Starting /dee2/code/volunteer_pipeline.sh SRR7180132 current disk space = 3056942411776 free memory = 1060448532 SRR7180132 SRAfilesize 94ea7d17dd23ae014fc6ba98dc2974a2 SRR7180132.sra SRR7180132.sra file validated SRR7180132 is paired end SRR7180132 is conventional basespace SRR7180132 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180132_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.71925 33.0 27.0 33.0 18.0 34.0 2 31.474 33.0 31.0 33.0 27.0 34.0 3 31.86425 33.0 31.0 33.0 29.0 34.0 4 32.7185 33.0 33.0 34.0 32.0 34.0 5 33.13525 33.0 33.0 34.0 33.0 34.0 6 36.911 38.0 37.0 38.0 35.0 38.0 7 37.1155 38.0 38.0 38.0 35.0 38.0 8 37.49025 38.0 38.0 38.0 37.0 38.0 9 37.63775 38.0 38.0 38.0 38.0 38.0 10-14 37.64444999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.626400000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.64545 38.0 38.0 38.0 38.0 38.0 25-29 37.62675 38.0 38.0 38.0 38.0 38.0 30-34 37.5809 38.0 38.0 38.0 38.0 38.0 35-39 37.545750000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.5331 38.0 38.0 38.0 38.0 38.0 45-49 37.5022 38.0 38.0 38.0 38.0 38.0 50-54 37.447649999999996 38.0 38.0 38.0 37.8 38.0 55-59 37.42425 38.0 38.0 38.0 37.2 38.0 60-64 37.37949999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.27445000000001 38.0 38.0 38.0 37.0 38.0 70-74 37.2682 38.0 38.0 38.0 37.0 38.0 75-79 37.22595 38.0 38.0 38.0 37.0 38.0 80-84 37.1527 38.0 38.0 38.0 36.4 38.0 85-89 37.1233 38.0 38.0 38.0 36.4 38.0 90-94 37.03874999999999 38.0 38.0 38.0 36.0 38.0 95-99 37.0129 38.0 38.0 38.0 36.0 38.0 100-104 36.877849999999995 38.0 38.0 38.0 35.8 38.0 105-109 36.8097 38.0 38.0 38.0 35.4 38.0 110-114 36.6548 38.0 38.0 38.0 34.8 38.0 115-119 36.647149999999996 38.0 38.0 38.0 35.0 38.0 120-124 36.4677 38.0 38.0 38.0 34.0 38.0 125-129 36.464600000000004 38.0 38.0 38.0 34.0 38.0 130-134 36.1978 38.0 38.0 38.0 33.8 38.0 135-139 35.9428 38.0 37.6 38.0 32.8 38.0 140-144 35.685449999999996 38.0 36.8 38.0 32.6 38.0 145-149 35.327799999999996 38.0 36.0 38.0 31.8 38.0 150-151 32.375875 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 3.0 18 1.0 19 0.0 20 2.0 21 1.0 22 3.0 23 4.0 24 7.0 25 9.0 26 6.0 27 10.0 28 21.0 29 21.0 30 22.0 31 40.0 32 52.0 33 59.0 34 96.0 35 171.0 36 493.0 37 2970.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.87147335423197 13.557993730407524 13.349007314524556 34.221525600835946 2 19.900000000000002 18.9 36.55 24.65 3 18.75 23.625 28.375 29.25 4 22.6 30.7 23.625 23.075000000000003 5 21.15 32.725 25.874999999999996 20.25 6 16.683341670835418 36.14307153576789 26.738369184592298 20.4352176088044 7 13.65 25.6 41.65 19.1 8 16.475 25.5 31.674999999999997 26.35 9 16.875 25.825 33.2 24.099999999999998 10-14 19.515 29.310000000000002 27.605 23.57 15-19 19.495 28.51 28.53 23.465 20-24 19.295 28.84 28.189999999999998 23.674999999999997 25-29 19.715 29.68 27.88 22.725 30-34 19.314999999999998 29.37 28.185 23.13 35-39 19.345000000000002 28.735 28.375 23.544999999999998 40-44 19.46 29.205 28.194999999999997 23.14 45-49 19.189999999999998 29.09 28.225 23.494999999999997 50-54 19.61 28.9 27.334999999999997 24.154999999999998 55-59 20.119999999999997 28.705000000000002 27.985 23.189999999999998 60-64 19.555 29.325000000000003 27.315 23.805 65-69 20.005 28.444999999999997 27.99 23.56 70-74 19.98 28.34 28.275 23.405 75-79 19.415 28.285 28.189999999999998 24.11 80-84 19.575 28.54 28.110000000000003 23.775 85-89 20.025000000000002 28.360000000000003 27.61 24.005000000000003 90-94 19.98 28.754999999999995 27.63 23.635 95-99 19.99 27.98 28.27 23.76 100-104 19.935 28.754999999999995 27.58 23.73 105-109 19.91 28.065 28.415000000000003 23.61 110-114 20.06 28.48 27.77 23.69 115-119 20.175 28.18 28.095 23.549999999999997 120-124 19.895 28.505000000000003 27.265 24.335 125-129 20.535 28.565 27.355 23.544999999999998 130-134 20.625 28.144999999999996 27.639999999999997 23.59 135-139 20.349999999999998 28.794999999999998 27.35 23.505000000000003 140-144 20.695 28.215 27.075 24.015 145-149 21.175 28.355000000000004 26.889999999999997 23.580000000000002 150-151 20.978845913130552 28.201276755538867 27.024658905995746 23.795218425334834 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.5 9 1.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 0.5 20 1.0 21 2.5 22 3.5 23 5.5 24 6.0 25 5.5 26 5.0 27 8.5 28 13.5 29 19.5 30 23.0 31 31.5 32 47.0 33 55.5 34 68.5 35 85.5 36 105.5 37 138.0 38 155.5 39 172.5 40 194.0 41 215.5 42 247.5 43 256.5 44 252.5 45 258.5 46 260.5 47 241.0 48 203.5 49 181.5 50 164.0 51 134.0 52 103.5 53 72.5 54 57.0 55 46.0 56 30.5 57 24.0 58 21.5 59 19.5 60 16.0 61 11.5 62 7.5 63 3.0 64 4.0 65 5.0 66 3.0 67 3.0 68 2.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0125 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.05 0.0 0.0 0.025 0.0 92-93 0.075 0.0 0.0 0.025 0.0 94-95 0.1 0.0 0.0 0.025 0.0 96-97 0.1375 0.0 0.0 0.025 0.0 98-99 0.15 0.0 0.0 0.025 0.0 100-101 0.175 0.0 0.0 0.025 0.0 102-103 0.21250000000000002 0.0 0.0 0.025 0.0 104-105 0.3375 0.0 0.0 0.025 0.0 106-107 0.4125 0.0 0.0 0.025 0.0 108-109 0.5625 0.0 0.0 0.025 0.0 110-111 0.725 0.0 0.0 0.025 0.0 112-113 0.825 0.0 0.0 0.025 0.0 114-115 0.9125000000000001 0.0 0.0 0.025 0.0 116-117 1.0375 0.0 0.0 0.025 0.0 118-119 1.2999999999999998 0.0 0.0 0.025 0.0 120-121 1.4625 0.0 0.0 0.025 0.0 122-123 1.7374999999999998 0.0 0.0 0.025 0.0 124-125 2.025 0.0 0.0 0.025 0.0 126-127 2.3625 0.0 0.0 0.025 0.0 128-129 2.6375 0.0 0.0 0.025 0.0 130-131 3.0 0.0 0.0 0.025 0.0 132-133 3.325 0.0 0.0 0.025 0.0 134-135 3.625 0.0 0.0 0.025 0.0 136-137 4.0625 0.0 0.0 0.025 0.0 138-139 4.475 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180132 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180132_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8785 33.0 33.0 34.0 32.0 34.0 2 33.084 34.0 33.0 34.0 33.0 34.0 3 33.13225 34.0 33.0 34.0 33.0 34.0 4 33.1015 34.0 33.0 34.0 33.0 34.0 5 33.0805 34.0 33.0 34.0 33.0 34.0 6 37.18525 38.0 38.0 38.0 37.0 38.0 7 37.21 38.0 38.0 38.0 38.0 38.0 8 37.1925 38.0 38.0 38.0 37.0 38.0 9 37.188 38.0 38.0 38.0 37.0 38.0 10-14 37.205499999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.1599 38.0 38.0 38.0 37.2 38.0 20-24 37.1124 38.0 38.0 38.0 37.0 38.0 25-29 37.12735 38.0 38.0 38.0 37.0 38.0 30-34 37.1123 38.0 38.0 38.0 37.0 38.0 35-39 37.0145 38.0 38.0 38.0 37.0 38.0 40-44 37.02295 38.0 38.0 38.0 37.0 38.0 45-49 37.051 38.0 38.0 38.0 37.0 38.0 50-54 37.02395 38.0 38.0 38.0 37.0 38.0 55-59 37.00605 38.0 38.0 38.0 36.8 38.0 60-64 36.92530000000001 38.0 38.0 38.0 36.2 38.0 65-69 36.82635 38.0 38.0 38.0 36.0 38.0 70-74 36.853049999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.8185 38.0 38.0 38.0 36.0 38.0 80-84 36.665049999999994 38.0 38.0 38.0 35.6 38.0 85-89 36.61135 38.0 38.0 38.0 35.4 38.0 90-94 36.520799999999994 38.0 38.0 38.0 34.8 38.0 95-99 36.5025 38.0 38.0 38.0 34.8 38.0 100-104 36.293600000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.14965 38.0 38.0 38.0 34.0 38.0 110-114 36.082350000000005 38.0 38.0 38.0 34.0 38.0 115-119 35.98775 38.0 38.0 38.0 33.8 38.0 120-124 35.7804 38.0 37.4 38.0 32.8 38.0 125-129 35.4422 38.0 36.6 38.0 30.8 38.0 130-134 35.28145 38.0 36.0 38.0 31.0 38.0 135-139 35.00405000000001 38.0 36.0 38.0 29.8 38.0 140-144 34.58385 38.0 35.4 38.0 27.0 38.0 145-149 34.00865 38.0 35.2 38.0 23.0 38.0 150-151 30.33475 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 7.0 4 2.0 5 2.0 6 0.0 7 2.0 8 1.0 9 1.0 10 2.0 11 3.0 12 2.0 13 0.0 14 6.0 15 1.0 16 1.0 17 4.0 18 7.0 19 2.0 20 4.0 21 10.0 22 6.0 23 8.0 24 8.0 25 10.0 26 18.0 27 16.0 28 24.0 29 18.0 30 38.0 31 35.0 32 64.0 33 85.0 34 112.0 35 205.0 36 536.0 37 2747.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.31455871259743 17.400050289162685 17.726929846618052 27.558461151621827 2 23.573573573573572 24.224224224224226 34.88488488488489 17.31731731731732 3 21.1408556417313 27.545659244433324 30.022516887665752 21.290968226169625 4 23.35 34.849999999999994 22.95 18.85 5 23.549999999999997 35.425000000000004 23.799999999999997 17.224999999999998 6 19.525000000000002 36.575 24.85 19.05 7 18.75 18.775 42.199999999999996 20.275000000000002 8 22.175 23.425 27.85 26.55 9 22.6 25.624999999999996 27.425 24.349999999999998 10-14 23.745 28.345 26.900000000000002 21.01 15-19 23.315 27.735 28.235 20.715 20-24 22.98 28.18 27.750000000000004 21.09 25-29 23.125 28.305000000000003 27.700000000000003 20.87 30-34 23.223128094833193 28.47996798879608 27.54964237483119 20.747261541539537 35-39 23.671038141956153 28.426268895785363 27.204925417959757 20.697767544298728 40-44 24.016418059865853 28.276103714085494 27.25998598458304 20.44749224146561 45-49 23.325000000000003 27.794999999999998 28.189999999999998 20.69 50-54 23.66 27.825 27.595 20.919999999999998 55-59 24.16 27.91 27.73 20.200000000000003 60-64 23.61 27.985 28.04 20.365 65-69 23.625 28.575 27.26 20.54 70-74 23.985 28.28 27.384999999999998 20.349999999999998 75-79 24.044999999999998 28.1 27.275 20.580000000000002 80-84 23.9 28.199999999999996 27.785 20.115 85-89 24.04 27.91 27.57 20.48 90-94 23.755000000000003 28.76 27.97 19.515 95-99 23.715 27.884999999999998 28.48 19.919999999999998 100-104 24.47 27.49 28.17 19.869999999999997 105-109 23.48 28.189999999999998 28.189999999999998 20.14 110-114 23.425 28.01 28.544999999999998 20.02 115-119 23.86 28.375 27.529999999999998 20.235 120-124 24.165 28.055000000000003 27.99 19.79 125-129 23.990000000000002 28.255000000000003 28.065 19.689999999999998 130-134 24.055 28.285 27.46 20.200000000000003 135-139 23.974999999999998 28.315 28.185 19.525000000000002 140-144 24.395 28.544999999999998 27.575 19.485 145-149 24.5 28.49 27.62 19.39 150-151 24.949773982923155 28.013561024610752 27.92566549472627 19.11099949773983 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.0 23 0.5 24 1.5 25 2.0 26 1.5 27 3.0 28 6.5 29 9.0 30 12.5 31 18.5 32 23.0 33 34.0 34 41.5 35 47.0 36 71.5 37 102.5 38 124.0 39 164.5 40 210.5 41 242.5 42 263.5 43 290.0 44 307.0 45 287.5 46 281.5 47 259.0 48 229.5 49 203.5 50 162.5 51 136.0 52 104.0 53 83.5 54 68.5 55 47.5 56 39.0 57 27.5 58 19.5 59 16.5 60 11.5 61 8.5 62 8.5 63 7.0 64 3.5 65 1.5 66 2.5 67 3.0 68 2.0 69 2.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.1 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.034999999999999996 35-39 0.11 40-44 0.11 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2 0.025 0.0 0.0 0.0 100-101 0.225 0.025 0.0 0.0 0.0 102-103 0.2625 0.025 0.0 0.0 0.0 104-105 0.3875 0.025 0.0 0.0 0.0 106-107 0.4625 0.025 0.0 0.0 0.0 108-109 0.6 0.025 0.0 0.0 0.0 110-111 0.75 0.025 0.0 0.0 0.0 112-113 0.875 0.025 0.0 0.0 0.0 114-115 0.9624999999999999 0.025 0.0 0.0 0.0 116-117 1.0875 0.025 0.0 0.0 0.0 118-119 1.3625 0.025 0.0 0.0 0.0 120-121 1.5375 0.025 0.0 0.0 0.0 122-123 1.7875 0.025 0.0 0.0 0.0 124-125 2.1 0.025 0.0 0.0 0.0 126-127 2.4375 0.025 0.0 0.0 0.0 128-129 2.725 0.025 0.0 0.0 0.0 130-131 3.0999999999999996 0.025 0.0 0.0 0.0 132-133 3.45 0.025 0.0 0.0 0.0 134-135 3.7375 0.025 0.0 0.0 0.0 136-137 4.1625 0.025 0.0 0.0 0.0 138-139 4.574999999999999 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675220 spots for SRR7180132.sra Written 675220 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra Read 675205 spots for SRR7180132.sra Written 675205 spots for SRR7180132.sra SRR ids: ['SRR7180132.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wci71h1w SRR7180132.sra spots: 13504115 blocks: [[1, 675205], [675206, 1350410], [1350411, 2025615], [2025616, 2700820], [2700821, 3376025], [3376026, 4051230], [4051231, 4726435], [4726436, 5401640], [5401641, 6076845], [6076846, 6752050], [6752051, 7427255], [7427256, 8102460], [8102461, 8777665], [8777666, 9452870], [9452871, 10128075], [10128076, 10803280], [10803281, 11478485], [11478486, 12153690], [12153691, 12828895], [12828896, 13504115]] SRR7180132 file size 4554401 SRR7180132 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180132 SRR7180132_1.fastq SRR7180132_2.fastq Input file: SRR7180132_1.fastq Paired file: SRR7180132_2.fastq trimmed: SRR7180132-trimmed-pair1.fastq, SRR7180132-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:25:45 2025 >> started Mon Feb 10 21:26:01 2025 >> done (16.161s) 13504115 read pairs processed; of these: 27240 ( 0.20%) short read pairs filtered out after trimming by size control 17559 ( 0.13%) empty read pairs filtered out after trimming by size control 13459316 (99.67%) read pairs available; of these: 4731068 (35.15%) trimmed read pairs available after processing 8728248 (64.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 4 0.00% 22 7 0.00% 23 7 0.00% 24 9 0.00% 25 6 0.00% 26 11 0.00% 27 11 0.00% 28 8 0.00% 29 7 0.00% 30 13 0.00% 31 11 0.00% 32 5 0.00% 33 7 0.00% 34 11 0.00% 35 7 0.00% 36 5 0.00% 37 8 0.00% 38 23 0.00% 39 38 0.00% 40 13 0.00% 41 12 0.00% 42 8 0.00% 43 22 0.00% 44 10 0.00% 45 31 0.00% 46 15 0.00% 47 22 0.00% 48 21 0.00% 49 16 0.00% 50 25 0.00% 51 27 0.00% 52 45 0.00% 53 39 0.00% 54 43 0.00% 55 105 0.00% 56 133 0.00% 57 66 0.00% 58 38 0.00% 59 51 0.00% 60 93 0.00% 61 81 0.00% 62 143 0.00% 63 131 0.00% 64 92 0.00% 65 111 0.00% 66 113 0.00% 67 158 0.00% 68 147 0.00% 69 178 0.00% 70 158 0.00% 71 214 0.00% 72 258 0.00% 73 311 0.00% 74 341 0.00% 75 445 0.00% 76 490 0.00% 77 556 0.00% 78 673 0.01% 79 829 0.01% 80 746 0.01% 81 863 0.01% 82 995 0.01% 83 1123 0.01% 84 2414 0.02% 85 3330 0.02% 86 3520 0.03% 87 4096 0.03% 88 4302 0.03% 89 4245 0.03% 90 4393 0.03% 91 4539 0.03% 92 4771 0.04% 93 4797 0.04% 94 5090 0.04% 95 5258 0.04% 96 5647 0.04% 97 5850 0.04% 98 6278 0.05% 99 6708 0.05% 100 6988 0.05% 101 7459 0.06% 102 7868 0.06% 103 8285 0.06% 104 9014 0.07% 105 9443 0.07% 106 10155 0.08% 107 10644 0.08% 108 11301 0.08% 109 11837 0.09% 110 12521 0.09% 111 13195 0.10% 112 13844 0.10% 113 14602 0.11% 114 15572 0.12% 115 16512 0.12% 116 16931 0.13% 117 18006 0.13% 118 19193 0.14% 119 19882 0.15% 120 21234 0.16% 121 22542 0.17% 122 22034 0.16% 123 22916 0.17% 124 24415 0.18% 125 25523 0.19% 126 26207 0.19% 127 27388 0.20% 128 28535 0.21% 129 29649 0.22% 130 31006 0.23% 131 32441 0.24% 132 33917 0.25% 133 35228 0.26% 134 37109 0.28% 135 39027 0.29% 136 40592 0.30% 137 42563 0.32% 138 45492 0.34% 139 48501 0.36% 140 51521 0.38% 141 55255 0.41% 142 60470 0.45% 143 66447 0.49% 144 75764 0.56% 145 85369 0.63% 146 101569 0.75% 147 132929 0.99% 148 197739 1.47% 149 396036 2.94% 150 2532965 18.82% 151 8728248 64.85% 13459316 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=29 prefix-density=0.70 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=165.03 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.4 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=5.55 fanout-score-rank=17 prefix-density=0.57 prefix-fanout=4.3 sequence=GGTGCTGAGAATGGCTGCAAGTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=109.56 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=11.0 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGA SRR7180132 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:26:53 Started mapping on | Feb 10 21:26:54 Finished on | Feb 10 21:29:13 Mapping speed, Million of reads per hour | 348.59 Number of input reads | 13459316 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12163669 Uniquely mapped reads % | 90.37% Average mapped length | 295.82 Number of splices: Total | 11323855 Number of splices: Annotated (sjdb) | 11067385 Number of splices: GT/AG | 11130764 Number of splices: GC/AG | 144924 Number of splices: AT/AC | 10255 Number of splices: Non-canonical | 37912 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324582 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 42793 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.81% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 997404 997404 997404 N_multimapping 324582 324582 324582 N_noFeature 404835 12019023 469489 N_ambiguous 143724 914 63212 UnstrandedReadsAssigned:11615110 PositiveStrandReadsAssigned:143732 NegativeStrandReadsAssigned:11630968 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180132 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180132-trimmed-pair1.fastq SRR7180132-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,459,316 reads, 11,556,079 reads pseudoaligned [quant] estimated average fragment length: 237.657 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR7180132.ke.tsv 34699 SRR7180132.se.tsv 87100 total ==> SRR7180132.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.34 1410 54.4325 Potri.005G024800.1.v4.1 1035 798.343 306 26.3584 Potri.004G059700.1.v4.1 961 724.348 30 2.84814 Potri.007G009000.2.v4.1 1416 1179.34 0 0 Potri.003G141000.2.v4.1 2943 2706.34 458.257 11.6443 Potri.016G087400.1.v4.1 270 75.0348 1226 1123.61 Potri.015G069301.1.v4.1 564 329.575 0 0 Potri.010G195200.1.v4.1 1773 1536.34 656 29.3631 Potri.012G127500.1.v4.1 977 740.343 12924 1200.47 ==> SRR7180132.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 615 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 348 SRR7180132 completed mapping pipeline successfully