999997 6 16.333166583291643 35.867933966983486 26.8384192096048 20.96048024012006 7 13.950000000000001 25.4 42.1 18.55 8 16.900000000000002 24.675 31.525 26.900000000000002 9 17.775 24.425 33.074999999999996 24.725 10-14 19.715 28.88 27.500000000000004 23.905 15-19 19.925 28.405 28.025 23.645 20-24 19.830000000000002 28.084999999999997 28.23 23.855 25-29 19.115 29.09 28.410000000000004 23.385 30-34 19.665 28.444999999999997 28.110000000000003 23.78 35-39 20.200000000000003 28.37 27.79 23.64 40-44 19.75 28.785 27.98 23.485 45-49 19.955000000000002 28.23 28.01 23.805 50-54 20.02 28.65 27.415 23.915 55-59 19.435 28.560000000000002 27.775 24.23 60-64 19.965 27.785 27.794999999999998 24.455 65-69 19.59 28.155 27.474999999999998 24.779999999999998 70-74 20.385 28.035 28.33 23.25 75-79 20.080000000000002 27.279999999999998 28.060000000000002 24.58 80-84 19.84 27.775 28.215 24.169999999999998 85-89 19.405 28.395 28.02 24.18 90-94 19.794999999999998 27.98 27.915 24.310000000000002 95-99 20.115 28.325 27.62 23.94 100-104 20.28 28.075 27.985 23.66 105-109 20.22 27.944999999999997 28.04 23.794999999999998 110-114 21.035 27.97 27.584999999999997 23.41 115-119 20.995 27.944999999999997 27.560000000000002 23.5 120-124 20.935000000000002 27.584999999999997 27.365000000000002 24.115000000000002 125-129 20.34 27.805000000000003 27.435 24.42 130-134 20.685000000000002 27.445000000000004 27.46 24.41 135-139 20.66 28.28 26.784999999999997 24.275 140-144 21.18 28.07 27.134999999999998 23.615 145-149 20.78 27.779999999999998 27.284999999999997 24.154999999999998 150-151 19.899874843554443 28.3729662077597 26.433041301627036 25.294117647058822 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 3.0 2 1.0 3 1.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 1.0 24 3.0 25 2.5 26 4.0 27 10.0 28 10.0 29 11.5 30 18.0 31 26.5 32 38.0 33 43.5 34 43.0 35 63.5 36 100.5 37 115.0 38 122.0 39 157.5 40 188.0 41 218.0 42 244.0 43 255.0 44 280.0 45 278.0 46 273.0 47 251.0 48 203.5 49 191.5 50 179.5 51 147.0 52 112.0 53 93.0 54 78.0 55 56.0 56 44.5 57 35.5 58 23.5 59 16.0 60 11.5 61 9.5 62 7.5 63 4.0 64 4.0 65 3.5 66 1.5 67 1.5 68 2.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4526024641689716 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025144581342720643 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.0875 0.0 0.0 0.0 0.0 118-119 3.4625000000000004 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.5625 0.0 0.0 0.0 0.0 126-127 4.975 0.0 0.0 0.0 0.0 128-129 5.5375 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.75 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 8.15 0.0 0.0 0.0 0.0 138-139 8.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180126 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180126_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93425 33.0 33.0 34.0 32.0 34.0 2 33.054 34.0 33.0 34.0 33.0 34.0 3 33.065 34.0 33.0 34.0 33.0 34.0 4 33.03525 34.0 33.0 34.0 33.0 34.0 5 32.96425 34.0 33.0 34.0 33.0 34.0 6 37.17275 38.0 38.0 38.0 38.0 38.0 7 37.199 38.0 38.0 38.0 37.0 38.0 8 37.161 38.0 38.0 38.0 37.0 38.0 9 37.02125 38.0 38.0 38.0 37.0 38.0 10-14 37.07805 38.0 38.0 38.0 37.0 38.0 15-19 37.0375 38.0 38.0 38.0 37.0 38.0 20-24 36.98705 38.0 38.0 38.0 37.0 38.0 25-29 37.008399999999995 38.0 38.0 38.0 37.2 38.0 30-34 36.96940000000001 38.0 38.0 38.0 37.0 38.0 35-39 36.866099999999996 38.0 38.0 38.0 37.0 38.0 40-44 36.85155 38.0 38.0 38.0 37.0 38.0 45-49 36.911699999999996 38.0 38.0 38.0 37.0 38.0 50-54 36.8756 38.0 38.0 38.0 37.0 38.0 55-59 36.87475 38.0 38.0 38.0 36.8 38.0 60-64 36.80985 38.0 38.0 38.0 36.6 38.0 65-69 36.6877 38.0 38.0 38.0 36.0 38.0 70-74 36.7149 38.0 38.0 38.0 36.2 38.0 75-79 36.6513 38.0 38.0 38.0 36.0 38.0 80-84 36.6173 38.0 38.0 38.0 36.0 38.0 85-89 36.4711 38.0 38.0 38.0 35.8 38.0 90-94 36.38225 38.0 38.0 38.0 35.0 38.0 95-99 36.3282 38.0 38.0 38.0 35.0 38.0 100-104 36.1973 38.0 38.0 38.0 34.2 38.0 105-109 36.078050000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.04314999999999 38.0 38.0 38.0 34.0 38.0 115-119 35.849149999999995 38.0 38.0 38.0 34.0 38.0 120-124 35.63105 38.0 37.6 38.0 32.8 38.0 125-129 35.345800000000004 38.0 37.0 38.0 31.4 38.0 130-134 35.14765 38.0 36.2 38.0 30.6 38.0 135-139 34.85185 38.0 36.0 38.0 29.0 38.0 140-144 34.41705 38.0 35.8 38.0 26.6 38.0 145-149 33.89475 38.0 35.2 38.0 22.6 38.0 150-151 30.158 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 11.0 4 5.0 5 2.0 6 5.0 7 6.0 8 1.0 9 1.0 10 4.0 11 2.0 12 2.0 13 4.0 14 6.0 15 2.0 16 3.0 17 5.0 18 5.0 19 3.0 20 8.0 21 4.0 22 8.0 23 6.0 24 3.0 25 16.0 26 6.0 27 16.0 28 23.0 29 22.0 30 26.0 31 51.0 32 47.0 33 70.0 34 105.0 35 175.0 36 471.0 37 2856.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.365461847389554 17.143574297188753 17.620481927710845 23.870481927710845 2 24.04904904904905 24.4994994994995 32.05705705705706 19.394394394394393 3 21.916437327995997 26.144608456342254 31.623717788341253 20.31523642732049 4 23.875 34.025 22.95 19.15 5 25.05 35.55 22.125 17.275 6 19.8 37.45 24.55 18.2 7 20.525 18.725 38.975 21.775 8 21.55 22.575 29.225 26.650000000000002 9 21.95 26.525 27.750000000000004 23.775 10-14 23.724999999999998 28.720000000000002 26.155 21.4 15-19 23.46 28.744999999999997 27.02 20.775 20-24 23.845 29.025000000000002 26.669999999999998 20.46 25-29 23.93 28.884999999999998 27.229999999999997 19.955000000000002 30-34 23.75356303445517 27.81417212581887 27.104065609841477 21.328199229884483 35-39 24.021423565922515 28.14095505055561 27.330063069376315 20.50755831414556 40-44 24.180225281602002 28.47058823529412 26.933667083854818 20.41551939924906 45-49 24.169999999999998 28.13 27.48 20.22 50-54 23.9 28.285 27.33 20.485 55-59 23.905 28.384999999999998 27.265 20.445 60-64 23.72 27.98 28.04 20.26 65-69 24.435000000000002 27.99 27.605 19.97 70-74 24.12 27.935 27.865000000000002 20.080000000000002 75-79 23.61 28.03 27.794999999999998 20.565 80-84 24.060000000000002 28.12 27.41 20.41 85-89 24.025 27.97 27.55 20.455000000000002 90-94 24.495 28.26 27.54 19.705000000000002 95-99 24.255 27.85 27.450000000000003 20.445 100-104 24.455 28.49 27.27 19.785 105-109 23.74 28.144999999999996 27.865000000000002 20.25 110-114 24.44 27.639999999999997 27.505000000000003 20.415 115-119 24.725 28.345 27.145000000000003 19.785 120-124 25.174999999999997 28.565 26.465 19.794999999999998 125-129 25.14 28.225 27.334999999999997 19.3 130-134 25.259999999999998 28.18 27.02 19.54 135-139 25.47 28.175 27.439999999999998 18.915000000000003 140-144 25.569999999999997 27.92 27.169999999999998 19.34 145-149 25.61 27.195000000000004 27.250000000000004 19.945 150-151 26.203610832497493 27.35707121364092 27.50752256770311 18.931795386158477 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 2.5 26 4.5 27 5.0 28 6.5 29 7.5 30 11.0 31 14.0 32 21.0 33 34.0 34 41.5 35 46.5 36 65.0 37 85.5 38 113.5 39 146.5 40 181.5 41 227.0 42 258.5 43 271.0 44 297.0 45 306.5 46 294.5 47 279.0 48 245.5 49 216.0 50 185.0 51 151.5 52 109.0 53 86.0 54 68.5 55 45.0 56 42.0 57 35.5 58 23.5 59 17.5 60 14.5 61 8.0 62 4.0 63 3.0 64 3.5 65 4.0 66 2.0 67 0.5 68 0.0 69 0.5 70 0.5 71 1.0 72 1.5 73 1.0 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.1 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.11 40-44 0.125 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.4 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 3.1625 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 3.9125 0.0 0.0 0.0 0.0 122-123 4.3875 0.0 0.0 0.0 0.0 124-125 4.7875 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.8125 0.0 0.0 0.0 0.0 130-131 6.362500000000001 0.0 0.0 0.0 0.0 132-133 7.074999999999999 0.0 0.0 0.0 0.0 134-135 7.7875 0.0 0.0 0.0 0.0 136-137 8.4875 0.0 0.0 0.0 0.0 138-139 9.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGGGC 10 0.006830828 145.0 7 TTCCTTG 20 3.5877043E-4 108.75 6 >>END_MODULE Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764808 spots for SRR7180126.sra Written 764808 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra Read 764806 spots for SRR7180126.sra Written 764806 spots for SRR7180126.sra SRR ids: ['SRR7180126.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xnqt3q8f SRR7180126.sra spots: 15296122 blocks: [[1, 764806], [764807, 1529612], [1529613, 2294418], [2294419, 3059224], [3059225, 3824030], [3824031, 4588836], [4588837, 5353642], [5353643, 6118448], [6118449, 6883254], [6883255, 7648060], [7648061, 8412866], [8412867, 9177672], [9177673, 9942478], [9942479, 10707284], [10707285, 11472090], [11472091, 12236896], [12236897, 13001702], [13001703, 13766508], [13766509, 14531314], [14531315, 15296122]] SRR7180126 file size 5161653 SRR7180126 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180126 SRR7180126_1.fastq SRR7180126_2.fastq Input file: SRR7180126_1.fastq Paired file: SRR7180126_2.fastq trimmed: SRR7180126-trimmed-pair1.fastq, SRR7180126-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:38:50 2025 >> started Mon Feb 10 21:39:10 2025 >> done (20.409s) 15296122 read pairs processed; of these: 44246 ( 0.29%) short read pairs filtered out after trimming by size control 28735 ( 0.19%) empty read pairs filtered out after trimming by size control 15223141 (99.52%) read pairs available; of these: 6031864 (39.62%) trimmed read pairs available after processing 9191277 (60.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 5 0.00% 21 2 0.00% 22 7 0.00% 23 11 0.00% 24 12 0.00% 25 5 0.00% 26 13 0.00% 27 10 0.00% 28 7 0.00% 29 8 0.00% 30 3 0.00% 31 7 0.00% 32 5 0.00% 33 8 0.00% 34 7 0.00% 35 8 0.00% 36 10 0.00% 37 17 0.00% 38 22 0.00% 39 41 0.00% 40 8 0.00% 41 13 0.00% 42 11 0.00% 43 16 0.00% 44 15 0.00% 45 36 0.00% 46 25 0.00% 47 23 0.00% 48 23 0.00% 49 28 0.00% 50 30 0.00% 51 35 0.00% 52 45 0.00% 53 62 0.00% 54 67 0.00% 55 116 0.00% 56 154 0.00% 57 110 0.00% 58 74 0.00% 59 107 0.00% 60 107 0.00% 61 155 0.00% 62 232 0.00% 63 207 0.00% 64 219 0.00% 65 268 0.00% 66 281 0.00% 67 290 0.00% 68 321 0.00% 69 387 0.00% 70 471 0.00% 71 545 0.00% 72 657 0.00% 73 777 0.01% 74 814 0.01% 75 995 0.01% 76 1204 0.01% 77 1326 0.01% 78 1524 0.01% 79 1777 0.01% 80 1950 0.01% 81 2133 0.01% 82 2570 0.02% 83 3059 0.02% 84 5097 0.03% 85 6507 0.04% 86 7096 0.05% 87 7853 0.05% 88 8288 0.05% 89 8562 0.06% 90 9022 0.06% 91 9335 0.06% 92 10080 0.07% 93 10267 0.07% 94 11290 0.07% 95 11570 0.08% 96 12509 0.08% 97 13391 0.09% 98 14172 0.09% 99 14776 0.10% 100 15780 0.10% 101 16550 0.11% 102 17531 0.12% 103 18391 0.12% 104 19355 0.13% 105 20958 0.14% 106 22113 0.15% 107 23135 0.15% 108 24426 0.16% 109 25504 0.17% 110 26765 0.18% 111 28472 0.19% 112 29635 0.19% 113 30696 0.20% 114 32086 0.21% 115 33882 0.22% 116 34927 0.23% 117 36950 0.24% 118 37989 0.25% 119 39816 0.26% 120 41959 0.28% 121 43750 0.29% 122 44138 0.29% 123 45490 0.30% 124 47076 0.31% 125 48386 0.32% 126 49959 0.33% 127 50888 0.33% 128 52694 0.35% 129 54241 0.36% 130 56385 0.37% 131 58061 0.38% 132 60225 0.40% 133 62657 0.41% 134 64134 0.42% 135 66728 0.44% 136 68618 0.45% 137 70936 0.47% 138 73807 0.48% 139 76827 0.50% 140 80001 0.53% 141 84116 0.55% 142 89235 0.59% 143 96410 0.63% 144 105950 0.70% 145 116515 0.77% 146 131940 0.87% 147 163784 1.08% 148 229585 1.51% 149 432297 2.84% 150 2646816 17.39% 151 9191277 60.38% 15223141 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=19 prefix-density=0.66 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=152.13 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.6 sequence=TTGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCTGATCACAACCTGGTGGTAAAGAGCTGCAAGTGCTGCTCCAATGAAGGGGCCAACCCA criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=20 prefix-density=0.80 prefix-fanout=2.0 sequence=CTGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=31.24 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=8.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7180126 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:39:54 Started mapping on | Feb 10 21:39:54 Finished on | Feb 10 21:42:17 Mapping speed, Million of reads per hour | 383.24 Number of input reads | 15223141 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13993850 Uniquely mapped reads % | 91.92% Average mapped length | 292.48 Number of splices: Total | 13506322 Number of splices: Annotated (sjdb) | 13258649 Number of splices: GT/AG | 13296869 Number of splices: GC/AG | 163291 Number of splices: AT/AC | 10920 Number of splices: Non-canonical | 35242 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342107 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 49666 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.43% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 925110 925110 925110 N_multimapping 342107 342107 342107 N_noFeature 340386 13835919 415854 N_ambiguous 146250 871 63305 UnstrandedReadsAssigned:13507214 PositiveStrandReadsAssigned:157060 NegativeStrandReadsAssigned:13514691 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180126 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180126-trimmed-pair1.fastq SRR7180126-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,223,141 reads, 13,449,059 reads pseudoaligned [quant] estimated average fragment length: 218.379 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR7180126.ke.tsv 34699 SRR7180126.se.tsv 87100 total ==> SRR7180126.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.62 1576 58.4775 Potri.005G024800.1.v4.1 1035 817.621 828 67.6601 Potri.004G059700.1.v4.1 961 743.621 13 1.16801 Potri.007G009000.2.v4.1 1416 1198.62 0 0 Potri.003G141000.2.v4.1 2943 2725.62 710.247 17.41 Potri.016G087400.1.v4.1 270 87.0446 1346.09 1033.21 Potri.015G069301.1.v4.1 564 348.55 0 0 Potri.010G195200.1.v4.1 1773 1555.62 363 15.5904 Potri.012G127500.1.v4.1 977 759.621 3955 347.86 ==> SRR7180126.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 493 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 152 SRR7180126 completed mapping pipeline successfully