Starting /dee2/code/volunteer_pipeline.sh SRR7180133 current disk space = 3057023676416 free memory = 1262851840 SRR7180133 SRAfilesize 25f6318a398ac11cf4ed37fe89d4ee6c SRR7180133.sra SRR7180133.sra file validated SRR7180133 is paired end SRR7180133 is conventional basespace SRR7180133 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180133_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.71125 18.0 18.0 32.0 18.0 33.0 2 29.77375 31.0 28.0 33.0 27.0 33.0 3 30.97225 32.0 31.0 33.0 27.0 33.0 4 31.909 33.0 31.0 33.0 29.0 33.0 5 32.5685 33.0 33.0 33.0 32.0 34.0 6 36.813 38.0 37.0 38.0 34.0 38.0 7 37.142 38.0 38.0 38.0 36.0 38.0 8 37.435 38.0 38.0 38.0 37.0 38.0 9 37.5085 38.0 38.0 38.0 37.0 38.0 10-14 37.59655 38.0 38.0 38.0 38.0 38.0 15-19 37.568400000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.551950000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.513799999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.529650000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.4627 38.0 38.0 38.0 37.2 38.0 40-44 37.4559 38.0 38.0 38.0 37.0 38.0 45-49 37.4413 38.0 38.0 38.0 37.0 38.0 50-54 37.37820000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.3236 38.0 38.0 38.0 37.0 38.0 60-64 37.28914999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.2285 38.0 38.0 38.0 37.0 38.0 70-74 37.206050000000005 38.0 38.0 38.0 36.6 38.0 75-79 37.196000000000005 38.0 38.0 38.0 36.2 38.0 80-84 37.1363 38.0 38.0 38.0 36.0 38.0 85-89 37.03445000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.9985 38.0 38.0 38.0 36.0 38.0 95-99 36.89795 38.0 38.0 38.0 35.4 38.0 100-104 36.8345 38.0 38.0 38.0 35.0 38.0 105-109 36.764599999999994 38.0 38.0 38.0 35.0 38.0 110-114 36.6275 38.0 38.0 38.0 34.4 38.0 115-119 36.45635 38.0 38.0 38.0 34.0 38.0 120-124 36.3375 38.0 38.0 38.0 34.0 38.0 125-129 36.1462 38.0 37.8 38.0 33.6 38.0 130-134 35.88905 38.0 37.0 38.0 33.0 38.0 135-139 35.729200000000006 38.0 36.2 38.0 32.4 38.0 140-144 35.50515 38.0 36.0 38.0 31.4 38.0 145-149 35.15474999999999 38.0 36.0 38.0 31.0 38.0 150-151 32.256875 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 3.0 18 0.0 19 2.0 20 0.0 21 3.0 22 5.0 23 1.0 24 13.0 25 5.0 26 12.0 27 14.0 28 18.0 29 30.0 30 33.0 31 39.0 32 48.0 33 76.0 34 129.0 35 204.0 36 593.0 37 2767.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.114697252600692 13.843691651106962 13.256868498266206 42.784742598026135 2 19.425 19.225 39.900000000000006 21.45 3 19.8 25.775 26.525 27.900000000000002 4 22.5 33.300000000000004 21.3 22.900000000000002 5 21.349999999999998 34.65 25.874999999999996 18.125 6 17.875 35.225 26.125 20.775 7 12.65 22.925 44.3 20.125 8 18.95 22.8 30.55 27.700000000000003 9 18.825 22.775000000000002 31.55 26.85 10-14 19.615 29.085 27.07 24.23 15-19 20.03 27.450000000000003 27.975 24.545 20-24 19.77 28.455000000000002 27.794999999999998 23.98 25-29 19.705000000000002 28.970000000000002 27.644999999999996 23.68 30-34 19.650000000000002 28.03 28.49 23.830000000000002 35-39 19.66 28.305000000000003 28.285 23.75 40-44 19.905 28.544999999999998 28.065 23.485 45-49 19.3 28.1 28.435 24.165 50-54 19.535 28.48 27.644999999999996 24.34 55-59 19.055 28.365000000000002 28.53 24.05 60-64 19.42 28.28 27.894999999999996 24.404999999999998 65-69 19.915 27.965 27.98 24.14 70-74 19.945 28.235 27.839999999999996 23.98 75-79 20.345 27.83 28.349999999999998 23.474999999999998 80-84 20.11 28.04 28.17 23.68 85-89 20.22 28.475 27.96 23.345 90-94 20.76 28.055000000000003 27.33 23.855 95-99 20.674999999999997 28.189999999999998 28.015 23.119999999999997 100-104 20.244999999999997 27.805000000000003 27.93 24.02 105-109 20.055 28.505000000000003 27.400000000000002 24.04 110-114 20.325 27.685 28.065 23.925 115-119 20.645 27.994999999999997 27.715 23.645 120-124 20.974999999999998 27.884999999999998 27.639999999999997 23.5 125-129 20.335 27.82 28.025 23.82 130-134 20.46 27.834999999999997 27.855 23.849999999999998 135-139 20.865000000000002 27.544999999999998 27.750000000000004 23.84 140-144 20.825 28.035 27.29 23.849999999999998 145-149 20.715 28.535 27.05 23.7 150-151 20.7875 27.437499999999996 27.3 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.5 24 0.5 25 2.0 26 3.0 27 3.0 28 6.5 29 8.5 30 9.0 31 19.0 32 32.5 33 43.0 34 51.5 35 66.5 36 92.0 37 111.5 38 132.0 39 158.0 40 209.5 41 255.0 42 275.0 43 283.0 44 274.5 45 274.0 46 268.0 47 256.0 48 245.5 49 206.5 50 162.0 51 129.5 52 106.5 53 89.5 54 61.5 55 49.5 56 35.5 57 19.5 58 15.0 59 9.5 60 8.0 61 7.5 62 4.5 63 3.5 64 4.5 65 2.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.025 0.025 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.025 0.025 0.0 0.0 0.0 88-89 0.037500000000000006 0.025 0.0 0.0 0.0 90-91 0.0625 0.025 0.0 0.0 0.0 92-93 0.1375 0.025 0.0 0.0 0.0 94-95 0.175 0.025 0.0 0.0 0.0 96-97 0.175 0.025 0.0 0.0 0.0 98-99 0.25 0.025 0.0 0.0 0.0 100-101 0.3 0.025 0.0 0.0 0.0 102-103 0.3375 0.025 0.0 0.0 0.0 104-105 0.4 0.025 0.0 0.0 0.0 106-107 0.525 0.025 0.0 0.0 0.0 108-109 0.65 0.025 0.0 0.0 0.0 110-111 0.7749999999999999 0.025 0.0 0.0 0.0 112-113 1.0125 0.025 0.0 0.0 0.0 114-115 1.225 0.025 0.0 0.0 0.0 116-117 1.4375 0.025 0.0 0.0 0.0 118-119 1.6 0.025 0.0 0.0 0.0 120-121 1.7625000000000002 0.025 0.0 0.0 0.0 122-123 1.8625 0.025 0.0 0.0 0.0 124-125 2.025 0.025 0.0 0.0 0.0 126-127 2.1875 0.025 0.0 0.0 0.0 128-129 2.3875 0.025 0.0 0.0 0.0 130-131 2.6125 0.025 0.0 0.0 0.0 132-133 2.9875 0.025 0.0 0.0 0.0 134-135 3.3625 0.025 0.0 0.0 0.0 136-137 3.6125 0.025 0.0 0.0 0.0 138-139 3.9250000000000003 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTCA 10 0.006841402 144.925 4 AAAGCAC 10 0.006841402 144.925 145 TCACAGC 10 0.006841402 144.925 7 >>END_MODULE SRR7180133 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180133_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79725 33.0 33.0 34.0 32.0 34.0 2 32.91775 33.0 33.0 34.0 32.0 34.0 3 33.05 34.0 33.0 34.0 32.0 34.0 4 32.98025 34.0 33.0 34.0 32.0 34.0 5 32.936 34.0 33.0 34.0 32.0 34.0 6 37.16475 38.0 38.0 38.0 37.0 38.0 7 37.135 38.0 38.0 38.0 37.0 38.0 8 37.1015 38.0 38.0 38.0 37.0 38.0 9 37.1655 38.0 38.0 38.0 36.0 38.0 10-14 37.1766 38.0 38.0 38.0 37.0 38.0 15-19 37.1595 38.0 38.0 38.0 36.8 38.0 20-24 37.163 38.0 38.0 38.0 37.0 38.0 25-29 37.129099999999994 38.0 38.0 38.0 36.6 38.0 30-34 37.055550000000004 38.0 38.0 38.0 36.6 38.0 35-39 37.01875 38.0 38.0 38.0 36.2 38.0 40-44 37.065749999999994 38.0 38.0 38.0 36.6 38.0 45-49 37.0441 38.0 38.0 38.0 36.2 38.0 50-54 37.03445000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.9936 38.0 38.0 38.0 36.0 38.0 60-64 36.894000000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.791199999999996 38.0 38.0 38.0 35.4 38.0 70-74 36.81385 38.0 38.0 38.0 35.6 38.0 75-79 36.79475 38.0 38.0 38.0 35.4 38.0 80-84 36.7927 38.0 38.0 38.0 35.2 38.0 85-89 36.57315 38.0 38.0 38.0 34.4 38.0 90-94 36.50095 38.0 38.0 38.0 34.0 38.0 95-99 36.518899999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.31305 38.0 38.0 38.0 34.0 38.0 105-109 36.01615 38.0 37.4 38.0 33.0 38.0 110-114 36.1367 38.0 37.6 38.0 33.6 38.0 115-119 35.9908 38.0 37.0 38.0 33.0 38.0 120-124 35.7039 38.0 36.8 38.0 31.8 38.0 125-129 35.498799999999996 38.0 36.0 38.0 31.0 38.0 130-134 35.251099999999994 38.0 36.0 38.0 29.6 38.0 135-139 34.84475 38.0 35.4 38.0 28.0 38.0 140-144 34.536950000000004 38.0 35.2 38.0 26.8 38.0 145-149 33.918949999999995 38.0 35.0 38.0 23.8 38.0 150-151 30.449125000000002 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 3.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 2.0 13 0.0 14 2.0 15 3.0 16 3.0 17 0.0 18 1.0 19 6.0 20 4.0 21 4.0 22 6.0 23 8.0 24 16.0 25 14.0 26 20.0 27 21.0 28 29.0 29 33.0 30 37.0 31 62.0 32 87.0 33 107.0 34 149.0 35 232.0 36 598.0 37 2546.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.074999999999996 16.675 17.8 32.45 2 24.375 22.25 36.95 16.425 3 21.325 24.45 33.0 21.224999999999998 4 22.900000000000002 32.85 23.724999999999998 20.525 5 24.775 36.5 21.775 16.950000000000003 6 17.375 38.45 25.674999999999997 18.5 7 19.025 15.725 42.475 22.775000000000002 8 20.0 24.275 27.3 28.425 9 21.725 25.4 28.375 24.5 10-14 23.3 28.244999999999997 26.340000000000003 22.115000000000002 15-19 22.58 27.92 28.07 21.43 20-24 22.699079631852744 29.051620648259302 26.95578231292517 21.293517406962785 25-29 23.30830830830831 29.24924924924925 26.82182182182182 20.62062062062062 30-34 23.444856255634576 28.75388159871782 27.296403886607234 20.50485825904037 35-39 23.1312625250501 28.80260521042084 26.853707414829657 21.2124248496994 40-44 23.239154393347363 28.589319707444144 27.397054403366393 20.7744714958421 45-49 23.23742807105329 28.07605704278209 27.535651738804102 21.15086314736052 50-54 23.83476695339068 28.755751150230047 26.890378075615125 20.519103820764155 55-59 23.415 28.53 27.36 20.695 60-64 23.155 28.96 27.62 20.265 65-69 23.724999999999998 27.99 27.334999999999997 20.95 70-74 24.365000000000002 28.38 26.405 20.849999999999998 75-79 23.74 28.725 27.35 20.185 80-84 24.085 28.335 27.095000000000002 20.485 85-89 23.830000000000002 28.410000000000004 27.51 20.25 90-94 23.294999999999998 28.205000000000002 27.639999999999997 20.86 95-99 23.419999999999998 29.080000000000002 27.389999999999997 20.11 100-104 23.849999999999998 28.285 27.52 20.345 105-109 23.84 28.335 27.715 20.11 110-114 23.595 28.389999999999997 27.51 20.505000000000003 115-119 24.4 28.34 27.465 19.794999999999998 120-124 24.245 28.275 27.055 20.424999999999997 125-129 24.425 28.18 27.105 20.29 130-134 24.285 28.139999999999997 27.72 19.855 135-139 24.645 28.125 27.485 19.744999999999997 140-144 24.485 28.08 27.529999999999998 19.905 145-149 25.009999999999998 28.07 26.57 20.349999999999998 150-151 24.406101525381345 27.769442360590148 27.906976744186046 19.91747936984246 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 2.0 26 3.0 27 1.5 28 2.0 29 4.0 30 6.0 31 7.5 32 13.0 33 19.0 34 27.0 35 50.0 36 83.5 37 109.0 38 133.0 39 171.0 40 205.0 41 237.0 42 278.0 43 315.5 44 312.5 45 302.5 46 279.5 47 249.0 48 237.0 49 200.5 50 168.5 51 135.5 52 109.0 53 90.0 54 71.0 55 55.0 56 35.0 57 21.5 58 16.0 59 14.0 60 9.5 61 6.5 62 3.5 63 2.0 64 2.0 65 3.0 66 3.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.04 25-29 0.1 30-34 0.16999999999999998 35-39 0.2 40-44 0.19 45-49 0.075 50-54 0.02 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.7250000000000001 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.7625 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.3499999999999996 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 3.025 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138-139 3.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTTA 10 0.0068608476 144.78749 3 GTGCCAT 10 0.0068608476 144.78749 145 >>END_MODULE Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886144 spots for SRR7180133.sra Written 886144 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra Read 886140 spots for SRR7180133.sra Written 886140 spots for SRR7180133.sra SRR ids: ['SRR7180133.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k_y749z3 SRR7180133.sra spots: 17722804 blocks: [[1, 886140], [886141, 1772280], [1772281, 2658420], [2658421, 3544560], [3544561, 4430700], [4430701, 5316840], [5316841, 6202980], [6202981, 7089120], [7089121, 7975260], [7975261, 8861400], [8861401, 9747540], [9747541, 10633680], [10633681, 11519820], [11519821, 12405960], [12405961, 13292100], [13292101, 14178240], [14178241, 15064380], [15064381, 15950520], [15950521, 16836660], [16836661, 17722804]] SRR7180133 file size 5983976 SRR7180133 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180133 SRR7180133_1.fastq SRR7180133_2.fastq Input file: SRR7180133_1.fastq Paired file: SRR7180133_2.fastq trimmed: SRR7180133-trimmed-pair1.fastq, SRR7180133-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 21:45:09 2025 >> started Mon Feb 10 21:45:28 2025 >> done (19.895s) 17722804 read pairs processed; of these: 9798 ( 0.06%) short read pairs filtered out after trimming by size control 7822 ( 0.04%) empty read pairs filtered out after trimming by size control 17705184 (99.90%) read pairs available; of these: 6180519 (34.91%) trimmed read pairs available after processing 11524665 (65.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 3 0.00% 25 1 0.00% 26 1 0.00% 27 4 0.00% 28 2 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 1 0.00% 35 1 0.00% 36 3 0.00% 37 1 0.00% 38 4 0.00% 39 3 0.00% 40 3 0.00% 41 9 0.00% 42 1 0.00% 43 8 0.00% 44 4 0.00% 45 6 0.00% 46 12 0.00% 47 8 0.00% 48 8 0.00% 49 12 0.00% 50 12 0.00% 51 15 0.00% 52 16 0.00% 53 16 0.00% 54 25 0.00% 55 27 0.00% 56 20 0.00% 57 33 0.00% 58 40 0.00% 59 51 0.00% 60 45 0.00% 61 58 0.00% 62 74 0.00% 63 62 0.00% 64 82 0.00% 65 85 0.00% 66 120 0.00% 67 122 0.00% 68 121 0.00% 69 140 0.00% 70 215 0.00% 71 217 0.00% 72 243 0.00% 73 325 0.00% 74 348 0.00% 75 419 0.00% 76 490 0.00% 77 522 0.00% 78 646 0.00% 79 700 0.00% 80 829 0.00% 81 865 0.00% 82 1035 0.01% 83 1204 0.01% 84 1788 0.01% 85 2236 0.01% 86 2376 0.01% 87 2728 0.02% 88 2901 0.02% 89 3061 0.02% 90 3304 0.02% 91 3563 0.02% 92 3818 0.02% 93 4063 0.02% 94 4581 0.03% 95 4797 0.03% 96 5273 0.03% 97 5903 0.03% 98 6283 0.04% 99 6315 0.04% 100 6964 0.04% 101 7289 0.04% 102 7969 0.05% 103 8427 0.05% 104 9178 0.05% 105 9924 0.06% 106 10466 0.06% 107 11100 0.06% 108 12013 0.07% 109 12561 0.07% 110 13357 0.08% 111 14217 0.08% 112 14774 0.08% 113 15662 0.09% 114 16555 0.09% 115 17512 0.10% 116 18636 0.11% 117 19692 0.11% 118 20961 0.12% 119 22567 0.13% 120 24788 0.14% 121 25144 0.14% 122 25135 0.14% 123 26434 0.15% 124 27581 0.16% 125 29003 0.16% 126 30167 0.17% 127 31868 0.18% 128 33631 0.19% 129 35399 0.20% 130 37300 0.21% 131 39200 0.22% 132 41392 0.23% 133 44115 0.25% 134 46098 0.26% 135 48406 0.27% 136 51492 0.29% 137 54580 0.31% 138 58807 0.33% 139 63282 0.36% 140 67774 0.38% 141 74361 0.42% 142 82085 0.46% 143 91822 0.52% 144 104992 0.59% 145 121614 0.69% 146 148498 0.84% 147 197227 1.11% 148 297664 1.68% 149 577089 3.26% 150 3301431 18.65% 151 11524665 65.09% 17705184 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=25 prefix-density=0.33 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=387.00 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=35.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=30 prefix-density=0.32 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=322.12 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=25.6 sequence=AGAAGAAGAGAGG SRR7180133 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 21:46:13 Started mapping on | Feb 10 21:46:13 Finished on | Feb 10 21:47:57 Mapping speed, Million of reads per hour | 612.87 Number of input reads | 17705184 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16913919 Uniquely mapped reads % | 95.53% Average mapped length | 296.80 Number of splices: Total | 17922769 Number of splices: Annotated (sjdb) | 17628391 Number of splices: GT/AG | 17641153 Number of splices: GC/AG | 228340 Number of splices: AT/AC | 13627 Number of splices: Non-canonical | 39649 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440703 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 67096 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.53% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 358895 358895 358895 N_multimapping 440703 440703 440703 N_noFeature 335790 16773966 394203 N_ambiguous 164880 812 82919 UnstrandedReadsAssigned:16413249 PositiveStrandReadsAssigned:139141 NegativeStrandReadsAssigned:16436797 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180133 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180133-trimmed-pair1.fastq SRR7180133-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,705,184 reads, 16,327,606 reads pseudoaligned [quant] estimated average fragment length: 250.337 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR7180133.ke.tsv 34699 SRR7180133.se.tsv 87100 total ==> SRR7180133.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.66 1107 35.3775 Potri.005G024800.1.v4.1 1035 785.663 248 17.8419 Potri.004G059700.1.v4.1 961 711.708 46 3.65326 Potri.007G009000.2.v4.1 1416 1166.66 0 0 Potri.003G141000.2.v4.1 2943 2693.66 594 12.4643 Potri.016G087400.1.v4.1 270 74.2602 1456.19 1108.37 Potri.015G069301.1.v4.1 564 319.54 0 0 Potri.010G195200.1.v4.1 1773 1523.66 319 11.8339 Potri.012G127500.1.v4.1 977 727.683 4395 341.382 ==> SRR7180133.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 89 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 396 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 219 SRR7180133 completed mapping pipeline successfully