Starting /dee2/code/volunteer_pipeline.sh SRR7180127 current disk space = 3056304087040 free memory = 942610480 SRR7180127 SRAfilesize 0e03d57fb39f420afeeced14efd40392 SRR7180127.sra SRR7180127.sra file validated SRR7180127 is paired end SRR7180127 is conventional basespace SRR7180127 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180127_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.167 33.0 33.0 34.0 32.0 34.0 2 32.91425 34.0 33.0 34.0 32.0 34.0 3 31.91375 33.0 32.0 33.0 28.0 34.0 4 33.0905 33.0 33.0 34.0 32.0 34.0 5 33.10275 33.0 33.0 34.0 33.0 34.0 6 36.97275 38.0 37.0 38.0 35.0 38.0 7 37.53525 38.0 38.0 38.0 37.0 38.0 8 37.68625 38.0 38.0 38.0 38.0 38.0 9 37.724 38.0 38.0 38.0 38.0 38.0 10-14 37.71165 38.0 38.0 38.0 38.0 38.0 15-19 37.6947 38.0 38.0 38.0 38.0 38.0 20-24 37.67495 38.0 38.0 38.0 38.0 38.0 25-29 37.67075 38.0 38.0 38.0 38.0 38.0 30-34 37.634550000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.62365 38.0 38.0 38.0 38.0 38.0 40-44 37.56225 38.0 38.0 38.0 38.0 38.0 45-49 37.577799999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.52695 38.0 38.0 38.0 38.0 38.0 55-59 37.4812 38.0 38.0 38.0 37.8 38.0 60-64 37.42700000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.374649999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.33795 38.0 38.0 38.0 37.0 38.0 75-79 37.308749999999996 38.0 38.0 38.0 37.0 38.0 80-84 37.20739999999999 38.0 38.0 38.0 37.0 38.0 85-89 37.2275 38.0 38.0 38.0 37.0 38.0 90-94 37.1349 38.0 38.0 38.0 36.4 38.0 95-99 37.029 38.0 38.0 38.0 36.0 38.0 100-104 36.964999999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.87245 38.0 38.0 38.0 35.8 38.0 110-114 36.77515 38.0 38.0 38.0 35.0 38.0 115-119 36.6656 38.0 38.0 38.0 34.8 38.0 120-124 36.56320000000001 38.0 38.0 38.0 34.6 38.0 125-129 36.39785 38.0 38.0 38.0 34.0 38.0 130-134 36.160799999999995 38.0 38.0 38.0 33.8 38.0 135-139 35.96835 38.0 38.0 38.0 33.2 38.0 140-144 35.7849 38.0 37.4 38.0 33.0 38.0 145-149 35.46915 38.0 36.4 38.0 32.4 38.0 150-151 32.599000000000004 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 1.0 15 1.0 16 2.0 17 0.0 18 2.0 19 2.0 20 2.0 21 2.0 22 3.0 23 4.0 24 2.0 25 11.0 26 12.0 27 6.0 28 18.0 29 21.0 30 20.0 31 26.0 32 40.0 33 71.0 34 87.0 35 157.0 36 450.0 37 3056.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.38690792974987 15.141032464076638 11.868014901543374 35.60404470463012 2 21.7 18.575 37.675 22.05 3 19.275000000000002 25.8 27.950000000000003 26.974999999999998 4 21.7 30.275000000000002 23.925 24.099999999999998 5 21.425 34.65 25.424999999999997 18.5 6 19.725 32.95 25.674999999999997 21.65 7 14.325 21.95 43.974999999999994 19.75 8 18.875 22.625 30.375000000000004 28.125 9 18.175 22.55 34.225 25.05 10-14 20.79 27.985 26.655 24.57 15-19 19.885 28.12 28.735 23.26 20-24 19.580000000000002 28.155 28.4 23.865 25-29 20.25 28.360000000000003 28.110000000000003 23.28 30-34 20.21 28.194999999999997 27.900000000000002 23.695 35-39 20.235 27.950000000000003 28.595 23.22 40-44 20.225 28.03 28.415000000000003 23.330000000000002 45-49 20.52 28.21 28.02 23.25 50-54 19.88 27.66 28.055000000000003 24.404999999999998 55-59 20.255000000000003 28.305000000000003 27.665 23.775 60-64 19.91 28.625 27.779999999999998 23.685000000000002 65-69 19.52 28.185 28.494999999999997 23.799999999999997 70-74 20.5 27.985 27.965 23.549999999999997 75-79 20.115 27.944999999999997 28.04 23.9 80-84 20.150000000000002 27.650000000000002 28.255000000000003 23.945 85-89 20.125 27.415 28.849999999999998 23.61 90-94 20.06 27.935 28.610000000000003 23.395 95-99 20.474999999999998 28.015 28.015 23.494999999999997 100-104 20.24 27.295 28.4 24.065 105-109 19.915 28.185 28.225 23.674999999999997 110-114 20.77 27.88 28.215 23.135 115-119 20.74 27.87 27.985 23.405 120-124 21.099999999999998 27.395000000000003 27.57 23.935000000000002 125-129 20.43 27.310000000000002 28.07 24.19 130-134 20.915 27.589999999999996 27.889999999999997 23.605 135-139 20.825 27.915 27.235 24.025 140-144 20.89 28.405 26.26 24.445 145-149 21.085 28.21 26.91 23.794999999999998 150-151 20.8875 28.212500000000002 26.9125 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 2.5 24 3.5 25 3.0 26 4.5 27 8.5 28 10.5 29 13.5 30 18.0 31 19.0 32 21.5 33 38.0 34 51.5 35 59.0 36 82.0 37 108.0 38 135.0 39 168.5 40 199.0 41 233.5 42 271.0 43 276.0 44 285.5 45 283.5 46 266.5 47 251.5 48 216.5 49 186.0 50 162.0 51 145.5 52 114.5 53 89.0 54 68.0 55 40.0 56 31.5 57 28.5 58 23.5 59 21.0 60 16.0 61 11.0 62 9.0 63 6.5 64 4.0 65 2.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.2999999999999998 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.7 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.2874999999999996 0.0 0.0 0.0 0.0 118-119 2.6125 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.625 0.0 0.0 0.0 0.0 130-131 5.2375 0.0 0.0 0.0 0.0 132-133 5.9125 0.0 0.0 0.0 0.0 134-135 6.75 0.0 0.0 0.0 0.0 136-137 7.362500000000001 0.0 0.0 0.0 0.0 138-139 8.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTTCC 10 0.0068396386 144.9375 9 CCATTTC 10 0.0068396386 144.9375 8 AATAACT 10 0.0068396386 144.9375 5 TTTAAAT 10 0.0068396386 144.9375 7 >>END_MODULE SRR7180127 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180127_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.113 34.0 33.0 34.0 33.0 34.0 2 33.15875 34.0 33.0 34.0 33.0 34.0 3 33.2585 34.0 33.0 34.0 33.0 34.0 4 33.24425 34.0 33.0 34.0 33.0 34.0 5 33.2685 34.0 33.0 34.0 33.0 34.0 6 37.50975 38.0 38.0 38.0 38.0 38.0 7 37.44525 38.0 38.0 38.0 38.0 38.0 8 37.41225 38.0 38.0 38.0 38.0 38.0 9 37.4145 38.0 38.0 38.0 38.0 38.0 10-14 37.37405 38.0 38.0 38.0 38.0 38.0 15-19 37.42015 38.0 38.0 38.0 38.0 38.0 20-24 37.36925 38.0 38.0 38.0 37.8 38.0 25-29 37.393649999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.348349999999996 38.0 38.0 38.0 37.6 38.0 35-39 37.294349999999994 38.0 38.0 38.0 37.4 38.0 40-44 37.26965 38.0 38.0 38.0 37.0 38.0 45-49 37.32005 38.0 38.0 38.0 37.6 38.0 50-54 37.26370000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.2027 38.0 38.0 38.0 37.0 38.0 60-64 37.1431 38.0 38.0 38.0 37.0 38.0 65-69 37.11625 38.0 38.0 38.0 37.0 38.0 70-74 37.093599999999995 38.0 38.0 38.0 36.6 38.0 75-79 36.9956 38.0 38.0 38.0 36.2 38.0 80-84 36.960449999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.85915 38.0 38.0 38.0 36.0 38.0 90-94 36.7762 38.0 38.0 38.0 35.6 38.0 95-99 36.711749999999995 38.0 38.0 38.0 35.2 38.0 100-104 36.6215 38.0 38.0 38.0 35.0 38.0 105-109 36.3455 38.0 38.0 38.0 34.0 38.0 110-114 36.30844999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.14735 38.0 38.0 38.0 33.8 38.0 120-124 36.0163 38.0 37.6 38.0 33.2 38.0 125-129 35.8125 38.0 37.2 38.0 33.0 38.0 130-134 35.462450000000004 38.0 36.6 38.0 31.0 38.0 135-139 35.2631 38.0 36.0 38.0 31.0 38.0 140-144 34.9478 38.0 36.0 38.0 28.8 38.0 145-149 34.29185 38.0 35.0 38.0 26.4 38.0 150-151 30.346375000000002 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 1.0 5 5.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 1.0 16 2.0 17 4.0 18 0.0 19 1.0 20 2.0 21 9.0 22 4.0 23 8.0 24 10.0 25 11.0 26 15.0 27 15.0 28 20.0 29 30.0 30 31.0 31 33.0 32 49.0 33 70.0 34 111.0 35 196.0 36 513.0 37 2842.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.875 17.025000000000002 16.8 26.3 2 26.400000000000002 22.85 31.900000000000002 18.85 3 21.25 28.275 31.424999999999997 19.05 4 24.5 35.65 21.775 18.075 5 23.549999999999997 36.5 21.0 18.95 6 20.025000000000002 38.1 22.875 19.0 7 19.775000000000002 18.224999999999998 40.9 21.099999999999998 8 20.1 25.025 26.200000000000003 28.675 9 22.25 25.374999999999996 28.425 23.95 10-14 23.544999999999998 28.749999999999996 25.915 21.790000000000003 15-19 23.285 28.9 27.134999999999998 20.68 20-24 23.044999999999998 28.775000000000002 27.705000000000002 20.474999999999998 25-29 23.630000000000003 28.845 27.029999999999998 20.495 30-34 22.939999999999998 29.24 27.0 20.82 35-39 23.095 28.360000000000003 27.169999999999998 21.375 40-44 23.425 28.044999999999998 27.955000000000002 20.575 45-49 23.865 28.395 27.33 20.41 50-54 23.315 28.175 27.555000000000003 20.955 55-59 23.52 27.68 27.775 21.025 60-64 23.285 28.025 27.82 20.87 65-69 23.59 28.355000000000004 27.68 20.375 70-74 23.799999999999997 28.17 27.62 20.41 75-79 23.855 28.275 27.93 19.939999999999998 80-84 24.09 28.02 27.71 20.18 85-89 24.035 28.575 27.525 19.865 90-94 23.52 28.415000000000003 27.82 20.244999999999997 95-99 24.104999999999997 28.07 27.415 20.41 100-104 23.28 28.749999999999996 27.485 20.485 105-109 24.21 28.13 27.485 20.175 110-114 24.12 28.365000000000002 27.67 19.845 115-119 23.715 28.139999999999997 28.005000000000003 20.14 120-124 24.09 28.610000000000003 27.07 20.23 125-129 24.279999999999998 28.194999999999997 27.26 20.265 130-134 24.64 28.4 27.045 19.915 135-139 24.915000000000003 28.87 26.884999999999998 19.33 140-144 24.995 28.444999999999997 26.884999999999998 19.675 145-149 25.645 28.395 26.765 19.195 150-151 25.593898474618655 29.00725181295324 25.906476619154787 19.49237309327332 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.5 26 3.5 27 4.0 28 4.0 29 5.5 30 8.0 31 10.0 32 20.5 33 25.5 34 26.5 35 51.0 36 74.5 37 89.0 38 127.0 39 176.5 40 218.5 41 234.0 42 256.0 43 303.5 44 329.0 45 319.5 46 289.5 47 252.0 48 226.5 49 198.5 50 168.5 51 148.0 52 115.5 53 88.0 54 63.0 55 42.0 56 31.0 57 20.0 58 12.5 59 12.0 60 11.0 61 7.0 62 5.0 63 3.5 64 3.0 65 3.5 66 4.5 67 3.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.45294413688978363 0.8999999999999999 3 0.10065425264217413 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.0125000000000002 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.3375000000000004 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.4375 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 4.2 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 6.074999999999999 0.0 0.0 0.0 0.0 134-135 6.9 0.0 0.0 0.0 0.0 136-137 7.55 0.0 0.0 0.0 0.0 138-139 8.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGTCC 10 0.006830828 145.0 145 >>END_MODULE Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821062 spots for SRR7180127.sra Written 821062 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra Read 821046 spots for SRR7180127.sra Written 821046 spots for SRR7180127.sra SRR ids: ['SRR7180127.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_unry5bdm SRR7180127.sra spots: 16420936 blocks: [[1, 821046], [821047, 1642092], [1642093, 2463138], [2463139, 3284184], [3284185, 4105230], [4105231, 4926276], [4926277, 5747322], [5747323, 6568368], [6568369, 7389414], [7389415, 8210460], [8210461, 9031506], [9031507, 9852552], [9852553, 10673598], [10673599, 11494644], [11494645, 12315690], [12315691, 13136736], [13136737, 13957782], [13957783, 14778828], [14778829, 15599874], [15599875, 16420936]] SRR7180127 file size 5542816 SRR7180127 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180127 SRR7180127_1.fastq SRR7180127_2.fastq Input file: SRR7180127_1.fastq Paired file: SRR7180127_2.fastq trimmed: SRR7180127-trimmed-pair1.fastq, SRR7180127-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 20:56:54 2025 >> started Mon Feb 10 20:57:12 2025 >> done (18.769s) 16420936 read pairs processed; of these: 16735 ( 0.10%) short read pairs filtered out after trimming by size control 12169 ( 0.07%) empty read pairs filtered out after trimming by size control 16392032 (99.82%) read pairs available; of these: 6134751 (37.43%) trimmed read pairs available after processing 10257281 (62.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 4 0.00% 25 2 0.00% 26 7 0.00% 27 3 0.00% 28 4 0.00% 29 5 0.00% 30 2 0.00% 31 5 0.00% 32 7 0.00% 33 3 0.00% 34 8 0.00% 35 1 0.00% 36 5 0.00% 37 4 0.00% 38 5 0.00% 39 7 0.00% 40 11 0.00% 41 8 0.00% 42 5 0.00% 43 18 0.00% 44 8 0.00% 45 16 0.00% 46 10 0.00% 47 28 0.00% 48 33 0.00% 49 23 0.00% 50 39 0.00% 51 49 0.00% 52 43 0.00% 53 65 0.00% 54 50 0.00% 55 47 0.00% 56 56 0.00% 57 66 0.00% 58 76 0.00% 59 93 0.00% 60 108 0.00% 61 159 0.00% 62 139 0.00% 63 184 0.00% 64 198 0.00% 65 226 0.00% 66 268 0.00% 67 313 0.00% 68 340 0.00% 69 426 0.00% 70 486 0.00% 71 595 0.00% 72 674 0.00% 73 741 0.00% 74 869 0.01% 75 1037 0.01% 76 1106 0.01% 77 1328 0.01% 78 1442 0.01% 79 1641 0.01% 80 1965 0.01% 81 2126 0.01% 82 2471 0.02% 83 2847 0.02% 84 3903 0.02% 85 4721 0.03% 86 5107 0.03% 87 5661 0.03% 88 6161 0.04% 89 6459 0.04% 90 6816 0.04% 91 7533 0.05% 92 7989 0.05% 93 8749 0.05% 94 9433 0.06% 95 10147 0.06% 96 10527 0.06% 97 11577 0.07% 98 12057 0.07% 99 13081 0.08% 100 13596 0.08% 101 14476 0.09% 102 15430 0.09% 103 16087 0.10% 104 17385 0.11% 105 18464 0.11% 106 19689 0.12% 107 20458 0.12% 108 21624 0.13% 109 22572 0.14% 110 23922 0.15% 111 24909 0.15% 112 26233 0.16% 113 27176 0.17% 114 28727 0.18% 115 30064 0.18% 116 31278 0.19% 117 32221 0.20% 118 34497 0.21% 119 36142 0.22% 120 37979 0.23% 121 38950 0.24% 122 39576 0.24% 123 41189 0.25% 124 42895 0.26% 125 43565 0.27% 126 44899 0.27% 127 46767 0.29% 128 48164 0.29% 129 50191 0.31% 130 52046 0.32% 131 53522 0.33% 132 56210 0.34% 133 57821 0.35% 134 60511 0.37% 135 62845 0.38% 136 64968 0.40% 137 68064 0.42% 138 70655 0.43% 139 73581 0.45% 140 77084 0.47% 141 82531 0.50% 142 87904 0.54% 143 94169 0.57% 144 103744 0.63% 145 116823 0.71% 146 135355 0.83% 147 169654 1.03% 148 240779 1.47% 149 458819 2.80% 150 2886106 17.61% 151 10257281 62.57% 16392032 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=32 prefix-density=0.64 prefix-fanout=2.8 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=65.41 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.3 sequence=TTCTTGATAAATTTCTTAATCTGTGTAAGAAACTGCTTCTTGTCAAATGGAGGTTGCTCCTGGAGCCTAAATGTGTCAACGATGTCAACAACCTTGGCAGCTTGGTCATCAACACCCTCATCCTCATCA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=4.75 fanout-score-rank=21 prefix-density=1.08 prefix-fanout=1.9 sequence=CTGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=222.25 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=13.6 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT SRR7180127 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 20:58:00 Started mapping on | Feb 10 20:58:00 Finished on | Feb 10 20:59:46 Mapping speed, Million of reads per hour | 556.71 Number of input reads | 16392032 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15401810 Uniquely mapped reads % | 93.96% Average mapped length | 293.91 Number of splices: Total | 15345559 Number of splices: Annotated (sjdb) | 15027443 Number of splices: GT/AG | 15090587 Number of splices: GC/AG | 198507 Number of splices: AT/AC | 13296 Number of splices: Non-canonical | 43169 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356701 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 40724 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.56% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 649848 649848 649848 N_multimapping 356701 356701 356701 N_noFeature 416558 15256393 480686 N_ambiguous 157521 774 75886 UnstrandedReadsAssigned:14827731 PositiveStrandReadsAssigned:144643 NegativeStrandReadsAssigned:14845238 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180127 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180127-trimmed-pair1.fastq SRR7180127-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,392,032 reads, 14,743,965 reads pseudoaligned [quant] estimated average fragment length: 224.393 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR7180127.ke.tsv 34699 SRR7180127.se.tsv 87100 total ==> SRR7180127.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.61 1261 45.1531 Potri.005G024800.1.v4.1 1035 811.607 319 25.2573 Potri.004G059700.1.v4.1 961 737.618 11 0.958303 Potri.007G009000.2.v4.1 1416 1192.61 0 0 Potri.003G141000.2.v4.1 2943 2719.61 701.244 16.5693 Potri.016G087400.1.v4.1 270 84.4808 1140 867.139 Potri.015G069301.1.v4.1 564 342.782 0 0 Potri.010G195200.1.v4.1 1773 1549.61 457.783 18.9837 Potri.012G127500.1.v4.1 977 753.618 15870 1353.22 ==> SRR7180127.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 53 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 459 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 307 SRR7180127 completed mapping pipeline successfully