Starting /dee2/code/volunteer_pipeline.sh SRR7180129 current disk space = 3056619581440 free memory = 1445275284 SRR7180129 SRAfilesize 4004241fd18717dae3eed9fd9e62e0f2 SRR7180129.sra SRR7180129.sra file validated SRR7180129 is paired end SRR7180129 is conventional basespace SRR7180129 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180129_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.98475 32.0 18.0 33.0 18.0 34.0 2 30.0415 32.0 27.0 33.0 25.0 34.0 3 31.24675 33.0 31.0 33.0 28.0 34.0 4 31.9645 33.0 32.0 33.0 31.0 34.0 5 32.3515 33.0 33.0 33.0 31.0 34.0 6 36.3895 38.0 37.0 38.0 34.0 38.0 7 37.31125 38.0 38.0 38.0 36.0 38.0 8 37.56475 38.0 38.0 38.0 37.0 38.0 9 37.62625 38.0 38.0 38.0 38.0 38.0 10-14 37.6459 38.0 38.0 38.0 38.0 38.0 15-19 37.67235 38.0 38.0 38.0 38.0 38.0 20-24 37.57715 38.0 38.0 38.0 38.0 38.0 25-29 37.61135 38.0 38.0 38.0 38.0 38.0 30-34 37.5817 38.0 38.0 38.0 38.0 38.0 35-39 37.57275 38.0 38.0 38.0 38.0 38.0 40-44 37.52565 38.0 38.0 38.0 38.0 38.0 45-49 37.5236 38.0 38.0 38.0 38.0 38.0 50-54 37.461 38.0 38.0 38.0 37.4 38.0 55-59 37.37595 38.0 38.0 38.0 37.0 38.0 60-64 37.3335 38.0 38.0 38.0 37.0 38.0 65-69 37.0664 38.0 38.0 38.0 36.6 38.0 70-74 36.99595000000001 38.0 38.0 38.0 36.4 38.0 75-79 37.104150000000004 38.0 38.0 38.0 36.2 38.0 80-84 37.10215000000001 38.0 38.0 38.0 36.0 38.0 85-89 37.00025000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.8959 38.0 38.0 38.0 35.4 38.0 95-99 36.73780000000001 38.0 38.0 38.0 35.0 38.0 100-104 36.5269 38.0 38.0 38.0 34.2 38.0 105-109 36.505250000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.147450000000006 38.0 37.4 38.0 33.2 38.0 115-119 36.0569 38.0 37.0 38.0 32.8 38.0 120-124 35.85455 38.0 36.8 38.0 32.4 38.0 125-129 35.669399999999996 38.0 36.0 38.0 31.4 38.0 130-134 35.362700000000004 38.0 36.0 38.0 30.0 38.0 135-139 34.981300000000005 38.0 35.0 38.0 28.0 38.0 140-144 34.662400000000005 38.0 34.6 38.0 27.4 38.0 145-149 33.12115 38.0 33.8 38.0 17.2 38.0 150-151 28.3435 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 1.0 16 1.0 17 2.0 18 2.0 19 4.0 20 1.0 21 2.0 22 1.0 23 5.0 24 3.0 25 11.0 26 13.0 27 14.0 28 18.0 29 24.0 30 40.0 31 49.0 32 64.0 33 107.0 34 191.0 35 321.0 36 799.0 37 2325.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.09682261696272 15.161371028271203 12.759569677257943 42.982236677508126 2 18.525 20.549999999999997 36.525 24.4 3 19.75 23.575 25.75 30.925000000000004 4 21.975 32.375 21.375 24.275 5 21.025 33.95 23.95 21.075 6 19.15 34.849999999999994 25.525 20.474999999999998 7 14.224999999999998 23.25 42.4 20.125 8 17.65 24.25 31.5 26.6 9 17.575 23.849999999999998 33.074999999999996 25.5 10-14 19.41 29.775000000000002 26.695 24.12 15-19 20.01 28.084999999999997 28.035 23.87 20-24 19.365809742922877 28.43853155946784 28.218465539661896 23.977193157947386 25-29 19.28 28.52 28.205000000000002 23.995 30-34 19.62 28.575 28.060000000000002 23.745 35-39 19.66 28.615000000000002 28.315 23.41 40-44 19.91 28.435 27.825 23.830000000000002 45-49 20.04 27.76 27.715 24.485 50-54 19.98 28.275 27.800000000000004 23.945 55-59 19.935 27.839999999999996 28.34 23.885 60-64 19.805893241282703 27.785281905047775 27.825303917154436 24.583520936515082 65-69 20.829558038860366 27.52944729688916 28.4707540521494 23.17024061210108 70-74 20.111703733521182 28.313374257824293 27.674348394887794 23.900573613766728 75-79 20.11 27.38 28.384999999999998 24.125 80-84 19.465 28.470000000000002 27.91 24.154999999999998 85-89 20.315 28.28 27.825 23.580000000000002 90-94 20.669999999999998 27.01 27.99 24.33 95-99 20.01 27.77 28.32 23.9 100-104 20.553221288515406 27.541016406562623 28.106242496998803 23.79951980792317 105-109 20.53 27.775 27.255000000000003 24.44 110-114 20.33126501200961 27.987389911929544 27.847277822257805 23.834067253803042 115-119 20.385 28.33 27.66 23.625 120-124 20.674999999999997 27.839999999999996 27.555000000000003 23.93 125-129 20.665 27.32 28.335 23.68 130-134 20.674999999999997 27.894999999999996 27.48 23.95 135-139 21.310000000000002 27.92 27.01 23.76 140-144 21.11 27.485 27.650000000000002 23.755000000000003 145-149 21.83 28.144999999999996 26.415 23.61 150-151 21.5625 28.050000000000004 26.087500000000002 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 2.0 23 2.0 24 1.5 25 4.5 26 6.0 27 7.0 28 7.0 29 8.5 30 14.5 31 18.0 32 24.0 33 45.5 34 57.5 35 62.0 36 83.0 37 108.5 38 133.5 39 156.0 40 181.5 41 221.0 42 249.5 43 282.5 44 300.0 45 283.0 46 273.5 47 245.0 48 237.5 49 223.5 50 174.5 51 145.0 52 116.0 53 80.0 54 58.0 55 49.5 56 32.5 57 21.0 58 22.5 59 16.0 60 11.0 61 10.5 62 6.0 63 4.0 64 3.5 65 4.0 66 2.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.055 65-69 0.67 70-74 0.63 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.08 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.7875 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.237500000000001 0.0 0.0 0.0 0.0 134-135 4.6 0.0 0.0 0.0 0.0 136-137 5.1375 0.0 0.0 0.0 0.0 138-139 5.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180129 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180129_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95975 34.0 33.0 34.0 33.0 34.0 2 33.06125 34.0 33.0 34.0 33.0 34.0 3 33.0845 34.0 33.0 34.0 33.0 34.0 4 33.0885 34.0 33.0 34.0 33.0 34.0 5 33.07975 34.0 33.0 34.0 33.0 34.0 6 37.269 38.0 38.0 38.0 38.0 38.0 7 37.17475 38.0 38.0 38.0 38.0 38.0 8 37.2205 38.0 38.0 38.0 38.0 38.0 9 37.123 38.0 38.0 38.0 38.0 38.0 10-14 37.1067 38.0 38.0 38.0 37.6 38.0 15-19 37.2784 38.0 38.0 38.0 37.6 38.0 20-24 37.185500000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.290049999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.293899999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.2423 38.0 38.0 38.0 38.0 38.0 40-44 37.185849999999995 38.0 38.0 38.0 37.6 38.0 45-49 37.171299999999995 38.0 38.0 38.0 37.2 38.0 50-54 37.09905 38.0 38.0 38.0 37.0 38.0 55-59 37.11925 38.0 38.0 38.0 37.0 38.0 60-64 36.9577 38.0 38.0 38.0 36.4 38.0 65-69 36.85 38.0 38.0 38.0 36.4 38.0 70-74 36.8875 38.0 38.0 38.0 36.4 38.0 75-79 36.8122 38.0 38.0 38.0 36.0 38.0 80-84 36.73415 38.0 38.0 38.0 36.0 38.0 85-89 36.693149999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.669399999999996 38.0 38.0 38.0 35.6 38.0 95-99 36.46595000000001 38.0 38.0 38.0 34.6 38.0 100-104 36.3427 38.0 38.0 38.0 34.2 38.0 105-109 36.325300000000006 38.0 38.0 38.0 34.4 38.0 110-114 35.94575 38.0 38.0 38.0 33.0 38.0 115-119 35.910000000000004 38.0 37.6 38.0 33.0 38.0 120-124 35.737899999999996 38.0 37.6 38.0 32.4 38.0 125-129 35.523300000000006 38.0 36.8 38.0 31.4 38.0 130-134 35.26775 38.0 36.2 38.0 30.0 38.0 135-139 34.630399999999995 38.0 35.8 38.0 27.2 38.0 140-144 34.286649999999995 38.0 34.0 38.0 26.0 38.0 145-149 33.483850000000004 38.0 33.0 38.0 21.2 38.0 150-151 28.531 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 7.0 4 4.0 5 3.0 6 2.0 7 1.0 8 2.0 9 1.0 10 1.0 11 2.0 12 3.0 13 4.0 14 1.0 15 2.0 16 2.0 17 3.0 18 1.0 19 6.0 20 8.0 21 5.0 22 6.0 23 6.0 24 5.0 25 23.0 26 8.0 27 16.0 28 24.0 29 20.0 30 37.0 31 49.0 32 56.0 33 80.0 34 147.0 35 268.0 36 532.0 37 2660.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.31102164066432 15.752390538500253 18.117765475591344 29.81882234524409 2 23.560472718129244 23.96278601961277 35.75559466934875 16.72114659290923 3 22.724987430869785 25.540472599296127 29.98994469582705 21.74459527400704 4 24.013075182298216 34.09605230072919 21.900930349509682 19.989942167462914 5 22.73070153381946 38.11918531556449 23.133014835302994 16.01709831531305 6 19.939728779507785 37.51883475640382 24.03314917127072 18.50828729281768 7 18.84422110552764 19.020100502512562 40.20100502512563 21.934673366834172 8 20.920291677143577 24.817701785265275 27.131003268795574 27.131003268795574 9 22.261395114580708 24.930747922437675 29.337698312767564 23.470158650214053 10-14 23.85002516356316 28.16809260191243 26.04428787116256 21.93759436336185 15-19 23.23080770192548 28.11702925731433 27.981995498874717 20.67016754188547 20-24 23.72 28.384999999999998 27.275 20.62 25-29 24.14 28.515 26.424999999999997 20.919999999999998 30-34 23.285 28.720000000000002 27.889999999999997 20.105 35-39 23.705000000000002 27.994999999999997 27.275 21.025 40-44 23.72 28.884999999999998 27.16 20.235 45-49 23.805 28.585 26.924999999999997 20.685000000000002 50-54 23.435 27.800000000000004 27.72 21.044999999999998 55-59 23.895 27.97 27.73 20.405 60-64 23.13 28.349999999999998 27.575 20.945 65-69 23.885 28.110000000000003 27.3 20.705000000000002 70-74 24.25 28.075 27.35 20.325 75-79 24.106205310265512 28.136406820341016 27.616380819040952 20.141007050352517 80-84 24.13931144915933 28.34767814251401 26.72137710168134 20.791633306645316 85-89 24.298504476566798 28.18486470264593 27.094483069074176 20.422147751713098 90-94 24.315 27.334999999999997 27.32 21.029999999999998 95-99 23.75 28.835 27.195000000000004 20.22 100-104 24.21 28.060000000000002 27.275 20.455000000000002 105-109 23.965 28.155 27.435 20.445 110-114 24.21 27.71 27.76 20.32 115-119 24.435000000000002 28.470000000000002 26.995 20.1 120-124 24.529999999999998 27.87 27.29 20.31 125-129 24.08 28.365000000000002 27.055 20.5 130-134 24.94 27.965 27.1 19.994999999999997 135-139 24.740000000000002 27.73 27.689999999999998 19.84 140-144 25.095 27.900000000000002 26.775 20.23 145-149 25.1 28.410000000000004 27.02 19.470000000000002 150-151 25.174999999999997 28.037499999999998 26.650000000000002 20.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.0 26 2.0 27 2.5 28 5.5 29 9.5 30 11.0 31 16.0 32 21.0 33 27.0 34 40.0 35 48.0 36 69.5 37 87.0 38 117.5 39 163.0 40 194.0 41 215.5 42 241.5 43 288.0 44 314.0 45 314.5 46 293.0 47 259.0 48 227.0 49 209.5 50 186.0 51 146.5 52 125.0 53 99.5 54 62.0 55 44.0 56 39.5 57 31.5 58 22.0 59 15.5 60 13.5 61 10.0 62 5.0 63 4.5 64 6.5 65 5.0 66 1.5 67 0.5 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.575 3 0.5499999999999999 4 0.575 5 0.575 6 0.44999999999999996 7 0.5 8 0.575 9 0.7250000000000001 10-14 0.65 15-19 0.025 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.08 85-89 0.034999999999999996 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.15 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.65 0.0 0.0 0.0 0.0 124-125 3.0250000000000004 0.0 0.0 0.0 0.0 126-127 3.3499999999999996 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 4.075 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.6375 0.0 0.0 0.0 0.0 136-137 5.15 0.0 0.0 0.0 0.0 138-139 5.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAAAT 10 0.006830828 145.0 1 >>END_MODULE Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698572 spots for SRR7180129.sra Written 698572 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra Read 698559 spots for SRR7180129.sra Written 698559 spots for SRR7180129.sra SRR ids: ['SRR7180129.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fo7o2m4k SRR7180129.sra spots: 13971193 blocks: [[1, 698559], [698560, 1397118], [1397119, 2095677], [2095678, 2794236], [2794237, 3492795], [3492796, 4191354], [4191355, 4889913], [4889914, 5588472], [5588473, 6287031], [6287032, 6985590], [6985591, 7684149], [7684150, 8382708], [8382709, 9081267], [9081268, 9779826], [9779827, 10478385], [10478386, 11176944], [11176945, 11875503], [11875504, 12574062], [12574063, 13272621], [13272622, 13971193]] SRR7180129 file size 4712678 SRR7180129 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180129 SRR7180129_1.fastq SRR7180129_2.fastq Input file: SRR7180129_1.fastq Paired file: SRR7180129_2.fastq trimmed: SRR7180129-trimmed-pair1.fastq, SRR7180129-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:08:16 2025 >> started Mon Feb 10 21:08:32 2025 >> done (15.297s) 13971193 read pairs processed; of these: 14010 ( 0.10%) short read pairs filtered out after trimming by size control 10728 ( 0.08%) empty read pairs filtered out after trimming by size control 13946455 (99.82%) read pairs available; of these: 6952111 (49.85%) trimmed read pairs available after processing 6994344 (50.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 6 0.00% 26 3 0.00% 27 0 0.00% 28 2 0.00% 29 3 0.00% 30 1 0.00% 31 1 0.00% 32 2 0.00% 33 2 0.00% 34 4 0.00% 35 1 0.00% 36 2 0.00% 37 0 0.00% 38 3 0.00% 39 5 0.00% 40 2 0.00% 41 4 0.00% 42 7 0.00% 43 13 0.00% 44 6 0.00% 45 8 0.00% 46 9 0.00% 47 3 0.00% 48 13 0.00% 49 9 0.00% 50 11 0.00% 51 19 0.00% 52 20 0.00% 53 22 0.00% 54 25 0.00% 55 23 0.00% 56 28 0.00% 57 24 0.00% 58 32 0.00% 59 41 0.00% 60 67 0.00% 61 61 0.00% 62 73 0.00% 63 98 0.00% 64 92 0.00% 65 86 0.00% 66 143 0.00% 67 149 0.00% 68 157 0.00% 69 209 0.00% 70 210 0.00% 71 310 0.00% 72 342 0.00% 73 342 0.00% 74 423 0.00% 75 468 0.00% 76 552 0.00% 77 647 0.00% 78 742 0.01% 79 822 0.01% 80 857 0.01% 81 1113 0.01% 82 1250 0.01% 83 1524 0.01% 84 2209 0.02% 85 2809 0.02% 86 3021 0.02% 87 3293 0.02% 88 3437 0.02% 89 3680 0.03% 90 3911 0.03% 91 4289 0.03% 92 4413 0.03% 93 4834 0.03% 94 5444 0.04% 95 5699 0.04% 96 6102 0.04% 97 6671 0.05% 98 7224 0.05% 99 7759 0.06% 100 8278 0.06% 101 8797 0.06% 102 9545 0.07% 103 10226 0.07% 104 10872 0.08% 105 11542 0.08% 106 12404 0.09% 107 13198 0.09% 108 13875 0.10% 109 14837 0.11% 110 15883 0.11% 111 16793 0.12% 112 17219 0.12% 113 17990 0.13% 114 19360 0.14% 115 20195 0.14% 116 21348 0.15% 117 22484 0.16% 118 23863 0.17% 119 24545 0.18% 120 25610 0.18% 121 27352 0.20% 122 28149 0.20% 123 29883 0.21% 124 30810 0.22% 125 32577 0.23% 126 33836 0.24% 127 35619 0.26% 128 37115 0.27% 129 39332 0.28% 130 40886 0.29% 131 42920 0.31% 132 45514 0.33% 133 48074 0.34% 134 50098 0.36% 135 52859 0.38% 136 56080 0.40% 137 59266 0.42% 138 63157 0.45% 139 68184 0.49% 140 73958 0.53% 141 80614 0.58% 142 88895 0.64% 143 99613 0.71% 144 116016 0.83% 145 138084 0.99% 146 175360 1.26% 147 266254 1.91% 148 403815 2.90% 149 711702 5.10% 150 3551329 25.46% 151 6994344 50.15% 13946455 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=26 prefix-density=0.39 prefix-fanout=3.1 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=99.80 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=17.9 sequence=TCCACCACCTTGTTTACCACCTGATCCTGATCCTGCTCGAGACCCAGCATAGGAACCCGCTTCAGAGCCCGCGTCAGACCCGCCATTAGAGCTTGAACTGGACCTGGATGAGGATGAAGAGGACGAACTTGACCCGGAACTTGATCCTGAACCAGAACC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=26 prefix-density=0.61 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=100.29 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.1 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGA SRR7180129 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:09:19 Started mapping on | Feb 10 21:09:20 Finished on | Feb 10 21:11:05 Mapping speed, Million of reads per hour | 478.16 Number of input reads | 13946455 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13230259 Uniquely mapped reads % | 94.86% Average mapped length | 294.68 Number of splices: Total | 12815032 Number of splices: Annotated (sjdb) | 12561723 Number of splices: GT/AG | 12615578 Number of splices: GC/AG | 156653 Number of splices: AT/AC | 9766 Number of splices: Non-canonical | 33035 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323895 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 38811 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.44% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 404380 404380 404380 N_multimapping 323895 323895 323895 N_noFeature 338259 13114388 386014 N_ambiguous 132864 536 64509 UnstrandedReadsAssigned:12759136 PositiveStrandReadsAssigned:115335 NegativeStrandReadsAssigned:12779736 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7180129 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180129-trimmed-pair1.fastq SRR7180129-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,946,455 reads, 12,656,864 reads pseudoaligned [quant] estimated average fragment length: 227.479 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR7180129.ke.tsv 34699 SRR7180129.se.tsv 87100 total ==> SRR7180129.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.52 1670 70.3403 Potri.005G024800.1.v4.1 1035 808.521 581 54.2244 Potri.004G059700.1.v4.1 961 734.526 19 1.95189 Potri.007G009000.2.v4.1 1416 1189.52 0 0 Potri.003G141000.2.v4.1 2943 2716.52 661.461 18.3739 Potri.016G087400.1.v4.1 270 79.8724 1027 970.249 Potri.015G069301.1.v4.1 564 339.065 0 0 Potri.010G195200.1.v4.1 1773 1546.52 264.839 12.9222 Potri.012G127500.1.v4.1 977 750.526 8365 841.027 ==> SRR7180129.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 445 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 135 SRR7180129 completed mapping pipeline successfully