Starting /dee2/code/volunteer_pipeline.sh SRR7180135 current disk space = 3057617149952 free memory = 1573742444 SRR7180135 SRAfilesize 92527f9103c296672e749d0a140b2978 SRR7180135.sra SRR7180135.sra file validated SRR7180135 is paired end SRR7180135 is conventional basespace SRR7180135 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180135_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.25425 33.0 33.0 34.0 30.0 34.0 2 32.815 34.0 33.0 34.0 31.0 34.0 3 32.65325 33.0 33.0 34.0 30.0 34.0 4 33.06275 34.0 33.0 34.0 31.0 34.0 5 33.437 34.0 33.0 34.0 33.0 34.0 6 37.26875 38.0 38.0 38.0 36.0 38.0 7 37.6075 38.0 38.0 38.0 38.0 38.0 8 37.666 38.0 38.0 38.0 38.0 38.0 9 37.705 38.0 38.0 38.0 38.0 38.0 10-14 37.7172 38.0 38.0 38.0 38.0 38.0 15-19 37.71935 38.0 38.0 38.0 38.0 38.0 20-24 37.6923 38.0 38.0 38.0 38.0 38.0 25-29 37.7045 38.0 38.0 38.0 38.0 38.0 30-34 37.709250000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.67845 38.0 38.0 38.0 38.0 38.0 40-44 37.64084999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.62595 38.0 38.0 38.0 38.0 38.0 50-54 37.58775 38.0 38.0 38.0 38.0 38.0 55-59 37.542449999999995 38.0 38.0 38.0 38.0 38.0 60-64 37.50035 38.0 38.0 38.0 37.8 38.0 65-69 37.4784 38.0 38.0 38.0 37.8 38.0 70-74 37.451100000000004 38.0 38.0 38.0 37.2 38.0 75-79 37.39355 38.0 38.0 38.0 37.0 38.0 80-84 37.35895000000001 38.0 38.0 38.0 37.0 38.0 85-89 37.30749999999999 38.0 38.0 38.0 37.0 38.0 90-94 37.231950000000005 38.0 38.0 38.0 36.8 38.0 95-99 37.2151 38.0 38.0 38.0 36.6 38.0 100-104 37.0953 38.0 38.0 38.0 36.2 38.0 105-109 37.01285 38.0 38.0 38.0 36.0 38.0 110-114 36.88165 38.0 38.0 38.0 35.8 38.0 115-119 36.8651 38.0 38.0 38.0 35.8 38.0 120-124 36.768600000000006 38.0 38.0 38.0 35.2 38.0 125-129 36.60965 38.0 38.0 38.0 35.0 38.0 130-134 36.409749999999995 38.0 38.0 38.0 34.2 38.0 135-139 36.196349999999995 38.0 38.0 38.0 34.0 38.0 140-144 35.9866 38.0 37.8 38.0 33.0 38.0 145-149 35.751799999999996 38.0 37.4 38.0 33.0 38.0 150-151 33.359500000000004 37.0 34.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 2.0 16 0.0 17 1.0 18 2.0 19 2.0 20 2.0 21 2.0 22 4.0 23 4.0 24 2.0 25 4.0 26 10.0 27 15.0 28 9.0 29 16.0 30 20.0 31 23.0 32 32.0 33 50.0 34 78.0 35 146.0 36 386.0 37 3187.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.58388375165126 15.217965653896961 12.179656538969617 38.018494055482165 2 20.43064596895343 20.180270405608415 37.0555833750626 22.33350025037556 3 19.175 24.9 26.174999999999997 29.75 4 22.5 31.65 22.775000000000002 23.075000000000003 5 22.45 34.325 24.825 18.4 6 18.0 35.199999999999996 26.424999999999997 20.375 7 13.525 22.975 43.875 19.625 8 17.849999999999998 22.5 30.275000000000002 29.375 9 18.175 24.65 32.875 24.3 10-14 20.200000000000003 28.965000000000003 26.955000000000002 23.880000000000003 15-19 20.465 28.395 27.815 23.325000000000003 20-24 20.46 28.565 27.54 23.435 25-29 20.1 28.465 27.905 23.53 30-34 19.88 28.645 27.67 23.805 35-39 19.71 28.249999999999996 28.4 23.64 40-44 20.405 28.060000000000002 27.54 23.995 45-49 20.73 28.044999999999998 27.529999999999998 23.695 50-54 20.515 27.860000000000003 27.975 23.65 55-59 20.625 28.205000000000002 27.900000000000002 23.27 60-64 20.51 27.49 27.655 24.345 65-69 20.435 28.325 27.32 23.919999999999998 70-74 20.200000000000003 27.875 28.03 23.895 75-79 20.765 27.33 27.88 24.025 80-84 20.895 27.775 27.85 23.48 85-89 20.45 27.834999999999997 28.125 23.59 90-94 21.215 27.735 27.334999999999997 23.715 95-99 20.175 28.04 28.035 23.75 100-104 21.365000000000002 27.92 27.355 23.36 105-109 21.415 27.894999999999996 27.04 23.65 110-114 21.060000000000002 27.900000000000002 27.415 23.625 115-119 21.19 28.110000000000003 27.055 23.645 120-124 20.95 27.865000000000002 27.72 23.465 125-129 21.375 27.334999999999997 27.47 23.82 130-134 21.490000000000002 27.55 27.52 23.44 135-139 20.755000000000003 28.060000000000002 27.365000000000002 23.82 140-144 21.385 28.205000000000002 26.41 24.0 145-149 21.44 27.875 26.605 24.08 150-151 21.45895895895896 27.264764764764767 26.626626626626624 24.64964964964965 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.5 23 1.5 24 2.0 25 2.0 26 4.5 27 8.0 28 9.0 29 10.5 30 17.5 31 29.0 32 30.0 33 34.5 34 52.0 35 70.5 36 81.0 37 103.0 38 138.0 39 162.5 40 181.0 41 208.5 42 228.0 43 251.5 44 274.0 45 273.0 46 278.0 47 267.5 48 243.5 49 210.5 50 172.5 51 148.5 52 114.5 53 82.5 54 66.0 55 54.0 56 42.0 57 34.0 58 30.5 59 21.5 60 15.0 61 14.0 62 9.5 63 4.5 64 3.0 65 2.0 66 2.5 67 2.0 68 0.5 69 2.0 70 2.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.375 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.4124999999999996 0.0 0.0 0.0 0.0 122-123 3.8375000000000004 0.0 0.0 0.0 0.0 124-125 4.225 0.0 0.0 0.0 0.0 126-127 4.6125 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.675000000000001 0.0 0.0 0.0 0.0 132-133 6.2875 0.0 0.0 0.0 0.0 134-135 6.9 0.0 0.0 0.0 0.0 136-137 7.4375 0.0 0.0 0.0 0.0 138-139 8.162500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCACT 10 0.0068396386 144.9375 9 ATGTGTG 10 0.0068396386 144.9375 6 GGCTTCC 10 0.0068396386 144.9375 8 TGGCTTC 10 0.0068396386 144.9375 7 >>END_MODULE SRR7180135 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180135_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.192 34.0 33.0 34.0 33.0 34.0 2 33.31175 34.0 33.0 34.0 33.0 34.0 3 33.41175 34.0 33.0 34.0 33.0 34.0 4 33.40875 34.0 33.0 34.0 33.0 34.0 5 33.40725 34.0 33.0 34.0 33.0 34.0 6 37.5505 38.0 38.0 38.0 38.0 38.0 7 37.5885 38.0 38.0 38.0 38.0 38.0 8 37.57675 38.0 38.0 38.0 38.0 38.0 9 37.58625 38.0 38.0 38.0 38.0 38.0 10-14 37.547450000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.5056 38.0 38.0 38.0 38.0 38.0 20-24 37.476099999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.4184 38.0 38.0 38.0 38.0 38.0 30-34 37.39255 38.0 38.0 38.0 38.0 38.0 35-39 37.3553 38.0 38.0 38.0 38.0 38.0 40-44 37.35075 38.0 38.0 38.0 38.0 38.0 45-49 37.367549999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.365899999999996 38.0 38.0 38.0 37.8 38.0 55-59 37.338750000000005 38.0 38.0 38.0 37.4 38.0 60-64 37.298899999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.270050000000005 38.0 38.0 38.0 37.0 38.0 70-74 37.29445 38.0 38.0 38.0 37.0 38.0 75-79 37.21065 38.0 38.0 38.0 37.0 38.0 80-84 37.20585 38.0 38.0 38.0 37.0 38.0 85-89 37.1092 38.0 38.0 38.0 36.4 38.0 90-94 37.0515 38.0 38.0 38.0 36.0 38.0 95-99 36.9871 38.0 38.0 38.0 35.8 38.0 100-104 36.84855 38.0 38.0 38.0 36.0 38.0 105-109 36.72545 38.0 38.0 38.0 35.0 38.0 110-114 36.7186 38.0 38.0 38.0 35.0 38.0 115-119 36.498200000000004 38.0 38.0 38.0 34.2 38.0 120-124 36.4148 38.0 38.0 38.0 34.2 38.0 125-129 36.2004 38.0 38.0 38.0 33.8 38.0 130-134 35.99015 38.0 37.8 38.0 33.2 38.0 135-139 35.665800000000004 38.0 36.4 38.0 32.6 38.0 140-144 35.414049999999996 38.0 36.0 38.0 31.0 38.0 145-149 35.0203 38.0 36.0 38.0 31.0 38.0 150-151 31.51175 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 3.0 13 1.0 14 2.0 15 4.0 16 1.0 17 0.0 18 3.0 19 2.0 20 4.0 21 2.0 22 5.0 23 5.0 24 11.0 25 11.0 26 11.0 27 15.0 28 12.0 29 14.0 30 26.0 31 34.0 32 46.0 33 53.0 34 73.0 35 161.0 36 466.0 37 3028.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.35 14.575 16.8 31.275 2 23.674999999999997 21.65 36.5 18.175 3 20.5 25.650000000000002 32.25 21.6 4 25.5 32.5 22.5 19.5 5 25.275 35.475 22.075 17.175 6 19.21441080810608 37.90342757067801 22.942206654991242 19.93995496622467 7 18.224999999999998 16.575 42.175000000000004 23.025000000000002 8 20.65 22.325 28.95 28.075 9 23.43671835917959 24.912456228114056 27.938969484742373 23.71185592796398 10-14 23.481437005904134 28.339837886520563 25.773041128790155 22.40568397878515 15-19 23.679863857049902 28.249662145252515 26.98333249912408 21.0871414985735 20-24 23.779480246357217 28.356116368734664 26.568524360322463 21.29587902458565 25-29 23.703072527692846 27.93343692045511 26.775600220540323 21.587890331311712 30-34 23.31494483450351 27.94383149448345 27.597793380140423 21.143430290872615 35-39 22.868605817452355 28.074222668004012 27.75827482447342 21.298896690070208 40-44 23.45035105315948 27.793380140421263 27.50752256770311 21.248746238716148 45-49 23.42951608055305 28.263701031960725 26.95621681194269 21.350566075543533 50-54 23.524405506883607 28.330413016270338 27.284105131414265 20.86107634543179 55-59 23.52823388065679 28.083700440528638 27.347817380857027 21.040248297957547 60-64 23.721093202522773 27.645409950946043 27.08479327259986 21.548703573931324 65-69 23.497021574811033 27.51163838414176 27.351454172298144 21.63988586874906 70-74 23.643003652008606 28.375606583620993 27.19995997798789 20.78142978638251 75-79 23.936755729010308 28.14970479335535 26.908836185329733 21.00470329230461 80-84 23.874324594756853 28.16690014008405 27.446467880728438 20.51230738443066 85-89 24.350828038224844 27.878120778506027 27.09761344874168 20.673437734527443 90-94 24.066203310165506 27.951397569878495 26.86134306715336 21.12105605280264 95-99 24.05 27.889999999999997 27.474999999999998 20.585 100-104 24.099999999999998 27.639999999999997 27.145000000000003 21.115000000000002 105-109 24.15 27.925 27.095000000000002 20.830000000000002 110-114 24.02 27.73 27.084999999999997 21.165 115-119 23.692369236923692 28.002800280028 27.687768776877686 20.617061706170617 120-124 24.39121956097805 28.05140257012851 27.411370568528426 20.146007300365017 125-129 24.227422742274225 27.947794779477945 27.45274527452745 20.37203720372037 130-134 24.777433229968988 28.00340102030609 27.028108432529756 20.191057317195156 135-139 24.751187796949235 27.811952988247064 27.216804201050266 20.220055013753438 140-144 25.346267313365665 28.186409320466023 26.426321316065803 20.041002050102506 145-149 25.64 28.415000000000003 26.505000000000003 19.439999999999998 150-151 25.49830763444904 27.341105678826626 27.153065062053404 20.00752162467093 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 2.0 27 1.5 28 5.0 29 7.0 30 5.5 31 5.5 32 13.5 33 22.0 34 28.0 35 44.0 36 71.5 37 87.0 38 117.0 39 155.0 40 178.5 41 209.5 42 241.5 43 258.0 44 284.0 45 308.5 46 303.0 47 276.5 48 253.5 49 231.0 50 187.0 51 152.0 52 123.0 53 105.5 54 83.0 55 58.0 56 47.5 57 30.5 58 20.0 59 18.5 60 14.0 61 12.5 62 10.0 63 5.5 64 4.5 65 3.5 66 1.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.05 10-14 0.06999999999999999 15-19 0.105 20-24 0.145 25-29 0.245 30-34 0.3 35-39 0.3 40-44 0.3 45-49 0.19 50-54 0.125 55-59 0.12 60-64 0.11 65-69 0.11499999999999999 70-74 0.055 75-79 0.06999999999999999 80-84 0.06 85-89 0.065 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.005 125-129 0.01 130-134 0.03 135-139 0.025 140-144 0.005 145-149 0.0 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.9249999999999998 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.45 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.3875 0.0 0.0 0.0 0.0 122-123 3.8375000000000004 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 5.15 0.0 0.0 0.0 0.0 130-131 5.762499999999999 0.0 0.0 0.0 0.0 132-133 6.4125 0.0 0.0 0.0 0.0 134-135 7.0125 0.0 0.0 0.0 0.0 136-137 7.550000000000001 0.0 0.0 0.0 0.0 138-139 8.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCTAG 10 0.006830828 145.0 9 >>END_MODULE Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812497 spots for SRR7180135.sra Written 812497 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra Read 812493 spots for SRR7180135.sra Written 812493 spots for SRR7180135.sra SRR ids: ['SRR7180135.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ndgr46hq SRR7180135.sra spots: 16249864 blocks: [[1, 812493], [812494, 1624986], [1624987, 2437479], [2437480, 3249972], [3249973, 4062465], [4062466, 4874958], [4874959, 5687451], [5687452, 6499944], [6499945, 7312437], [7312438, 8124930], [8124931, 8937423], [8937424, 9749916], [9749917, 10562409], [10562410, 11374902], [11374903, 12187395], [12187396, 12999888], [12999889, 13812381], [13812382, 14624874], [14624875, 15437367], [15437368, 16249864]] SRR7180135 file size 5484845 SRR7180135 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180135 SRR7180135_1.fastq SRR7180135_2.fastq Input file: SRR7180135_1.fastq Paired file: SRR7180135_2.fastq trimmed: SRR7180135-trimmed-pair1.fastq, SRR7180135-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:47:16 2025 >> started Mon Feb 10 22:47:33 2025 >> done (16.760s) 16249864 read pairs processed; of these: 17427 ( 0.11%) short read pairs filtered out after trimming by size control 10721 ( 0.07%) empty read pairs filtered out after trimming by size control 16221716 (99.83%) read pairs available; of these: 5876477 (36.23%) trimmed read pairs available after processing 10345239 (63.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 4 0.00% 21 2 0.00% 22 0 0.00% 23 2 0.00% 24 5 0.00% 25 5 0.00% 26 6 0.00% 27 4 0.00% 28 1 0.00% 29 6 0.00% 30 9 0.00% 31 3 0.00% 32 2 0.00% 33 5 0.00% 34 2 0.00% 35 1 0.00% 36 10 0.00% 37 38 0.00% 38 14 0.00% 39 16 0.00% 40 9 0.00% 41 4 0.00% 42 13 0.00% 43 19 0.00% 44 28 0.00% 45 42 0.00% 46 39 0.00% 47 78 0.00% 48 33 0.00% 49 67 0.00% 50 30 0.00% 51 96 0.00% 52 79 0.00% 53 113 0.00% 54 77 0.00% 55 138 0.00% 56 154 0.00% 57 85 0.00% 58 56 0.00% 59 70 0.00% 60 100 0.00% 61 117 0.00% 62 121 0.00% 63 148 0.00% 64 138 0.00% 65 173 0.00% 66 194 0.00% 67 225 0.00% 68 260 0.00% 69 302 0.00% 70 364 0.00% 71 400 0.00% 72 464 0.00% 73 601 0.00% 74 706 0.00% 75 781 0.00% 76 901 0.01% 77 1025 0.01% 78 1131 0.01% 79 1356 0.01% 80 1476 0.01% 81 1679 0.01% 82 2006 0.01% 83 2384 0.01% 84 3119 0.02% 85 3769 0.02% 86 4206 0.03% 87 4717 0.03% 88 5350 0.03% 89 5523 0.03% 90 5957 0.04% 91 6449 0.04% 92 6935 0.04% 93 7553 0.05% 94 8297 0.05% 95 8764 0.05% 96 9848 0.06% 97 10452 0.06% 98 11053 0.07% 99 11826 0.07% 100 12483 0.08% 101 13308 0.08% 102 14198 0.09% 103 15005 0.09% 104 16295 0.10% 105 17096 0.11% 106 18317 0.11% 107 19381 0.12% 108 20616 0.13% 109 22008 0.14% 110 22770 0.14% 111 23878 0.15% 112 25029 0.15% 113 26023 0.16% 114 27544 0.17% 115 29100 0.18% 116 30099 0.19% 117 31466 0.19% 118 33293 0.21% 119 36392 0.22% 120 37497 0.23% 121 38648 0.24% 122 39310 0.24% 123 39801 0.25% 124 41261 0.25% 125 42542 0.26% 126 44275 0.27% 127 46183 0.28% 128 47666 0.29% 129 49327 0.30% 130 51781 0.32% 131 53352 0.33% 132 55363 0.34% 133 58268 0.36% 134 59433 0.37% 135 61580 0.38% 136 63991 0.39% 137 66064 0.41% 138 68500 0.42% 139 71953 0.44% 140 75940 0.47% 141 79961 0.49% 142 85171 0.53% 143 91188 0.56% 144 100011 0.62% 145 110667 0.68% 146 127011 0.78% 147 156578 0.97% 148 221170 1.36% 149 422601 2.61% 150 2782841 17.16% 151 10345239 63.77% 16221716 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=5.84 fanout-score-rank=17 prefix-density=0.68 prefix-fanout=3.1 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=77.90 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=17.1 sequence=CCATCTTCAAGCTGCTTCCCAGCAAA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=5.97 fanout-score-rank=21 prefix-density=0.79 prefix-fanout=2.3 sequence=TGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=337.94 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=31.5 sequence=GAAGAAGAAGAAA SRR7180135 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:48:18 Started mapping on | Feb 10 22:48:18 Finished on | Feb 10 22:50:30 Mapping speed, Million of reads per hour | 442.41 Number of input reads | 16221716 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14984713 Uniquely mapped reads % | 92.37% Average mapped length | 294.35 Number of splices: Total | 14663166 Number of splices: Annotated (sjdb) | 14397762 Number of splices: GT/AG | 14427584 Number of splices: GC/AG | 185400 Number of splices: AT/AC | 11628 Number of splices: Non-canonical | 38554 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399617 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 42820 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.83% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 849010 849010 849010 N_multimapping 399617 399617 399617 N_noFeature 342542 14836402 408352 N_ambiguous 160360 1460 76907 UnstrandedReadsAssigned:14481811 PositiveStrandReadsAssigned:146851 NegativeStrandReadsAssigned:14499454 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180135 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180135-trimmed-pair1.fastq SRR7180135-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,221,716 reads, 14,434,752 reads pseudoaligned [quant] estimated average fragment length: 225.09 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR7180135.ke.tsv 34699 SRR7180135.se.tsv 87100 total ==> SRR7180135.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.91 1014 38.2836 Potri.005G024800.1.v4.1 1035 810.91 227 18.9596 Potri.004G059700.1.v4.1 961 736.935 40 3.67626 Potri.007G009000.2.v4.1 1416 1191.91 0 0 Potri.003G141000.2.v4.1 2943 2718.91 455 11.3342 Potri.016G087400.1.v4.1 270 84.2009 1168.6 939.994 Potri.015G069301.1.v4.1 564 342.39 0 0 Potri.010G195200.1.v4.1 1773 1548.91 355 15.5231 Potri.012G127500.1.v4.1 977 752.925 5906 531.273 ==> SRR7180135.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 121 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 525 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 283 SRR7180135 completed mapping pipeline successfully