Starting /dee2/code/volunteer_pipeline.sh SRR7180134 current disk space = 3057500323840 free memory = 1579908404 SRR7180134 SRAfilesize 49f28d43b1646e5567fa70b3f4d37d5b SRR7180134.sra SRR7180134.sra file validated SRR7180134 is paired end SRR7180134 is conventional basespace SRR7180134 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.11325 33.0 33.0 34.0 28.0 34.0 2 32.60675 33.0 33.0 34.0 30.0 34.0 3 32.3315 33.0 33.0 34.0 29.0 34.0 4 32.307 33.0 33.0 33.0 31.0 34.0 5 33.14825 33.0 33.0 34.0 33.0 34.0 6 37.04475 38.0 37.0 38.0 35.0 38.0 7 37.3615 38.0 38.0 38.0 37.0 38.0 8 37.5795 38.0 38.0 38.0 37.0 38.0 9 37.716 38.0 38.0 38.0 38.0 38.0 10-14 37.688100000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.702749999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.6314 38.0 38.0 38.0 38.0 38.0 25-29 37.60815 38.0 38.0 38.0 38.0 38.0 30-34 37.57715 38.0 38.0 38.0 38.0 38.0 35-39 37.5909 38.0 38.0 38.0 38.0 38.0 40-44 37.52235 38.0 38.0 38.0 38.0 38.0 45-49 37.508449999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.489 38.0 38.0 38.0 38.0 38.0 55-59 37.429 38.0 38.0 38.0 38.0 38.0 60-64 37.394149999999996 38.0 38.0 38.0 37.4 38.0 65-69 37.33225 38.0 38.0 38.0 37.0 38.0 70-74 37.3118 38.0 38.0 38.0 37.2 38.0 75-79 37.2765 38.0 38.0 38.0 37.0 38.0 80-84 37.238350000000004 38.0 38.0 38.0 37.0 38.0 85-89 37.2108 38.0 38.0 38.0 37.0 38.0 90-94 37.1714 38.0 38.0 38.0 36.8 38.0 95-99 37.09085 38.0 38.0 38.0 36.6 38.0 100-104 36.98175 38.0 38.0 38.0 36.0 38.0 105-109 36.908 38.0 38.0 38.0 36.0 38.0 110-114 36.86325000000001 38.0 38.0 38.0 35.8 38.0 115-119 36.717549999999996 38.0 38.0 38.0 35.0 38.0 120-124 36.596000000000004 38.0 38.0 38.0 35.0 38.0 125-129 36.4388 38.0 38.0 38.0 34.4 38.0 130-134 36.201049999999995 38.0 38.0 38.0 34.0 38.0 135-139 36.02825 38.0 38.0 38.0 33.6 38.0 140-144 35.8295 38.0 38.0 38.0 33.0 38.0 145-149 35.579499999999996 38.0 37.0 38.0 32.6 38.0 150-151 32.851625 37.0 33.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 0.0 11 3.0 12 1.0 13 2.0 14 1.0 15 1.0 16 0.0 17 2.0 18 3.0 19 1.0 20 4.0 21 2.0 22 2.0 23 2.0 24 7.0 25 9.0 26 9.0 27 20.0 28 8.0 29 16.0 30 27.0 31 41.0 32 30.0 33 51.0 34 87.0 35 136.0 36 387.0 37 3145.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.088042049934295 13.350854139290409 15.795006570302233 37.76609724047306 2 20.505758637956937 17.601402103154733 37.43114672008012 24.461692538808215 3 19.625 22.35 26.35 31.674999999999997 4 23.3 29.625 22.175 24.9 5 23.375 32.074999999999996 25.275 19.275000000000002 6 18.625 34.849999999999994 26.224999999999998 20.3 7 14.75 22.25 44.05 18.95 8 17.65 23.474999999999998 32.85 26.025 9 19.400000000000002 24.224999999999998 32.0 24.375 10-14 19.595000000000002 30.035 27.134999999999998 23.235 15-19 19.45 28.804999999999996 28.349999999999998 23.395 20-24 19.775000000000002 29.220000000000002 27.750000000000004 23.255 25-29 19.925 29.185 27.834999999999997 23.055 30-34 19.74 29.154999999999998 26.889999999999997 24.215 35-39 19.91 28.720000000000002 27.474999999999998 23.895 40-44 20.43 29.160000000000004 26.77 23.64 45-49 19.66 28.754999999999995 27.42 24.165 50-54 20.325 28.499999999999996 27.46 23.715 55-59 19.855 28.84 27.68 23.625 60-64 20.355 28.139999999999997 27.700000000000003 23.805 65-69 19.950000000000003 28.515 27.54 23.995 70-74 20.53 27.950000000000003 28.115000000000002 23.405 75-79 20.645 27.85 27.77 23.735 80-84 20.21 28.144999999999996 27.22 24.425 85-89 20.369999999999997 28.33 27.575 23.724999999999998 90-94 20.244999999999997 27.655 28.110000000000003 23.990000000000002 95-99 20.49 28.025 27.97 23.515 100-104 20.32 28.189999999999998 27.73 23.76 105-109 20.5 27.689999999999998 27.855 23.955000000000002 110-114 20.78 28.310000000000002 27.42 23.49 115-119 21.25 28.51 26.86 23.380000000000003 120-124 20.59 27.71 27.63 24.07 125-129 20.89 28.134999999999998 27.779999999999998 23.195 130-134 20.94 27.83 27.425 23.805 135-139 20.935000000000002 27.555000000000003 27.589999999999996 23.919999999999998 140-144 21.26 27.900000000000002 27.175 23.665 145-149 21.365000000000002 28.57 26.55 23.515 150-151 22.237517206857717 28.50707045426104 26.554874233512706 22.70053810536854 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 1.0 3 1.0 4 0.5 5 0.5 6 0.5 7 1.0 8 1.0 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.5 25 3.5 26 7.0 27 11.0 28 10.5 29 15.5 30 22.5 31 26.5 32 37.5 33 50.0 34 61.0 35 79.5 36 97.5 37 112.0 38 133.5 39 162.5 40 185.5 41 210.0 42 237.5 43 249.0 44 253.5 45 265.5 46 253.5 47 240.5 48 217.5 49 184.0 50 170.5 51 134.5 52 108.5 53 98.5 54 80.0 55 63.0 56 47.0 57 36.0 58 37.0 59 25.5 60 10.5 61 11.5 62 11.5 63 8.0 64 5.0 65 2.0 66 1.5 67 2.5 68 2.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.875 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0125 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0125 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88-89 0.1125 0.0 0.0 0.025 0.0 90-91 0.125 0.0 0.0 0.025 0.0 92-93 0.21250000000000002 0.0 0.0 0.025 0.0 94-95 0.25 0.0 0.0 0.025 0.0 96-97 0.3125 0.0 0.0 0.025 0.0 98-99 0.375 0.0 0.0 0.025 0.0 100-101 0.4125 0.0 0.0 0.025 0.0 102-103 0.5 0.0 0.0 0.025 0.0 104-105 0.5375000000000001 0.0 0.0 0.025 0.0 106-107 0.65 0.0 0.0 0.025 0.0 108-109 0.7749999999999999 0.0 0.0 0.025 0.0 110-111 0.9375 0.0 0.0 0.025 0.0 112-113 1.1124999999999998 0.0 0.0 0.025 0.0 114-115 1.3875 0.0 0.0 0.025 0.0 116-117 1.6375 0.0 0.0 0.025 0.0 118-119 1.8375 0.0 0.0 0.025 0.0 120-121 2.1500000000000004 0.0 0.0 0.025 0.0 122-123 2.4000000000000004 0.0 0.0 0.025 0.0 124-125 2.625 0.0 0.0 0.025 0.0 126-127 2.8625 0.0 0.0 0.025 0.0 128-129 3.1624999999999996 0.0 0.0 0.025 0.0 130-131 3.6125 0.0 0.0 0.025 0.0 132-133 4.15 0.0 0.0 0.025 0.0 134-135 4.625 0.0 0.0 0.025 0.0 136-137 5.1125 0.0 0.0 0.025 0.0 138-139 5.775 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180134 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.117 34.0 33.0 34.0 33.0 34.0 2 33.24375 34.0 33.0 34.0 33.0 34.0 3 33.2925 34.0 33.0 34.0 33.0 34.0 4 33.31075 34.0 33.0 34.0 33.0 34.0 5 33.338 34.0 33.0 34.0 33.0 34.0 6 37.41725 38.0 38.0 38.0 38.0 38.0 7 37.41325 38.0 38.0 38.0 38.0 38.0 8 37.384 38.0 38.0 38.0 38.0 38.0 9 37.376 38.0 38.0 38.0 38.0 38.0 10-14 37.3351 38.0 38.0 38.0 38.0 38.0 15-19 37.2975 38.0 38.0 38.0 37.8 38.0 20-24 37.3395 38.0 38.0 38.0 38.0 38.0 25-29 37.3286 38.0 38.0 38.0 38.0 38.0 30-34 37.23350000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.13100000000001 38.0 38.0 38.0 37.2 38.0 40-44 37.17325 38.0 38.0 38.0 37.6 38.0 45-49 37.19345 38.0 38.0 38.0 37.0 38.0 50-54 37.18195 38.0 38.0 38.0 37.0 38.0 55-59 37.13385 38.0 38.0 38.0 37.0 38.0 60-64 37.04785 38.0 38.0 38.0 37.0 38.0 65-69 37.046350000000004 38.0 38.0 38.0 37.0 38.0 70-74 36.98635 38.0 38.0 38.0 37.0 38.0 75-79 36.934749999999994 38.0 38.0 38.0 36.6 38.0 80-84 36.92865 38.0 38.0 38.0 36.0 38.0 85-89 36.874700000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.804500000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.758500000000005 38.0 38.0 38.0 35.8 38.0 100-104 36.6514 38.0 38.0 38.0 35.6 38.0 105-109 36.4068 38.0 38.0 38.0 34.0 38.0 110-114 36.4265 38.0 38.0 38.0 34.4 38.0 115-119 36.2847 38.0 38.0 38.0 34.0 38.0 120-124 36.180899999999994 38.0 38.0 38.0 34.0 38.0 125-129 35.969550000000005 38.0 38.0 38.0 33.2 38.0 130-134 35.8535 38.0 37.6 38.0 33.2 38.0 135-139 35.49634999999999 38.0 36.0 38.0 31.8 38.0 140-144 35.14205 38.0 36.0 38.0 31.0 38.0 145-149 34.71585 38.0 36.0 38.0 29.0 38.0 150-151 31.416875 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 7.0 4 3.0 5 4.0 6 3.0 7 1.0 8 1.0 9 0.0 10 2.0 11 1.0 12 3.0 13 0.0 14 1.0 15 2.0 16 1.0 17 6.0 18 3.0 19 3.0 20 1.0 21 7.0 22 3.0 23 8.0 24 6.0 25 6.0 26 15.0 27 15.0 28 19.0 29 25.0 30 23.0 31 43.0 32 48.0 33 70.0 34 93.0 35 145.0 36 443.0 37 2985.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.300000000000004 14.95 18.7 32.05 2 23.474999999999998 23.674999999999997 35.025 17.825 3 22.35 25.324999999999996 30.099999999999998 22.225 4 25.174999999999997 32.0 21.675 21.15 5 25.55 36.199999999999996 22.15 16.1 6 19.60931630353118 36.78938141748059 24.04207362885049 19.55922865013774 7 18.593593593593592 18.71871871871872 41.34134134134134 21.346346346346344 8 21.4 23.225 28.599999999999998 26.775 9 22.088655146506387 24.442774855997996 29.17605810167794 24.292511895817682 10-14 23.82311698717949 29.01141826923077 25.1953125 21.970152243589745 15-19 23.486100676183323 28.459804658151768 26.977210117705987 21.076884547958926 20-24 23.26571500125219 28.41472577009767 26.841973453543698 21.477585775106437 25-29 23.61076314075262 28.63155784937616 26.887808788896127 20.869870220975095 30-34 23.397644700576297 27.647206213981455 27.637183663242293 21.31796542219995 35-39 23.556246240224585 28.037898536194106 27.07038299578905 21.33547222779226 40-44 23.480441323971917 28.114343029087262 26.94082246740221 21.464393179538614 45-49 22.46881418766595 27.88437453033415 27.814237763639092 21.832573518360803 50-54 23.826696719258702 28.244427748559982 26.972201352366643 20.956674179814673 55-59 24.327573253193087 27.9038317054846 27.082394189832204 20.686200851490106 60-64 23.886801903330827 27.798647633358375 27.59328825444528 20.721262208865515 65-69 23.611319809666917 28.219383921863262 27.192587027297773 20.97670924117205 70-74 23.838141025641026 27.57411858974359 27.73938301282051 20.848357371794872 75-79 23.845537413603125 27.45166783532004 27.73214464589803 20.970650105178805 80-84 24.0222344634183 27.377435024287642 28.103560518804144 20.49676999348991 85-89 23.93569067414605 28.072723630171293 27.41159971952319 20.57998597615947 90-94 24.21468587434974 27.235894357743096 27.941176470588236 20.60824329731893 95-99 23.25465093018604 28.32066413282657 27.410482096419287 21.014202840568114 100-104 24.019607843137255 27.43097238895558 27.726090436174474 20.823329331732694 105-109 24.10482096419284 27.140428085617124 28.265653130626124 20.489097819563913 110-114 23.85596399099775 27.576894223555886 27.806951737934483 20.760190047511877 115-119 24.362181090545274 28.154077038519258 27.03351675837919 20.45022511255628 120-124 23.731865932966485 28.38919459729865 27.158579289644823 20.720360180090044 125-129 24.77734414089863 28.059641749224458 27.16901831281897 19.99399579705794 130-134 24.59828803123592 27.84201832106923 27.451569304700406 20.108124342994444 135-139 24.679807884730838 28.206924154492697 27.41144686812087 19.701821092655596 140-144 24.50990198039608 28.175635127025405 27.070414082816562 20.244048809761953 145-149 25.745 27.71 27.045 19.5 150-151 24.902870033838827 27.509712996616116 27.93583155783933 19.651585411705728 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 0.5 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.0 20 0.0 21 1.0 22 1.0 23 1.0 24 1.5 25 1.5 26 3.5 27 6.0 28 6.0 29 7.5 30 9.5 31 15.0 32 23.0 33 30.0 34 37.0 35 47.0 36 68.5 37 93.5 38 124.0 39 154.5 40 181.5 41 206.0 42 228.0 43 265.0 44 279.5 45 285.5 46 287.5 47 265.5 48 235.5 49 209.0 50 191.5 51 150.5 52 115.0 53 98.0 54 78.0 55 64.5 56 48.5 57 33.0 58 32.5 59 27.0 60 15.0 61 12.5 62 11.5 63 9.0 64 7.5 65 5.0 66 5.5 67 4.0 68 1.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.17500000000000002 7 0.1 8 0.0 9 0.17500000000000002 10-14 0.16 15-19 0.17500000000000002 20-24 0.17500000000000002 25-29 0.215 30-34 0.22499999999999998 35-39 0.26 40-44 0.3 45-49 0.19499999999999998 50-54 0.17500000000000002 55-59 0.17500000000000002 60-64 0.17500000000000002 65-69 0.17500000000000002 70-74 0.16 75-79 0.16999999999999998 80-84 0.155 85-89 0.16999999999999998 90-94 0.04 95-99 0.02 100-104 0.04 105-109 0.02 110-114 0.025 115-119 0.05 120-124 0.05 125-129 0.06999999999999999 130-134 0.11499999999999999 135-139 0.06 140-144 0.02 145-149 0.0 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3193849256365 98.5 2 0.604991177211999 1.2 3 0.050415931434333254 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025207965717166627 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.38749999999999996 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.325 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.125 0.0 0.0 0.0 0.0 122-123 2.375 0.0 0.0 0.0 0.0 124-125 2.5999999999999996 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.1875 0.0 0.0 0.0 0.0 130-131 3.6624999999999996 0.0 0.0 0.0 0.0 132-133 4.2375 0.0 0.0 0.0 0.0 134-135 4.7375 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCAT 10 0.006830828 145.0 5 >>END_MODULE Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690727 spots for SRR7180134.sra Written 690727 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra Read 690721 spots for SRR7180134.sra Written 690721 spots for SRR7180134.sra SRR ids: ['SRR7180134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s7rk7mvd SRR7180134.sra spots: 13814426 blocks: [[1, 690721], [690722, 1381442], [1381443, 2072163], [2072164, 2762884], [2762885, 3453605], [3453606, 4144326], [4144327, 4835047], [4835048, 5525768], [5525769, 6216489], [6216490, 6907210], [6907211, 7597931], [7597932, 8288652], [8288653, 8979373], [8979374, 9670094], [9670095, 10360815], [10360816, 11051536], [11051537, 11742257], [11742258, 12432978], [12432979, 13123699], [13123700, 13814426]] SRR7180134 file size 4659555 SRR7180134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180134 SRR7180134_1.fastq SRR7180134_2.fastq Input file: SRR7180134_1.fastq Paired file: SRR7180134_2.fastq trimmed: SRR7180134-trimmed-pair1.fastq, SRR7180134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:38:05 2025 >> started Mon Feb 10 22:38:19 2025 >> done (14.677s) 13814426 read pairs processed; of these: 18307 ( 0.13%) short read pairs filtered out after trimming by size control 9923 ( 0.07%) empty read pairs filtered out after trimming by size control 13786196 (99.80%) read pairs available; of these: 4887546 (35.45%) trimmed read pairs available after processing 8898650 (64.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 5 0.00% 22 3 0.00% 23 3 0.00% 24 6 0.00% 25 2 0.00% 26 7 0.00% 27 6 0.00% 28 8 0.00% 29 8 0.00% 30 2 0.00% 31 10 0.00% 32 3 0.00% 33 2 0.00% 34 7 0.00% 35 10 0.00% 36 13 0.00% 37 34 0.00% 38 11 0.00% 39 13 0.00% 40 11 0.00% 41 5 0.00% 42 4 0.00% 43 22 0.00% 44 38 0.00% 45 21 0.00% 46 39 0.00% 47 46 0.00% 48 21 0.00% 49 69 0.00% 50 26 0.00% 51 64 0.00% 52 51 0.00% 53 70 0.00% 54 72 0.00% 55 106 0.00% 56 133 0.00% 57 61 0.00% 58 42 0.00% 59 52 0.00% 60 62 0.00% 61 79 0.00% 62 86 0.00% 63 93 0.00% 64 101 0.00% 65 93 0.00% 66 100 0.00% 67 141 0.00% 68 134 0.00% 69 148 0.00% 70 211 0.00% 71 201 0.00% 72 250 0.00% 73 272 0.00% 74 335 0.00% 75 457 0.00% 76 506 0.00% 77 585 0.00% 78 653 0.00% 79 637 0.00% 80 801 0.01% 81 925 0.01% 82 1045 0.01% 83 1194 0.01% 84 1866 0.01% 85 2565 0.02% 86 2836 0.02% 87 3145 0.02% 88 3556 0.03% 89 3826 0.03% 90 3923 0.03% 91 4247 0.03% 92 4533 0.03% 93 4715 0.03% 94 5274 0.04% 95 5441 0.04% 96 5832 0.04% 97 6387 0.05% 98 6857 0.05% 99 7328 0.05% 100 8107 0.06% 101 8423 0.06% 102 9097 0.07% 103 9663 0.07% 104 10082 0.07% 105 11200 0.08% 106 12062 0.09% 107 12632 0.09% 108 13428 0.10% 109 14901 0.11% 110 15464 0.11% 111 16542 0.12% 112 17368 0.13% 113 18156 0.13% 114 19111 0.14% 115 20300 0.15% 116 21167 0.15% 117 22404 0.16% 118 23878 0.17% 119 26126 0.19% 120 27217 0.20% 121 28067 0.20% 122 27894 0.20% 123 28852 0.21% 124 30471 0.22% 125 31296 0.23% 126 32462 0.24% 127 34409 0.25% 128 35459 0.26% 129 36802 0.27% 130 39121 0.28% 131 39891 0.29% 132 41649 0.30% 133 43837 0.32% 134 45390 0.33% 135 46845 0.34% 136 49283 0.36% 137 51591 0.37% 138 53733 0.39% 139 56711 0.41% 140 59973 0.44% 141 63849 0.46% 142 67886 0.49% 143 73819 0.54% 144 81650 0.59% 145 90888 0.66% 146 105946 0.77% 147 133329 0.97% 148 192452 1.40% 149 373423 2.71% 150 2470687 17.92% 151 8898650 64.55% 13786196 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=24 prefix-density=0.48 prefix-fanout=2.7 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=20.39 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=TCATAGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=32 prefix-density=0.77 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=36.42 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=9.7 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7180134 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:39:12 Started mapping on | Feb 10 22:39:12 Finished on | Feb 10 22:42:00 Mapping speed, Million of reads per hour | 295.42 Number of input reads | 13786196 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12357561 Uniquely mapped reads % | 89.64% Average mapped length | 295.51 Number of splices: Total | 11822114 Number of splices: Annotated (sjdb) | 11593662 Number of splices: GT/AG | 11629318 Number of splices: GC/AG | 148515 Number of splices: AT/AC | 9458 Number of splices: Non-canonical | 34823 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327627 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 42652 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.58% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1114615 1114615 1114615 N_multimapping 327627 327627 327627 N_noFeature 325544 12238861 365443 N_ambiguous 139033 666 59939 UnstrandedReadsAssigned:11892984 PositiveStrandReadsAssigned:118034 NegativeStrandReadsAssigned:11932179 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180134-trimmed-pair1.fastq SRR7180134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,786,196 reads, 11,839,604 reads pseudoaligned [quant] estimated average fragment length: 229.866 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR7180134.ke.tsv 34699 SRR7180134.se.tsv 87100 total ==> SRR7180134.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.13 1027 40.875 Potri.005G024800.1.v4.1 1035 806.134 719 63.5115 Potri.004G059700.1.v4.1 961 732.148 9 0.875334 Potri.007G009000.2.v4.1 1416 1187.13 0 0 Potri.003G141000.2.v4.1 2943 2714.13 565.693 14.8416 Potri.016G087400.1.v4.1 270 80.0603 1573 1399.08 Potri.015G069301.1.v4.1 564 337.556 0 0 Potri.010G195200.1.v4.1 1773 1544.13 485.883 22.4067 Potri.012G127500.1.v4.1 977 748.134 3701 352.266 ==> SRR7180134.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 461 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 395 SRR7180134 completed mapping pipeline successfully