Starting /dee2/code/volunteer_pipeline.sh SRR7180130 current disk space = 3057155489792 free memory = 1579508116 SRR7180130 SRAfilesize aa9664b7fb8eb5497009c555c3bef2aa SRR7180130.sra SRR7180130.sra file validated SRR7180130 is paired end SRR7180130 is conventional basespace SRR7180130 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180130_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.365 28.0 18.0 32.0 18.0 33.0 2 27.52975 29.0 25.0 31.0 18.0 33.0 3 29.50775 31.0 28.0 33.0 25.0 33.0 4 32.18575 33.0 32.0 33.0 32.0 33.0 5 32.35525 33.0 33.0 33.0 32.0 34.0 6 36.268 38.0 36.0 38.0 34.0 38.0 7 36.99625 38.0 37.0 38.0 35.0 38.0 8 37.43 38.0 38.0 38.0 37.0 38.0 9 37.46175 38.0 38.0 38.0 37.0 38.0 10-14 37.59705 38.0 38.0 38.0 37.8 38.0 15-19 37.6034 38.0 38.0 38.0 38.0 38.0 20-24 37.58145 38.0 38.0 38.0 38.0 38.0 25-29 37.55125 38.0 38.0 38.0 38.0 38.0 30-34 37.52575 38.0 38.0 38.0 37.8 38.0 35-39 37.47095 38.0 38.0 38.0 37.4 38.0 40-44 37.4363 38.0 38.0 38.0 37.0 38.0 45-49 37.408950000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.39375 38.0 38.0 38.0 37.0 38.0 55-59 37.429899999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.31535 38.0 38.0 38.0 37.0 38.0 65-69 37.257000000000005 38.0 38.0 38.0 36.8 38.0 70-74 37.2207 38.0 38.0 38.0 36.8 38.0 75-79 37.2132 38.0 38.0 38.0 36.2 38.0 80-84 37.101699999999994 38.0 38.0 38.0 36.0 38.0 85-89 37.049949999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.984 38.0 38.0 38.0 36.0 38.0 95-99 36.88745 38.0 38.0 38.0 35.8 38.0 100-104 36.847500000000004 38.0 38.0 38.0 35.4 38.0 105-109 36.78405 38.0 38.0 38.0 35.0 38.0 110-114 36.61455 38.0 38.0 38.0 34.6 38.0 115-119 36.454499999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.335049999999995 38.0 37.8 38.0 34.0 38.0 125-129 36.1738 38.0 37.8 38.0 33.6 38.0 130-134 35.9813 38.0 37.0 38.0 32.8 38.0 135-139 35.7258 38.0 36.4 38.0 31.8 38.0 140-144 35.3284 38.0 36.0 38.0 31.0 38.0 145-149 34.951 38.0 36.0 38.0 29.4 38.0 150-151 32.156 36.5 32.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 2.0 12 0.0 13 0.0 14 2.0 15 2.0 16 1.0 17 0.0 18 0.0 19 3.0 20 0.0 21 2.0 22 2.0 23 4.0 24 5.0 25 7.0 26 8.0 27 19.0 28 13.0 29 24.0 30 27.0 31 46.0 32 50.0 33 89.0 34 135.0 35 229.0 36 646.0 37 2682.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.023622047244093 13.963254593175852 13.070866141732285 41.94225721784777 2 19.05 20.825 38.45 21.675 3 18.825 26.674999999999997 26.474999999999998 28.025 4 22.475 33.375 21.0 23.150000000000002 5 21.8 34.675 24.349999999999998 19.175 6 16.225 36.6 25.825 21.349999999999998 7 12.525 20.200000000000003 46.85 20.424999999999997 8 16.6 22.025 31.75 29.625 9 17.675 22.075 33.225 27.025 10-14 20.115 28.21 26.735 24.94 15-19 19.625 27.384999999999998 28.52 24.47 20-24 19.939999999999998 28.02 28.335 23.705000000000002 25-29 19.885 28.515 27.62 23.98 30-34 19.400000000000002 29.25 27.839999999999996 23.51 35-39 20.150000000000002 27.48 28.84 23.53 40-44 19.885 28.605000000000004 27.765 23.745 45-49 20.195 27.584999999999997 28.194999999999997 24.025 50-54 20.055 28.215 27.985 23.745 55-59 19.91 27.765 28.16 24.165 60-64 19.52 27.900000000000002 28.63 23.95 65-69 20.265 28.34 28.115000000000002 23.28 70-74 19.965 28.28 27.939999999999998 23.815 75-79 20.525 27.855 28.09 23.53 80-84 20.45 27.889999999999997 27.715 23.945 85-89 20.22 27.82 28.32 23.64 90-94 20.055 28.28 27.305 24.36 95-99 20.244999999999997 28.360000000000003 27.85 23.544999999999998 100-104 19.955000000000002 27.785 28.32 23.94 105-109 19.869999999999997 28.575 27.85 23.705000000000002 110-114 20.165 28.27 27.944999999999997 23.62 115-119 20.36 28.310000000000002 27.634999999999998 23.695 120-124 20.57 28.000000000000004 27.77 23.66 125-129 20.575 28.050000000000004 27.555000000000003 23.82 130-134 20.57 27.744999999999997 27.405 24.279999999999998 135-139 20.82 27.650000000000002 27.235 24.295 140-144 20.880000000000003 28.194999999999997 27.644999999999996 23.28 145-149 20.365 28.12 27.560000000000002 23.955000000000002 150-151 21.15 27.700000000000003 27.125 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.5 24 2.0 25 1.5 26 4.0 27 5.5 28 5.0 29 9.0 30 13.5 31 18.0 32 28.5 33 36.0 34 45.5 35 63.0 36 81.5 37 108.5 38 139.5 39 155.5 40 189.0 41 239.0 42 266.0 43 269.0 44 260.0 45 284.5 46 292.0 47 257.5 48 237.5 49 220.5 50 193.0 51 155.0 52 110.0 53 79.5 54 63.0 55 47.5 56 35.0 57 23.5 58 17.0 59 10.0 60 5.5 61 6.0 62 4.0 63 3.0 64 3.5 65 3.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.5250000000000004 0.0 0.0 0.0 0.0 128-129 2.65 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.0 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 4.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180130 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180130_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85325 33.0 33.0 34.0 32.0 34.0 2 33.0105 34.0 33.0 34.0 32.0 34.0 3 33.03775 34.0 33.0 34.0 32.0 34.0 4 32.93225 34.0 33.0 34.0 32.0 34.0 5 32.98975 34.0 33.0 34.0 32.0 34.0 6 37.13825 38.0 38.0 38.0 37.0 38.0 7 37.16125 38.0 38.0 38.0 37.0 38.0 8 37.111 38.0 38.0 38.0 37.0 38.0 9 37.16425 38.0 38.0 38.0 37.0 38.0 10-14 37.243449999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.13445 38.0 38.0 38.0 36.8 38.0 20-24 37.075300000000006 38.0 38.0 38.0 36.8 38.0 25-29 37.11024999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.11435 38.0 38.0 38.0 37.0 38.0 35-39 37.04395000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.036199999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.024 38.0 38.0 38.0 36.6 38.0 50-54 37.03825 38.0 38.0 38.0 36.0 38.0 55-59 36.936350000000004 38.0 38.0 38.0 35.8 38.0 60-64 36.8781 38.0 38.0 38.0 35.8 38.0 65-69 36.87785 38.0 38.0 38.0 35.8 38.0 70-74 36.870599999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.827400000000004 38.0 38.0 38.0 35.6 38.0 80-84 36.7632 38.0 38.0 38.0 35.0 38.0 85-89 36.55545 38.0 38.0 38.0 34.4 38.0 90-94 36.54505 38.0 38.0 38.0 34.4 38.0 95-99 36.3664 38.0 38.0 38.0 34.0 38.0 100-104 36.2014 38.0 38.0 38.0 33.8 38.0 105-109 36.13175 38.0 37.8 38.0 33.4 38.0 110-114 36.09955 38.0 37.4 38.0 33.4 38.0 115-119 36.03815 38.0 37.2 38.0 33.2 38.0 120-124 35.889700000000005 38.0 37.0 38.0 32.8 38.0 125-129 35.6728 38.0 36.4 38.0 31.8 38.0 130-134 35.32775 38.0 36.0 38.0 30.2 38.0 135-139 35.067750000000004 38.0 36.0 38.0 28.6 38.0 140-144 34.7321 38.0 35.2 38.0 27.8 38.0 145-149 33.9358 38.0 35.0 38.0 23.2 38.0 150-151 30.650374999999997 36.5 30.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 0.0 5 3.0 6 1.0 7 0.0 8 0.0 9 2.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 5.0 18 2.0 19 4.0 20 3.0 21 4.0 22 5.0 23 8.0 24 12.0 25 9.0 26 18.0 27 21.0 28 34.0 29 25.0 30 47.0 31 55.0 32 69.0 33 89.0 34 137.0 35 244.0 36 610.0 37 2576.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.648973460190284 14.972458688032047 18.903355032548824 33.475212819228844 2 24.524524524524523 21.22122122122122 37.13713713713714 17.117117117117118 3 20.905226306576644 26.906726681670417 31.882970742685675 20.305076269067268 4 24.8 34.0 22.675 18.525 5 24.44944944944945 36.03603603603604 21.646646646646648 17.86786786786787 6 18.459229614807406 37.59379689844922 24.087043521760883 19.85992996498249 7 18.70305458187281 16.524787180771156 43.86579869804707 20.906359539308962 8 20.375 23.549999999999997 28.675 27.400000000000002 9 21.56617463097323 24.31823867900926 30.122591943957964 23.992994746059544 10-14 22.869999999999997 28.285 26.115 22.73 15-19 23.047285464098074 27.235426569927444 28.07605704278209 21.641230923192396 20-24 23.038012720989634 27.785846646967492 27.720739219712527 21.455401412330342 25-29 22.5751503006012 28.20140280561122 27.970941883767537 21.25250501002004 30-34 22.576281376822486 28.02745628538504 27.812014629991484 21.58424770780099 35-39 23.225741780272653 28.443263833199676 27.450882117080994 20.88011226944667 40-44 22.792422571915406 27.533326651297983 28.239951889345495 21.434298887441113 45-49 23.249874812218327 28.367551326990487 27.456184276414625 20.926389584376565 50-54 22.966818477553677 28.226815474700967 28.02662529402933 20.77974075371603 55-59 23.758563784567684 27.774166124918736 28.10921638245737 20.358053708056207 60-64 23.563534530179528 27.93919087863179 27.664149622443368 20.833124968745313 65-69 23.326166308315415 27.821391069553474 28.24641232061603 20.606030301515077 70-74 23.555 28.165000000000003 27.36 20.919999999999998 75-79 23.419999999999998 28.21 27.62 20.75 80-84 23.49 27.35 28.294999999999998 20.865000000000002 85-89 23.515 28.21 27.639999999999997 20.635 90-94 23.330000000000002 27.6 28.244999999999997 20.825 95-99 23.055 28.52 27.560000000000002 20.865000000000002 100-104 23.494999999999997 28.615000000000002 27.355 20.535 105-109 23.91 27.750000000000004 28.084999999999997 20.255000000000003 110-114 23.605 28.01 27.169999999999998 21.215 115-119 23.735 28.32 27.24 20.705000000000002 120-124 23.585 28.255000000000003 27.58 20.580000000000002 125-129 23.94 28.275 27.345000000000002 20.44 130-134 24.310000000000002 27.85 27.689999999999998 20.150000000000002 135-139 24.79 27.884999999999998 27.36 19.965 140-144 25.145 28.389999999999997 26.96 19.505 145-149 25.16 27.939999999999998 27.155 19.744999999999997 150-151 24.65924721770664 27.960485181943227 26.897586594973117 20.482681005377014 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 3.0 23 2.0 24 1.0 25 1.5 26 3.5 27 4.5 28 6.0 29 6.5 30 7.5 31 13.5 32 17.0 33 22.0 34 31.5 35 47.5 36 70.0 37 97.0 38 135.5 39 174.0 40 195.5 41 239.5 42 283.0 43 275.0 44 267.0 45 303.0 46 307.5 47 264.5 48 245.0 49 219.5 50 175.5 51 143.0 52 115.5 53 90.0 54 61.0 55 38.0 56 32.0 57 27.0 58 20.0 59 14.5 60 12.5 61 7.5 62 3.0 63 3.5 64 3.0 65 1.5 66 2.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.1 3 0.025 4 0.0 5 0.1 6 0.05 7 0.15 8 0.0 9 0.075 10-14 0.0 15-19 0.075 20-24 0.165 25-29 0.2 30-34 0.20500000000000002 35-39 0.24 40-44 0.22999999999999998 45-49 0.15 50-54 0.095 55-59 0.015 60-64 0.015 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.1375000000000002 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.0 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.6500000000000004 0.0 0.0 0.0 0.0 138-139 3.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCAAT 10 0.006830828 145.0 1 >>END_MODULE Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863418 spots for SRR7180130.sra Written 863418 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra Read 863406 spots for SRR7180130.sra Written 863406 spots for SRR7180130.sra SRR ids: ['SRR7180130.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__pyx_34n SRR7180130.sra spots: 17268132 blocks: [[1, 863406], [863407, 1726812], [1726813, 2590218], [2590219, 3453624], [3453625, 4317030], [4317031, 5180436], [5180437, 6043842], [6043843, 6907248], [6907249, 7770654], [7770655, 8634060], [8634061, 9497466], [9497467, 10360872], [10360873, 11224278], [11224279, 12087684], [12087685, 12951090], [12951091, 13814496], [13814497, 14677902], [14677903, 15541308], [15541309, 16404714], [16404715, 17268132]] SRR7180130 file size 5829902 SRR7180130 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180130 SRR7180130_1.fastq SRR7180130_2.fastq Input file: SRR7180130_1.fastq Paired file: SRR7180130_2.fastq trimmed: SRR7180130-trimmed-pair1.fastq, SRR7180130-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:10:42 2025 >> started Mon Feb 10 22:11:01 2025 >> done (19.309s) 17268132 read pairs processed; of these: 12324 ( 0.07%) short read pairs filtered out after trimming by size control 13791 ( 0.08%) empty read pairs filtered out after trimming by size control 17242017 (99.85%) read pairs available; of these: 6342041 (36.78%) trimmed read pairs available after processing 10899976 (63.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 3 0.00% 21 4 0.00% 22 0 0.00% 23 0 0.00% 24 4 0.00% 25 2 0.00% 26 1 0.00% 27 2 0.00% 28 3 0.00% 29 2 0.00% 30 5 0.00% 31 2 0.00% 32 3 0.00% 33 1 0.00% 34 3 0.00% 35 4 0.00% 36 7 0.00% 37 22 0.00% 38 5 0.00% 39 2 0.00% 40 26 0.00% 41 31 0.00% 42 6 0.00% 43 6 0.00% 44 31 0.00% 45 77 0.00% 46 64 0.00% 47 21 0.00% 48 35 0.00% 49 69 0.00% 50 121 0.00% 51 68 0.00% 52 47 0.00% 53 25 0.00% 54 82 0.00% 55 140 0.00% 56 38 0.00% 57 40 0.00% 58 41 0.00% 59 190 0.00% 60 105 0.00% 61 63 0.00% 62 76 0.00% 63 89 0.00% 64 96 0.00% 65 115 0.00% 66 135 0.00% 67 145 0.00% 68 165 0.00% 69 211 0.00% 70 195 0.00% 71 244 0.00% 72 322 0.00% 73 381 0.00% 74 416 0.00% 75 450 0.00% 76 547 0.00% 77 755 0.00% 78 755 0.00% 79 757 0.00% 80 901 0.01% 81 900 0.01% 82 1103 0.01% 83 1307 0.01% 84 2004 0.01% 85 2540 0.01% 86 2681 0.02% 87 3017 0.02% 88 3306 0.02% 89 3428 0.02% 90 3635 0.02% 91 3904 0.02% 92 4076 0.02% 93 4451 0.03% 94 4766 0.03% 95 5063 0.03% 96 5555 0.03% 97 6002 0.03% 98 6381 0.04% 99 6766 0.04% 100 7241 0.04% 101 7858 0.05% 102 8227 0.05% 103 8875 0.05% 104 9384 0.05% 105 9906 0.06% 106 10997 0.06% 107 11628 0.07% 108 12215 0.07% 109 13053 0.08% 110 13645 0.08% 111 14359 0.08% 112 15118 0.09% 113 16130 0.09% 114 16857 0.10% 115 17843 0.10% 116 18696 0.11% 117 19983 0.12% 118 20813 0.12% 119 22678 0.13% 120 22972 0.13% 121 25053 0.15% 122 25817 0.15% 123 26328 0.15% 124 27590 0.16% 125 28532 0.17% 126 30198 0.18% 127 31365 0.18% 128 32972 0.19% 129 34704 0.20% 130 36205 0.21% 131 38443 0.22% 132 40061 0.23% 133 42205 0.24% 134 45071 0.26% 135 47254 0.27% 136 50129 0.29% 137 53314 0.31% 138 56745 0.33% 139 61317 0.36% 140 65766 0.38% 141 71083 0.41% 142 78827 0.46% 143 88350 0.51% 144 101190 0.59% 145 119766 0.69% 146 147470 0.86% 147 195712 1.14% 148 299229 1.74% 149 590299 3.42% 150 3473526 20.15% 151 10899976 63.22% 17242017 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.73 fanout-score-rank=15 prefix-density=0.37 prefix-fanout=3.4 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=32.54 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.3 sequence=GATATCATAATGACTGAAAAACATCTTACATTGCTTAATCAAACACACGCTAGCTCGCTTATAAGCGCCCCTAGTTAAGGGAAACCTTTATTTAATAAAGTCACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACCATTGTCATAAGATGTA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.2 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=87.56 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.9 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7180130 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:11:48 Started mapping on | Feb 10 22:11:48 Finished on | Feb 10 22:14:24 Mapping speed, Million of reads per hour | 397.89 Number of input reads | 17242017 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16182618 Uniquely mapped reads % | 93.86% Average mapped length | 296.65 Number of splices: Total | 16653062 Number of splices: Annotated (sjdb) | 16361098 Number of splices: GT/AG | 16394006 Number of splices: GC/AG | 210781 Number of splices: AT/AC | 12116 Number of splices: Non-canonical | 36159 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409607 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 34447 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 660713 660713 660713 N_multimapping 409607 409607 409607 N_noFeature 338047 16045418 393258 N_ambiguous 157569 628 75248 UnstrandedReadsAssigned:15687002 PositiveStrandReadsAssigned:136572 NegativeStrandReadsAssigned:15714112 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180130 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180130-trimmed-pair1.fastq SRR7180130-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,242,017 reads, 15,621,623 reads pseudoaligned [quant] estimated average fragment length: 249.514 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7180130.ke.tsv 34699 SRR7180130.se.tsv 87100 total ==> SRR7180130.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.49 1263 45.4137 Potri.005G024800.1.v4.1 1035 786.486 231 18.6875 Potri.004G059700.1.v4.1 961 712.521 16 1.42874 Potri.007G009000.2.v4.1 1416 1167.49 0 0 Potri.003G141000.2.v4.1 2943 2694.49 672 15.8681 Potri.016G087400.1.v4.1 270 74.7089 1039 884.86 Potri.015G069301.1.v4.1 564 320.177 0 0 Potri.010G195200.1.v4.1 1773 1524.49 272 11.3521 Potri.012G127500.1.v4.1 977 728.516 4046 353.361 ==> SRR7180130.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 66 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 517 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 271 SRR7180130 completed mapping pipeline successfully