Starting /dee2/code/volunteer_pipeline.sh SRR7180128 current disk space = 2818724450304 free memory = 1580977160 SRR7180128 SRAfilesize 9b7c97080c07df21905b8a06586bb189 SRR7180128.sra SRR7180128.sra file validated SRR7180128 is paired end SRR7180128 is conventional basespace SRR7180128 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180128_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.09475 32.0 18.0 33.0 18.0 34.0 2 30.574 32.0 30.0 33.0 25.0 34.0 3 31.409 33.0 31.0 33.0 29.0 33.0 4 32.269 33.0 32.0 33.0 32.0 34.0 5 32.5305 33.0 33.0 33.0 32.0 34.0 6 36.9105 38.0 37.0 38.0 35.0 38.0 7 37.21075 38.0 38.0 38.0 36.0 38.0 8 37.5235 38.0 38.0 38.0 37.0 38.0 9 37.6385 38.0 38.0 38.0 38.0 38.0 10-14 37.68485 38.0 38.0 38.0 38.0 38.0 15-19 37.650549999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.585449999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.591 38.0 38.0 38.0 38.0 38.0 30-34 37.5882 38.0 38.0 38.0 38.0 38.0 35-39 37.5407 38.0 38.0 38.0 38.0 38.0 40-44 37.5068 38.0 38.0 38.0 38.0 38.0 45-49 37.52955 38.0 38.0 38.0 38.0 38.0 50-54 37.4939 38.0 38.0 38.0 38.0 38.0 55-59 37.3702 38.0 38.0 38.0 37.0 38.0 60-64 37.3745 38.0 38.0 38.0 37.0 38.0 65-69 36.96704999999999 38.0 38.0 38.0 36.2 38.0 70-74 36.9507 38.0 38.0 38.0 36.2 38.0 75-79 37.08005 38.0 38.0 38.0 36.2 38.0 80-84 37.0873 38.0 38.0 38.0 36.0 38.0 85-89 37.04965 38.0 38.0 38.0 36.0 38.0 90-94 36.8618 38.0 38.0 38.0 35.2 38.0 95-99 36.80525 38.0 38.0 38.0 35.0 38.0 100-104 36.5484 38.0 38.0 38.0 34.2 38.0 105-109 36.52315 38.0 38.0 38.0 34.2 38.0 110-114 36.19035 38.0 37.4 38.0 33.4 38.0 115-119 36.13745 38.0 37.0 38.0 33.4 38.0 120-124 35.9288 38.0 37.0 38.0 32.6 38.0 125-129 35.65865 38.0 36.2 38.0 31.2 38.0 130-134 35.3792 38.0 36.0 38.0 30.0 38.0 135-139 35.04015 38.0 35.6 38.0 28.6 38.0 140-144 34.67085 38.0 34.6 38.0 27.4 38.0 145-149 33.4024 38.0 33.8 38.0 20.6 38.0 150-151 28.3215 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 2.0 15 0.0 16 1.0 17 1.0 18 3.0 19 3.0 20 3.0 21 1.0 22 1.0 23 7.0 24 4.0 25 11.0 26 8.0 27 6.0 28 20.0 29 19.0 30 33.0 31 41.0 32 73.0 33 131.0 34 153.0 35 313.0 36 792.0 37 2369.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.57443082311734 15.911933950462847 12.809607205404053 38.704028021015766 2 19.0 19.775000000000002 37.275000000000006 23.95 3 20.424999999999997 21.8 27.250000000000004 30.525000000000002 4 22.725 29.825000000000003 22.425 25.025 5 21.9 32.675 23.35 22.075 6 19.075 36.449999999999996 25.074999999999996 19.400000000000002 7 14.799999999999999 25.074999999999996 42.1 18.025 8 17.95 24.0 31.45 26.6 9 17.45 25.85 32.65 24.05 10-14 19.64 29.735 27.22 23.405 15-19 19.564999999999998 28.99 27.42 24.025 20-24 19.657863145258105 29.381752701080433 27.521008403361346 23.43937575030012 25-29 20.095 28.794999999999998 27.62 23.49 30-34 19.975 28.884999999999998 27.965 23.175 35-39 20.11 29.015 26.900000000000002 23.974999999999998 40-44 19.99 28.92 27.689999999999998 23.400000000000002 45-49 20.119999999999997 28.655 27.575 23.65 50-54 20.215 29.015 27.439999999999998 23.330000000000002 55-59 20.175 28.48 27.794999999999998 23.549999999999997 60-64 20.002000700245084 29.170209573350675 27.114490071525033 23.713299654879208 65-69 20.470493210157 28.97672775001262 27.411782523095564 23.14099651673482 70-74 20.095742000503904 28.88384983623079 27.362055933484502 23.658352229780803 75-79 20.635 28.599999999999998 27.125 23.64 80-84 21.365000000000002 27.900000000000002 26.97 23.765 85-89 20.04 28.050000000000004 28.025 23.885 90-94 20.75 27.92 27.860000000000003 23.47 95-99 20.11 28.799999999999997 27.36 23.73 100-104 20.252151290774464 28.31699019411647 27.876726035621374 23.554132479487695 105-109 20.935000000000002 27.834999999999997 27.534999999999997 23.695 110-114 20.577780003004058 27.882641566114252 27.67235768287188 23.867220748009814 115-119 21.415 28.035 26.900000000000002 23.65 120-124 20.375 28.555000000000003 27.189999999999998 23.880000000000003 125-129 21.032103210321033 27.952795279527955 27.462746274627463 23.552355235523553 130-134 21.345 28.04 26.83 23.785 135-139 21.14 28.08 26.490000000000002 24.29 140-144 21.085 28.555000000000003 26.58 23.78 145-149 21.445 28.26 26.415 23.880000000000003 150-151 20.025000000000002 28.0875 27.0625 24.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.5 22 2.0 23 3.5 24 4.5 25 5.5 26 7.0 27 8.0 28 7.0 29 13.0 30 25.0 31 29.5 32 37.5 33 44.5 34 55.5 35 72.0 36 85.5 37 108.0 38 135.5 39 166.0 40 181.0 41 208.0 42 242.5 43 262.0 44 272.0 45 274.5 46 271.0 47 244.0 48 229.0 49 208.5 50 164.5 51 135.0 52 123.5 53 105.0 54 75.5 55 51.0 56 31.0 57 23.5 58 21.0 59 14.0 60 10.0 61 7.0 62 8.5 63 10.0 64 4.0 65 1.0 66 1.5 67 1.5 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.04 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.034999999999999996 65-69 0.955 70-74 0.775 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.0 110-114 0.135 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8496993987976 99.65 2 0.125250501002004 0.25 3 0.0 0.0 4 0.0250501002004008 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.825 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.3625 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.85 0.0 0.0 0.0 0.0 126-127 4.324999999999999 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 4.949999999999999 0.0 0.0 0.0 0.0 132-133 5.3375 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.325 0.0 0.0 0.0 0.0 138-139 6.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGAT 10 0.006867937 144.7375 3 CCAGATA 10 0.006867937 144.7375 4 ACACCAG 10 0.006867937 144.7375 145 ATTCTTC 10 0.006867937 144.7375 5 >>END_MODULE SRR7180128 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180128_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.846 34.0 33.0 34.0 33.0 34.0 2 32.93775 34.0 33.0 34.0 33.0 34.0 3 32.9665 34.0 33.0 34.0 33.0 34.0 4 32.9245 34.0 33.0 34.0 33.0 34.0 5 32.905 34.0 33.0 34.0 33.0 34.0 6 36.99075 38.0 38.0 38.0 37.0 38.0 7 37.04975 38.0 38.0 38.0 38.0 38.0 8 37.01125 38.0 38.0 38.0 38.0 38.0 9 36.87 38.0 38.0 38.0 38.0 38.0 10-14 36.89155 38.0 38.0 38.0 37.6 38.0 15-19 37.089150000000004 38.0 38.0 38.0 37.6 38.0 20-24 37.0679 38.0 38.0 38.0 37.4 38.0 25-29 37.10575 38.0 38.0 38.0 38.0 38.0 30-34 37.14525 38.0 38.0 38.0 38.0 38.0 35-39 37.06595 38.0 38.0 38.0 37.6 38.0 40-44 36.979150000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.0122 38.0 38.0 38.0 37.0 38.0 50-54 36.98055 38.0 38.0 38.0 37.0 38.0 55-59 36.89475 38.0 38.0 38.0 36.8 38.0 60-64 36.813599999999994 38.0 38.0 38.0 36.6 38.0 65-69 36.69839999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.72925 38.0 38.0 38.0 36.0 38.0 75-79 36.7079 38.0 38.0 38.0 36.0 38.0 80-84 36.6104 38.0 38.0 38.0 36.0 38.0 85-89 36.4918 38.0 38.0 38.0 35.6 38.0 90-94 36.447849999999995 38.0 38.0 38.0 35.2 38.0 95-99 36.24625 38.0 38.0 38.0 34.2 38.0 100-104 36.09265 38.0 38.0 38.0 34.0 38.0 105-109 36.096500000000006 38.0 38.0 38.0 34.0 38.0 110-114 35.771550000000005 38.0 37.6 38.0 33.0 38.0 115-119 35.60585 38.0 37.2 38.0 32.2 38.0 120-124 35.512600000000006 38.0 37.2 38.0 31.8 38.0 125-129 35.2043 38.0 36.2 38.0 30.4 38.0 130-134 35.0452 38.0 36.0 38.0 30.0 38.0 135-139 34.27935 38.0 34.6 38.0 24.4 38.0 140-144 33.999449999999996 38.0 33.6 38.0 23.4 38.0 145-149 33.318200000000004 38.0 33.0 38.0 18.4 38.0 150-151 27.96225 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 7.0 4 8.0 5 1.0 6 4.0 7 1.0 8 3.0 9 3.0 10 2.0 11 2.0 12 2.0 13 4.0 14 2.0 15 4.0 16 4.0 17 5.0 18 3.0 19 5.0 20 5.0 21 6.0 22 1.0 23 8.0 24 5.0 25 12.0 26 12.0 27 22.0 28 20.0 29 21.0 30 33.0 31 47.0 32 70.0 33 84.0 34 173.0 35 226.0 36 592.0 37 2585.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.40262361251261 17.608476286579215 17.734611503531784 28.254288597376387 2 23.973810123394614 23.142785192646688 34.903047091412745 17.98035759254596 3 21.87814702920443 25.956696878147028 29.632426988922454 22.532729103726084 4 26.81944094686477 31.80559053135231 22.261395114580708 19.113573407202217 5 26.54911838790932 35.113350125944585 21.28463476070529 17.052896725440807 6 19.345911949685537 36.528301886792455 24.930817610062896 19.19496855345912 7 19.753397081026673 17.287367891293407 41.11726220432813 21.84197282335179 8 21.676737160120847 23.66565961732125 28.600201409869086 26.057401812688823 9 22.674418604651162 24.3427704752275 30.080889787664304 22.901921132457026 10-14 23.957019623669478 28.31054835292337 26.625636886445037 21.106795136962113 15-19 23.870967741935484 27.81695423855964 27.336834208552137 20.975243810952737 20-24 23.115 28.875 26.965 21.044999999999998 25-29 23.785 28.560000000000002 26.6 21.055 30-34 24.25 28.015 27.065 20.669999999999998 35-39 23.54 28.59 26.85 21.02 40-44 23.555 27.855 27.375 21.215 45-49 23.48 28.13 27.205000000000002 21.185000000000002 50-54 23.64 27.88 27.36 21.12 55-59 23.985 27.805000000000003 27.305 20.905 60-64 23.945 27.855 27.43 20.77 65-69 23.919999999999998 27.389999999999997 27.555000000000003 21.135 70-74 23.549999999999997 27.775 28.08 20.595 75-79 23.765 27.655 27.939999999999998 20.64 80-84 23.714228537122274 27.756653992395435 27.891735041024614 20.637382429457674 85-89 23.705926481620406 27.376844211052763 27.76194048512128 21.155288822205552 90-94 23.919999999999998 27.495000000000005 27.639999999999997 20.945 95-99 23.919999999999998 27.595 27.615000000000002 20.87 100-104 23.89 27.875 27.665 20.57 105-109 23.919999999999998 27.525 27.915 20.64 110-114 23.555 27.85 27.884999999999998 20.71 115-119 24.625 27.725 27.33 20.32 120-124 24.445 27.474999999999998 27.83 20.25 125-129 24.529999999999998 27.295 27.834999999999997 20.34 130-134 24.645 27.815 27.779999999999998 19.759999999999998 135-139 24.349999999999998 28.01 27.555000000000003 20.085 140-144 25.11 28.09 27.33 19.470000000000002 145-149 25.25 27.925 27.055 19.77 150-151 25.7625 27.487499999999997 27.037499999999998 19.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 1.5 25 4.5 26 4.0 27 2.5 28 5.5 29 7.0 30 8.5 31 13.5 32 19.5 33 29.5 34 44.5 35 51.5 36 56.0 37 84.0 38 119.5 39 139.5 40 171.0 41 211.0 42 233.5 43 274.0 44 308.5 45 297.0 46 289.0 47 278.5 48 259.0 49 229.0 50 187.0 51 144.0 52 125.5 53 106.5 54 71.5 55 52.5 56 36.0 57 28.0 58 23.5 59 19.5 60 11.5 61 6.0 62 7.5 63 6.5 64 6.5 65 6.5 66 4.0 67 2.5 68 1.0 69 0.5 70 1.5 71 2.5 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.7250000000000001 3 0.7000000000000001 4 0.7250000000000001 5 0.75 6 0.625 7 0.65 8 0.7000000000000001 9 1.0999999999999999 10-14 0.885 15-19 0.025 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.06 85-89 0.025 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1625 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.825 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.3875 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.475 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.7875 0.0 0.0 0.0 0.0 136-137 6.375 0.0 0.0 0.0 0.0 138-139 6.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAATG 10 0.0065993075 146.65823 2 TCCACCT 10 0.0065993075 146.65823 9 >>END_MODULE Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra Read 660266 spots for SRR7180128.sra Written 660266 spots for SRR7180128.sra Read 660265 spots for SRR7180128.sra Written 660265 spots for SRR7180128.sra SRR ids: ['SRR7180128.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4zqj35jg SRR7180128.sra spots: 13205301 blocks: [[1, 660265], [660266, 1320530], [1320531, 1980795], [1980796, 2641060], [2641061, 3301325], [3301326, 3961590], [3961591, 4621855], [4621856, 5282120], [5282121, 5942385], [5942386, 6602650], [6602651, 7262915], [7262916, 7923180], [7923181, 8583445], [8583446, 9243710], [9243711, 9903975], [9903976, 10564240], [10564241, 11224505], [11224506, 11884770], [11884771, 12545035], [12545036, 13205301]] SRR7180128 file size 4453142 SRR7180128 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180128 SRR7180128_1.fastq SRR7180128_2.fastq Input file: SRR7180128_1.fastq Paired file: SRR7180128_2.fastq trimmed: SRR7180128-trimmed-pair1.fastq, SRR7180128-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 16:03:32 2025 >> started Thu Apr 10 16:03:47 2025 >> done (15.340s) 13205301 read pairs processed; of these: 23141 ( 0.18%) short read pairs filtered out after trimming by size control 19838 ( 0.15%) empty read pairs filtered out after trimming by size control 13162322 (99.67%) read pairs available; of these: 6755545 (51.32%) trimmed read pairs available after processing 6406777 (48.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 9 0.00% 21 4 0.00% 22 5 0.00% 23 6 0.00% 24 9 0.00% 25 2 0.00% 26 9 0.00% 27 5 0.00% 28 7 0.00% 29 6 0.00% 30 7 0.00% 31 7 0.00% 32 2 0.00% 33 2 0.00% 34 5 0.00% 35 4 0.00% 36 5 0.00% 37 5 0.00% 38 5 0.00% 39 12 0.00% 40 7 0.00% 41 9 0.00% 42 11 0.00% 43 18 0.00% 44 14 0.00% 45 18 0.00% 46 12 0.00% 47 17 0.00% 48 26 0.00% 49 21 0.00% 50 27 0.00% 51 21 0.00% 52 49 0.00% 53 49 0.00% 54 40 0.00% 55 45 0.00% 56 61 0.00% 57 59 0.00% 58 98 0.00% 59 93 0.00% 60 104 0.00% 61 140 0.00% 62 155 0.00% 63 158 0.00% 64 194 0.00% 65 204 0.00% 66 231 0.00% 67 291 0.00% 68 341 0.00% 69 393 0.00% 70 420 0.00% 71 487 0.00% 72 617 0.00% 73 636 0.00% 74 783 0.01% 75 908 0.01% 76 1016 0.01% 77 1195 0.01% 78 1272 0.01% 79 1431 0.01% 80 1616 0.01% 81 1838 0.01% 82 2138 0.02% 83 2511 0.02% 84 3670 0.03% 85 4593 0.03% 86 4874 0.04% 87 5264 0.04% 88 5557 0.04% 89 5650 0.04% 90 6081 0.05% 91 6369 0.05% 92 6790 0.05% 93 7174 0.05% 94 7784 0.06% 95 8163 0.06% 96 8969 0.07% 97 9454 0.07% 98 10278 0.08% 99 10833 0.08% 100 11585 0.09% 101 12091 0.09% 102 13108 0.10% 103 13745 0.10% 104 14375 0.11% 105 14950 0.11% 106 16281 0.12% 107 17442 0.13% 108 18240 0.14% 109 19345 0.15% 110 20230 0.15% 111 21238 0.16% 112 21821 0.17% 113 22749 0.17% 114 23615 0.18% 115 24765 0.19% 116 25960 0.20% 117 27457 0.21% 118 28726 0.22% 119 29832 0.23% 120 30994 0.24% 121 32339 0.25% 122 33683 0.26% 123 35373 0.27% 124 36689 0.28% 125 37648 0.29% 126 38832 0.30% 127 40836 0.31% 128 42026 0.32% 129 43700 0.33% 130 46058 0.35% 131 48173 0.37% 132 50381 0.38% 133 52982 0.40% 134 54452 0.41% 135 57085 0.43% 136 59828 0.45% 137 63090 0.48% 138 66837 0.51% 139 71423 0.54% 140 76297 0.58% 141 82496 0.63% 142 91129 0.69% 143 100654 0.76% 144 114979 0.87% 145 134085 1.02% 146 168723 1.28% 147 247371 1.88% 148 375721 2.85% 149 654608 4.97% 150 3238093 24.60% 151 6406777 48.68% 13162322 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.50 fanout-score-rank=17 prefix-density=0.29 prefix-fanout=3.7 sequence=CCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=379.43 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=34.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=35 prefix-density=0.35 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=154.29 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=10.0 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7180128 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 16:04:32 Started mapping on | Apr 10 16:04:32 Finished on | Apr 10 16:06:34 Mapping speed, Million of reads per hour | 388.40 Number of input reads | 13162322 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12183098 Uniquely mapped reads % | 92.56% Average mapped length | 293.14 Number of splices: Total | 11804174 Number of splices: Annotated (sjdb) | 11595617 Number of splices: GT/AG | 11617838 Number of splices: GC/AG | 144392 Number of splices: AT/AC | 9502 Number of splices: Non-canonical | 32442 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360986 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 30149 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.39% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 638108 638108 638108 N_multimapping 360986 360986 360986 N_noFeature 278632 12064230 329813 N_ambiguous 127708 734 59576 UnstrandedReadsAssigned:11776758 PositiveStrandReadsAssigned:118134 NegativeStrandReadsAssigned:11793709 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7180128 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180128-trimmed-pair1.fastq SRR7180128-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,162,322 reads, 11,731,579 reads pseudoaligned [quant] estimated average fragment length: 223.469 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR7180128.ke.tsv 34699 SRR7180128.se.tsv 87100 total ==> SRR7180128.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.53 806 34.6087 Potri.005G024800.1.v4.1 1035 812.531 171 16.2256 Potri.004G059700.1.v4.1 961 738.531 22 2.29666 Potri.007G009000.2.v4.1 1416 1193.53 0 0 Potri.003G141000.2.v4.1 2943 2720.53 376 10.6556 Potri.016G087400.1.v4.1 270 83.5371 1280 1181.34 Potri.015G069301.1.v4.1 564 343.339 0 0 Potri.010G195200.1.v4.1 1773 1550.53 303.901 15.1111 Potri.012G127500.1.v4.1 977 754.531 3914 399.933 ==> SRR7180128.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 398 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 195 SRR7180128 completed mapping pipeline successfully