Starting /dee2/code/volunteer_pipeline.sh SRR7180131 current disk space = 3056932343808 free memory = 1251856508 SRR7180131 SRAfilesize aa54f3337c0a76835b2e04df31fff4d2 SRR7180131.sra SRR7180131.sra file validated SRR7180131 is paired end SRR7180131 is conventional basespace SRR7180131 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180131_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47125 33.0 33.0 34.0 32.0 34.0 2 29.7005 31.0 28.0 33.0 18.0 33.0 3 31.88925 33.0 31.0 33.0 29.0 33.0 4 32.595 33.0 33.0 33.0 31.0 34.0 5 32.771 33.0 33.0 34.0 31.0 34.0 6 36.594 38.0 37.0 38.0 34.0 38.0 7 36.996 38.0 37.0 38.0 35.0 38.0 8 37.41575 38.0 38.0 38.0 36.0 38.0 9 37.6025 38.0 38.0 38.0 37.0 38.0 10-14 37.623599999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.651650000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.661500000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.64465 38.0 38.0 38.0 38.0 38.0 30-34 37.636649999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.61565 38.0 38.0 38.0 38.0 38.0 40-44 37.597 38.0 38.0 38.0 38.0 38.0 45-49 37.5553 38.0 38.0 38.0 38.0 38.0 50-54 37.513349999999996 38.0 38.0 38.0 38.0 38.0 55-59 37.4955 38.0 38.0 38.0 37.6 38.0 60-64 37.47580000000001 38.0 38.0 38.0 37.6 38.0 65-69 37.4036 38.0 38.0 38.0 37.0 38.0 70-74 37.35435 38.0 38.0 38.0 37.0 38.0 75-79 37.357 38.0 38.0 38.0 37.0 38.0 80-84 37.291650000000004 38.0 38.0 38.0 37.0 38.0 85-89 37.21945 38.0 38.0 38.0 36.6 38.0 90-94 37.2191 38.0 38.0 38.0 36.8 38.0 95-99 37.16015 38.0 38.0 38.0 36.2 38.0 100-104 37.0339 38.0 38.0 38.0 36.0 38.0 105-109 36.8938 38.0 38.0 38.0 35.4 38.0 110-114 36.856199999999994 38.0 38.0 38.0 35.4 38.0 115-119 36.7744 38.0 38.0 38.0 35.0 38.0 120-124 36.7093 38.0 38.0 38.0 34.8 38.0 125-129 36.5957 38.0 38.0 38.0 34.8 38.0 130-134 36.26185 38.0 38.0 38.0 33.8 38.0 135-139 36.086850000000005 38.0 37.8 38.0 33.2 38.0 140-144 36.029849999999996 38.0 37.6 38.0 33.4 38.0 145-149 35.611599999999996 38.0 36.8 38.0 32.6 38.0 150-151 32.762625 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 2.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 2.0 21 2.0 22 3.0 23 3.0 24 5.0 25 4.0 26 12.0 27 6.0 28 14.0 29 29.0 30 16.0 31 33.0 32 41.0 33 54.0 34 81.0 35 180.0 36 438.0 37 3068.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.572063824221814 14.569709652105676 12.24169500392362 41.61653151974889 2 20.05 18.9 34.475 26.575 3 18.2 24.55 24.224999999999998 33.025 4 23.0 30.825000000000003 21.575 24.6 5 22.525000000000002 32.4 24.3 20.775 6 18.099999999999998 35.15 25.8 20.95 7 13.900000000000002 22.75 42.625 20.724999999999998 8 17.175 23.75 30.625000000000004 28.449999999999996 9 18.05 24.125 32.6 25.224999999999998 10-14 19.950000000000003 28.449999999999996 27.325 24.275 15-19 19.71 27.860000000000003 27.99 24.44 20-24 19.975 28.435 28.175 23.415 25-29 19.805 28.595 27.834999999999997 23.765 30-34 19.36 28.1 27.894999999999996 24.645 35-39 19.835 28.199999999999996 27.315 24.65 40-44 20.16 28.12 28.005000000000003 23.715 45-49 19.555 28.08 27.57 24.795 50-54 20.575 28.275 27.66 23.49 55-59 20.200000000000003 27.775 28.105000000000004 23.919999999999998 60-64 19.634999999999998 29.235 27.49 23.64 65-69 20.07 28.065 27.355 24.51 70-74 20.27 28.08 27.67 23.98 75-79 20.47 27.765 27.48 24.285 80-84 20.405 27.955000000000002 27.095000000000002 24.545 85-89 20.7 28.24 27.62 23.44 90-94 20.445 27.529999999999998 27.765 24.26 95-99 20.325 27.775 27.860000000000003 24.04 100-104 20.47 28.060000000000002 27.46 24.01 105-109 20.61 28.305000000000003 27.639999999999997 23.445 110-114 20.424999999999997 27.92 27.115000000000002 24.54 115-119 20.895 28.494999999999997 26.974999999999998 23.635 120-124 20.96 28.439999999999998 26.815 23.785 125-129 20.775 28.375 26.945000000000004 23.905 130-134 21.13 28.470000000000002 26.955000000000002 23.445 135-139 21.085 28.610000000000003 26.640000000000004 23.665 140-144 20.86 27.950000000000003 26.939999999999998 24.25 145-149 21.08 27.775 27.334999999999997 23.810000000000002 150-151 19.925 27.750000000000004 27.1625 25.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 2.5 25 4.0 26 3.5 27 5.5 28 10.0 29 9.0 30 9.0 31 17.5 32 30.5 33 41.0 34 43.0 35 52.5 36 72.5 37 111.5 38 137.5 39 151.0 40 177.0 41 198.5 42 224.0 43 261.0 44 282.0 45 264.5 46 258.5 47 282.5 48 265.0 49 217.0 50 184.0 51 164.5 52 140.0 53 104.0 54 79.5 55 54.0 56 34.0 57 26.0 58 19.5 59 15.0 60 10.0 61 6.0 62 6.5 63 5.0 64 2.5 65 2.5 66 3.0 67 1.0 68 1.5 69 2.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0125 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0125 0.0 0.0 0.025 0.0 78-79 0.037500000000000006 0.0 0.0 0.025 0.0 80-81 0.07500000000000001 0.0 0.0 0.025 0.0 82-83 0.125 0.0 0.0 0.025 0.0 84-85 0.1375 0.0 0.0 0.025 0.0 86-87 0.175 0.0 0.0 0.025 0.0 88-89 0.21250000000000002 0.0 0.0 0.025 0.0 90-91 0.25 0.0 0.0 0.025 0.0 92-93 0.275 0.0 0.0 0.025 0.0 94-95 0.275 0.0 0.0 0.025 0.0 96-97 0.275 0.0 0.0 0.025 0.0 98-99 0.35 0.0 0.0 0.025 0.0 100-101 0.45 0.0 0.0 0.025 0.0 102-103 0.55 0.0 0.0 0.025 0.0 104-105 0.6375 0.0 0.0 0.025 0.0 106-107 0.75 0.0 0.0 0.025 0.0 108-109 0.925 0.0 0.0 0.025 0.0 110-111 1.0375 0.0 0.0 0.025 0.0 112-113 1.25 0.0 0.0 0.025 0.0 114-115 1.65 0.0 0.0 0.025 0.0 116-117 2.0 0.0 0.0 0.025 0.0 118-119 2.3499999999999996 0.0 0.0 0.025 0.0 120-121 2.6375 0.0 0.0 0.025 0.0 122-123 2.95 0.0 0.0 0.025 0.0 124-125 3.4875 0.0 0.0 0.025 0.0 126-127 3.9625000000000004 0.0 0.0 0.025 0.0 128-129 4.425 0.0 0.0 0.025 0.0 130-131 4.9 0.0 0.0 0.025 0.0 132-133 5.2125 0.0 0.0 0.025 0.0 134-135 5.625 0.0 0.0 0.025 0.0 136-137 6.0625 0.0 0.0 0.025 0.0 138-139 6.7375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCTCTA 10 0.0068343505 144.975 4 TTCCACT 10 0.0068343505 144.975 2 GATCATT 10 0.0068343505 144.975 8 >>END_MODULE SRR7180131 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180131_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.122 33.0 33.0 34.0 33.0 34.0 2 33.218 34.0 33.0 34.0 33.0 34.0 3 33.19975 34.0 33.0 34.0 33.0 34.0 4 33.177 34.0 33.0 34.0 33.0 34.0 5 33.18725 34.0 33.0 34.0 33.0 34.0 6 37.40325 38.0 38.0 38.0 38.0 38.0 7 37.394 38.0 38.0 38.0 38.0 38.0 8 37.25775 38.0 38.0 38.0 37.0 38.0 9 37.254 38.0 38.0 38.0 37.0 38.0 10-14 37.33215 38.0 38.0 38.0 37.4 38.0 15-19 37.285900000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.253699999999995 38.0 38.0 38.0 37.2 38.0 25-29 37.273700000000005 38.0 38.0 38.0 37.4 38.0 30-34 37.2351 38.0 38.0 38.0 37.2 38.0 35-39 37.18444999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.12140000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.15495 38.0 38.0 38.0 37.0 38.0 50-54 37.10875 38.0 38.0 38.0 37.0 38.0 55-59 37.06464999999999 38.0 38.0 38.0 36.4 38.0 60-64 37.02815 38.0 38.0 38.0 36.2 38.0 65-69 36.940000000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.9268 38.0 38.0 38.0 36.0 38.0 75-79 36.92015 38.0 38.0 38.0 36.0 38.0 80-84 36.848200000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.7603 38.0 38.0 38.0 35.8 38.0 90-94 36.63605 38.0 38.0 38.0 35.0 38.0 95-99 36.5563 38.0 38.0 38.0 34.4 38.0 100-104 36.30765 38.0 38.0 38.0 34.0 38.0 105-109 36.204750000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.163050000000005 38.0 38.0 38.0 33.8 38.0 115-119 36.03085 38.0 37.8 38.0 33.4 38.0 120-124 35.7387 38.0 37.0 38.0 32.2 38.0 125-129 35.6144 38.0 36.8 38.0 31.2 38.0 130-134 35.22709999999999 38.0 36.0 38.0 29.4 38.0 135-139 35.0041 38.0 35.8 38.0 29.8 38.0 140-144 34.48055 38.0 35.0 38.0 26.8 38.0 145-149 33.92985 38.0 35.0 38.0 23.6 38.0 150-151 30.249875 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 0.0 15 3.0 16 4.0 17 1.0 18 4.0 19 6.0 20 8.0 21 6.0 22 1.0 23 5.0 24 12.0 25 16.0 26 19.0 27 15.0 28 28.0 29 19.0 30 39.0 31 38.0 32 64.0 33 86.0 34 131.0 35 239.0 36 567.0 37 2670.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.95 15.65 19.325 31.075000000000003 2 24.175 22.25 35.575 18.0 3 21.75 25.35 31.275 21.625 4 24.7 33.300000000000004 21.725 20.275000000000002 5 25.624999999999996 36.025 21.349999999999998 17.0 6 19.400000000000002 36.35 24.05 20.200000000000003 7 19.225 17.724999999999998 41.3 21.75 8 22.650000000000002 23.275000000000002 26.85 27.224999999999998 9 22.575 24.9 28.125 24.4 10-14 23.865 28.49 25.745 21.9 15-19 22.189999999999998 28.605000000000004 27.51 21.695 20-24 23.321996598979695 28.463539061718517 27.368210463138944 20.846253876162848 25-29 23.243243243243246 28.273273273273276 27.45745745745746 21.026026026026027 30-34 22.992992992992995 28.583583583583582 27.38238238238238 21.04104104104104 35-39 23.35452224836078 28.675108864307525 27.0534060763802 20.9169628109515 40-44 23.600961057162877 27.7305035539093 27.850635699269194 20.817899689658624 45-49 23.303642914331466 28.032425940752603 27.677141713370695 20.986789431545237 50-54 24.17225167550265 27.728318495548663 27.62328698609583 20.476142842852855 55-59 23.798569785467823 27.53413011951793 27.619142871430714 21.048157223583537 60-64 24.0498099619924 27.635527105421083 27.140428085617124 21.174234846969394 65-69 23.738560784117617 27.944191628744314 27.56413462019303 20.753112966945043 70-74 24.72870930639596 27.40911136670501 27.644146621993297 20.218032704905735 75-79 23.946197309865493 28.171408570428518 27.166358317915893 20.71603580179009 80-84 24.188628294244136 27.544131619742963 27.359103865579836 20.908136220433065 85-89 24.02 27.775 27.384999999999998 20.82 90-94 24.104999999999997 28.110000000000003 26.755000000000003 21.029999999999998 95-99 23.905 27.765 27.67 20.66 100-104 24.315 27.794999999999998 27.315 20.575 105-109 24.104999999999997 28.34 27.495000000000005 20.06 110-114 24.095 28.255000000000003 27.18 20.47 115-119 24.395 27.944999999999997 27.1 20.560000000000002 120-124 25.014999999999997 27.41 27.02 20.555 125-129 24.556227811390567 27.541377068853446 27.396369818490925 20.506025301265062 130-134 24.833725058758812 27.459118867830174 27.604140621093165 20.103015452317848 135-139 25.28 27.889999999999997 26.784999999999997 20.044999999999998 140-144 25.14 27.325 27.700000000000003 19.835 145-149 25.805 27.634999999999998 27.310000000000002 19.25 150-151 25.43475541098461 28.074565244589017 26.56074064806706 19.929938696359315 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 2.5 25 1.5 26 2.5 27 2.5 28 2.0 29 5.5 30 5.0 31 6.0 32 11.0 33 21.5 34 34.0 35 45.0 36 67.5 37 86.0 38 105.0 39 146.5 40 191.5 41 235.5 42 276.0 43 308.0 44 308.5 45 290.0 46 273.0 47 253.0 48 230.0 49 211.5 50 202.5 51 167.5 52 125.5 53 100.0 54 76.5 55 54.5 56 41.0 57 29.5 58 18.0 59 12.0 60 10.5 61 9.5 62 6.0 63 5.0 64 5.5 65 3.0 66 2.0 67 1.5 68 1.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.1 30-34 0.1 35-39 0.105 40-44 0.11 45-49 0.08 50-54 0.03 55-59 0.015 60-64 0.02 65-69 0.015 70-74 0.015 75-79 0.005 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6625000000000001 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.3499999999999996 0.0 0.0 0.0 0.0 120-121 2.65 0.0 0.0 0.0 0.0 122-123 2.9875 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.9 0.0 0.0 0.0 0.0 128-129 4.3125 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.5 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGAAG 10 0.006830828 145.0 8 AGTTCAA 10 0.006830828 145.0 5 CTTCCCT 10 0.006830828 145.0 6 >>END_MODULE Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749309 spots for SRR7180131.sra Written 749309 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra Read 749308 spots for SRR7180131.sra Written 749308 spots for SRR7180131.sra SRR ids: ['SRR7180131.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g6m8y9ds SRR7180131.sra spots: 14986161 blocks: [[1, 749308], [749309, 1498616], [1498617, 2247924], [2247925, 2997232], [2997233, 3746540], [3746541, 4495848], [4495849, 5245156], [5245157, 5994464], [5994465, 6743772], [6743773, 7493080], [7493081, 8242388], [8242389, 8991696], [8991697, 9741004], [9741005, 10490312], [10490313, 11239620], [11239621, 11988928], [11988929, 12738236], [12738237, 13487544], [13487545, 14236852], [14236853, 14986161]] SRR7180131 file size 5056617 SRR7180131 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180131 SRR7180131_1.fastq SRR7180131_2.fastq Input file: SRR7180131_1.fastq Paired file: SRR7180131_2.fastq trimmed: SRR7180131-trimmed-pair1.fastq, SRR7180131-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:30:22 2025 >> started Mon Feb 10 21:30:38 2025 >> done (16.102s) 14986161 read pairs processed; of these: 19670 ( 0.13%) short read pairs filtered out after trimming by size control 11496 ( 0.08%) empty read pairs filtered out after trimming by size control 14954995 (99.79%) read pairs available; of these: 5516749 (36.89%) trimmed read pairs available after processing 9438246 (63.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 5 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 4 0.00% 28 4 0.00% 29 5 0.00% 30 2 0.00% 31 2 0.00% 32 6 0.00% 33 1 0.00% 34 4 0.00% 35 5 0.00% 36 15 0.00% 37 18 0.00% 38 6 0.00% 39 5 0.00% 40 19 0.00% 41 22 0.00% 42 11 0.00% 43 7 0.00% 44 7 0.00% 45 35 0.00% 46 45 0.00% 47 63 0.00% 48 41 0.00% 49 49 0.00% 50 42 0.00% 51 98 0.00% 52 28 0.00% 53 32 0.00% 54 51 0.00% 55 94 0.00% 56 43 0.00% 57 46 0.00% 58 51 0.00% 59 72 0.00% 60 77 0.00% 61 75 0.00% 62 93 0.00% 63 112 0.00% 64 114 0.00% 65 134 0.00% 66 168 0.00% 67 171 0.00% 68 215 0.00% 69 245 0.00% 70 286 0.00% 71 352 0.00% 72 396 0.00% 73 439 0.00% 74 555 0.00% 75 663 0.00% 76 756 0.01% 77 862 0.01% 78 951 0.01% 79 1079 0.01% 80 1272 0.01% 81 1447 0.01% 82 1640 0.01% 83 1907 0.01% 84 2977 0.02% 85 3977 0.03% 86 4124 0.03% 87 4439 0.03% 88 4767 0.03% 89 5021 0.03% 90 5314 0.04% 91 5679 0.04% 92 6136 0.04% 93 6533 0.04% 94 7059 0.05% 95 7406 0.05% 96 8072 0.05% 97 8684 0.06% 98 9367 0.06% 99 9969 0.07% 100 10548 0.07% 101 11268 0.08% 102 11597 0.08% 103 12488 0.08% 104 13311 0.09% 105 14102 0.09% 106 15336 0.10% 107 16452 0.11% 108 17116 0.11% 109 18071 0.12% 110 19043 0.13% 111 20180 0.13% 112 21192 0.14% 113 22308 0.15% 114 23362 0.16% 115 24491 0.16% 116 25565 0.17% 117 26975 0.18% 118 28444 0.19% 119 30249 0.20% 120 30619 0.20% 121 33429 0.22% 122 34170 0.23% 123 34674 0.23% 124 36233 0.24% 125 36735 0.25% 126 38706 0.26% 127 40218 0.27% 128 41458 0.28% 129 43431 0.29% 130 45203 0.30% 131 46775 0.31% 132 48875 0.33% 133 50566 0.34% 134 52944 0.35% 135 54837 0.37% 136 57494 0.38% 137 59395 0.40% 138 62674 0.42% 139 66497 0.44% 140 69236 0.46% 141 73972 0.49% 142 80342 0.54% 143 86140 0.58% 144 94874 0.63% 145 106051 0.71% 146 123721 0.83% 147 154059 1.03% 148 217576 1.45% 149 416381 2.78% 150 2682884 17.94% 151 9438246 63.11% 14954995 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=25 prefix-density=0.88 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=47.54 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=7.6 sequence=ATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAG criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=27 prefix-density=0.82 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=68.30 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.5 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7180131 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:31:24 Started mapping on | Feb 10 21:31:24 Finished on | Feb 10 21:33:10 Mapping speed, Million of reads per hour | 507.91 Number of input reads | 14954995 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14058213 Uniquely mapped reads % | 94.00% Average mapped length | 294.70 Number of splices: Total | 14223614 Number of splices: Annotated (sjdb) | 13969023 Number of splices: GT/AG | 14000139 Number of splices: GC/AG | 176547 Number of splices: AT/AC | 11700 Number of splices: Non-canonical | 35228 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 369149 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 46924 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 543630 543630 543630 N_multimapping 369149 369149 369149 N_noFeature 301522 13928962 356577 N_ambiguous 140322 722 65718 UnstrandedReadsAssigned:13616369 PositiveStrandReadsAssigned:128529 NegativeStrandReadsAssigned:13635918 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180131 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180131-trimmed-pair1.fastq SRR7180131-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,954,995 reads, 13,523,714 reads pseudoaligned [quant] estimated average fragment length: 226.489 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52401 SRR7180131.ke.tsv 34699 SRR7180131.se.tsv 87100 total ==> SRR7180131.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.51 1052 38.0897 Potri.005G024800.1.v4.1 1035 809.511 239 19.1615 Potri.004G059700.1.v4.1 961 735.528 23 2.02947 Potri.007G009000.2.v4.1 1416 1190.51 0 0 Potri.003G141000.2.v4.1 2943 2717.51 678 16.1924 Potri.016G087400.1.v4.1 270 82.3966 1374 1082.26 Potri.015G069301.1.v4.1 564 340.497 0 0 Potri.010G195200.1.v4.1 1773 1547.51 460.895 19.3296 Potri.012G127500.1.v4.1 977 751.522 4516 390.001 ==> SRR7180131.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 43 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 429 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 259 SRR7180131 completed mapping pipeline successfully