Starting /dee2/code/volunteer_pipeline.sh SRR7180136 current disk space = 3057257840640 free memory = 1475292792 SRR7180136 SRAfilesize a3b02786aa9e7784823e0a047833edaf SRR7180136.sra SRR7180136.sra file validated SRR7180136 is paired end SRR7180136 is conventional basespace SRR7180136 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180136_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.3165 32.0 30.0 33.0 18.0 33.0 2 31.89775 33.0 31.0 33.0 29.0 34.0 3 32.20375 33.0 33.0 33.0 29.0 34.0 4 32.84475 33.0 33.0 34.0 32.0 34.0 5 33.21 34.0 33.0 34.0 33.0 34.0 6 37.085 38.0 37.0 38.0 36.0 38.0 7 37.373 38.0 38.0 38.0 37.0 38.0 8 37.44025 38.0 38.0 38.0 37.0 38.0 9 37.3955 38.0 38.0 38.0 37.0 38.0 10-14 37.558350000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.5688 38.0 38.0 38.0 38.0 38.0 20-24 37.58315 38.0 38.0 38.0 38.0 38.0 25-29 37.5431 38.0 38.0 38.0 38.0 38.0 30-34 37.522149999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.4679 38.0 38.0 38.0 37.2 38.0 40-44 37.41995000000001 38.0 38.0 38.0 37.2 38.0 45-49 37.43205 38.0 38.0 38.0 37.0 38.0 50-54 37.35425 38.0 38.0 38.0 37.0 38.0 55-59 37.36710000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.28915 38.0 38.0 38.0 37.0 38.0 65-69 37.2264 38.0 38.0 38.0 36.8 38.0 70-74 37.1984 38.0 38.0 38.0 36.6 38.0 75-79 37.184349999999995 38.0 38.0 38.0 36.6 38.0 80-84 37.0503 38.0 38.0 38.0 35.8 38.0 85-89 37.0213 38.0 38.0 38.0 36.0 38.0 90-94 36.998900000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.8509 38.0 38.0 38.0 35.0 38.0 100-104 36.8167 38.0 38.0 38.0 35.2 38.0 105-109 36.6978 38.0 38.0 38.0 35.0 38.0 110-114 36.504650000000005 38.0 38.0 38.0 34.4 38.0 115-119 36.4499 38.0 38.0 38.0 34.0 38.0 120-124 36.255100000000006 38.0 38.0 38.0 33.8 38.0 125-129 36.187200000000004 38.0 38.0 38.0 33.8 38.0 130-134 35.921749999999996 38.0 37.2 38.0 32.6 38.0 135-139 35.653749999999995 38.0 36.2 38.0 31.4 38.0 140-144 35.343900000000005 38.0 36.0 38.0 31.0 38.0 145-149 34.8963 38.0 36.0 38.0 30.0 38.0 150-151 31.981125 36.5 32.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 0.0 17 1.0 18 4.0 19 0.0 20 0.0 21 4.0 22 4.0 23 7.0 24 5.0 25 11.0 26 11.0 27 9.0 28 19.0 29 25.0 30 37.0 31 42.0 32 69.0 33 82.0 34 137.0 35 196.0 36 499.0 37 2834.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.747310417213335 13.251115192862766 14.405667803726056 39.59590658619785 2 20.525 16.7 37.125 25.650000000000002 3 18.65 21.6 27.150000000000002 32.6 4 21.675 29.049999999999997 23.5 25.775 5 22.575 31.574999999999996 24.45 21.4 6 18.8 33.85 27.35 20.0 7 15.15 22.8 43.525000000000006 18.525 8 17.974999999999998 23.95 32.2 25.874999999999996 9 18.224999999999998 23.075000000000003 33.7 25.0 10-14 20.39 29.310000000000002 26.939999999999998 23.36 15-19 20.27 27.72 28.215 23.794999999999998 20-24 19.42 28.21 28.549999999999997 23.82 25-29 19.869999999999997 28.325 27.889999999999997 23.915 30-34 19.365 28.32 28.285 24.03 35-39 19.865 28.139999999999997 27.939999999999998 24.055 40-44 19.915 28.425 27.74 23.919999999999998 45-49 19.475 27.950000000000003 28.475 24.099999999999998 50-54 19.830000000000002 27.93 28.415000000000003 23.825 55-59 19.869999999999997 28.060000000000002 28.095 23.974999999999998 60-64 20.44 28.294999999999998 27.400000000000002 23.865 65-69 19.915 28.595 27.065 24.425 70-74 20.724999999999998 27.755000000000003 28.155 23.365 75-79 20.395 28.060000000000002 27.35 24.195 80-84 20.765 28.439999999999998 27.01 23.785 85-89 20.27 28.53 27.61 23.59 90-94 19.900000000000002 28.494999999999997 26.979999999999997 24.625 95-99 20.555 28.050000000000004 28.175 23.22 100-104 20.29 28.105000000000004 27.6 24.005000000000003 105-109 20.424999999999997 28.189999999999998 27.465 23.919999999999998 110-114 20.66 28.205000000000002 27.46 23.674999999999997 115-119 20.45 28.155 27.310000000000002 24.085 120-124 20.775 28.105000000000004 27.185 23.935000000000002 125-129 21.005 27.944999999999997 27.405 23.645 130-134 21.310000000000002 28.000000000000004 26.784999999999997 23.905 135-139 21.08 28.139999999999997 26.965 23.815 140-144 21.295 27.37 27.435 23.9 145-149 20.835 28.03 26.810000000000002 24.325 150-151 21.5625 27.700000000000003 26.075 24.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 2.0 24 3.5 25 5.0 26 3.5 27 4.5 28 9.0 29 16.5 30 21.0 31 35.0 32 50.0 33 48.0 34 55.0 35 67.0 36 85.0 37 109.5 38 132.0 39 147.0 40 176.0 41 210.0 42 226.5 43 250.0 44 254.5 45 261.5 46 280.5 47 257.0 48 218.5 49 199.5 50 181.5 51 151.0 52 122.0 53 95.0 54 68.5 55 54.5 56 45.0 57 36.0 58 26.0 59 16.5 60 13.0 61 11.0 62 8.0 63 6.5 64 6.5 65 5.0 66 4.0 67 6.5 68 4.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.5125000000000002 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.2874999999999996 0.0 0.0 0.0 0.0 122-123 2.7249999999999996 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.2875 0.0 0.0 0.0 0.0 130-131 4.8 0.0 0.0 0.0 0.0 132-133 5.2375 0.0 0.0 0.0 0.0 134-135 5.6875 0.0 0.0 0.0 0.0 136-137 6.362500000000001 0.0 0.0 0.0 0.0 138-139 7.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGAA 10 0.0068378756 144.95 5 TTGAGTT 10 0.0068378756 144.95 2 TGCAGTA 10 0.0068378756 144.95 145 >>END_MODULE SRR7180136 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180136_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89475 33.0 33.0 34.0 32.0 34.0 2 33.03575 34.0 33.0 34.0 32.0 34.0 3 33.01625 34.0 33.0 34.0 32.0 34.0 4 32.96775 34.0 33.0 34.0 32.0 34.0 5 32.97075 34.0 33.0 34.0 32.0 34.0 6 37.1165 38.0 38.0 38.0 37.0 38.0 7 37.2115 38.0 38.0 38.0 37.0 38.0 8 37.158 38.0 38.0 38.0 37.0 38.0 9 37.19575 38.0 38.0 38.0 37.0 38.0 10-14 37.1983 38.0 38.0 38.0 37.0 38.0 15-19 37.1228 38.0 38.0 38.0 37.0 38.0 20-24 37.0792 38.0 38.0 38.0 36.8 38.0 25-29 37.052099999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.1011 38.0 38.0 38.0 36.8 38.0 35-39 36.9889 38.0 38.0 38.0 37.0 38.0 40-44 36.9646 38.0 38.0 38.0 36.6 38.0 45-49 36.9093 38.0 38.0 38.0 36.0 38.0 50-54 36.9865 38.0 38.0 38.0 36.4 38.0 55-59 36.8981 38.0 38.0 38.0 36.0 38.0 60-64 36.758900000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.79684999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.7729 38.0 38.0 38.0 35.8 38.0 75-79 36.738099999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.636 38.0 38.0 38.0 35.0 38.0 85-89 36.4979 38.0 38.0 38.0 34.6 38.0 90-94 36.4234 38.0 38.0 38.0 34.0 38.0 95-99 36.25865 38.0 38.0 38.0 34.0 38.0 100-104 36.161449999999995 38.0 38.0 38.0 33.8 38.0 105-109 36.038650000000004 38.0 37.2 38.0 33.2 38.0 110-114 36.07620000000001 38.0 37.6 38.0 33.4 38.0 115-119 35.9893 38.0 37.4 38.0 33.4 38.0 120-124 35.80325 38.0 37.0 38.0 32.6 38.0 125-129 35.4612 38.0 36.2 38.0 30.6 38.0 130-134 35.141000000000005 38.0 36.0 38.0 28.6 38.0 135-139 34.9052 38.0 35.6 38.0 28.0 38.0 140-144 34.50105 38.0 35.0 38.0 26.8 38.0 145-149 33.95525 38.0 35.0 38.0 23.6 38.0 150-151 30.367375000000003 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 2.0 5 4.0 6 2.0 7 1.0 8 5.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 2.0 16 2.0 17 1.0 18 1.0 19 1.0 20 3.0 21 8.0 22 2.0 23 8.0 24 20.0 25 15.0 26 11.0 27 26.0 28 24.0 29 33.0 30 46.0 31 46.0 32 85.0 33 94.0 34 148.0 35 216.0 36 588.0 37 2590.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.508627156789196 15.028757189297323 18.904726181545385 31.557889472368096 2 24.406101525381345 21.255313828457115 36.85921480370092 17.479369842460617 3 21.705426356589147 24.981245311327832 31.45786446611653 21.85546386596649 4 24.0 32.35 23.1 20.549999999999997 5 25.431357839459867 35.23380845211303 22.58064516129032 16.754188547136785 6 19.504876219054765 37.58439609902476 24.781195298824706 18.12953238309577 7 18.829707426856714 18.854713678419603 41.01025256314079 21.305326331582897 8 20.43010752688172 24.23105776444111 28.33208302075519 27.00675168792198 9 23.655913978494624 24.58114528632158 27.93198299574894 23.830957739434858 10-14 23.502350235023503 28.902890289028903 25.802580258025802 21.79217921792179 15-19 23.40585146286572 27.361840460115026 27.796949237309327 21.435358839709927 20-24 24.019607843137255 28.07122849139656 26.850740296118445 21.05842336934774 25-29 23.731865932966485 27.70885442721361 27.70385192596298 20.855427713856926 30-34 23.410216640816532 28.448491519487668 27.162655726222045 20.97863611347376 35-39 23.441334067805098 27.85818017927788 27.662877460063097 21.037608292853925 40-44 23.568281938325992 27.96355626752102 27.14757709251101 21.32058470164197 45-49 23.403191116890913 28.01980693242635 27.694693142599906 20.88230880808283 50-54 24.281070267566893 27.616904226056516 26.966741685421354 21.135283820955237 55-59 23.268490273541033 27.474121118167727 28.114217132569884 21.14317147572136 60-64 24.24484896979396 27.370474094818963 27.730546109221844 20.654130826165233 65-69 23.482348234823483 27.557755775577558 27.88278827882788 21.077107710771077 70-74 24.25621281064053 27.486374318715935 27.13635681784089 21.12105605280264 75-79 24.476223811190557 26.57132856642832 27.986399319965997 20.96604830241512 80-84 23.837383738373838 27.827782778277825 27.122712271227122 21.21212121212121 85-89 24.116205810290513 27.87139356967848 27.091354567728388 20.921046052302618 90-94 24.07 27.750000000000004 27.58 20.599999999999998 95-99 23.369999999999997 28.494999999999997 27.27 20.865000000000002 100-104 24.065 28.095 27.560000000000002 20.28 105-109 24.065 28.205000000000002 27.185 20.544999999999998 110-114 24.425 28.095 27.525 19.955000000000002 115-119 24.26 28.305000000000003 27.04 20.395 120-124 24.12 28.37 27.425 20.085 125-129 24.13 28.76 27.169999999999998 19.939999999999998 130-134 25.41 27.665 27.29 19.634999999999998 135-139 24.91 28.349999999999998 26.479999999999997 20.26 140-144 25.105 28.125 27.425 19.345000000000002 145-149 25.374999999999996 28.325 26.395000000000003 19.905 150-151 25.95324415551944 28.34104263032879 26.378297287160894 19.327415926990874 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.0 23 1.0 24 2.0 25 1.0 26 2.0 27 4.0 28 2.5 29 7.5 30 12.0 31 14.5 32 18.0 33 30.0 34 33.5 35 39.0 36 63.0 37 89.5 38 119.0 39 155.0 40 184.0 41 206.0 42 240.5 43 272.0 44 295.0 45 295.5 46 276.5 47 248.0 48 229.5 49 213.5 50 183.5 51 169.5 52 145.0 53 110.0 54 86.0 55 58.0 56 42.0 57 37.5 58 28.0 59 18.5 60 13.0 61 10.5 62 10.0 63 9.0 64 6.5 65 3.0 66 4.0 67 3.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.01 15-19 0.025 20-24 0.04 25-29 0.05 30-34 0.065 35-39 0.155 40-44 0.12 45-49 0.034999999999999996 50-54 0.025 55-59 0.015 60-64 0.02 65-69 0.01 70-74 0.005 75-79 0.005 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7250000000000001 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.2875 0.0 0.0 0.0 0.0 126-127 3.7875 0.0 0.0 0.0 0.0 128-129 4.3625 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.3 0.0 0.0 0.0 0.0 134-135 5.7375 0.0 0.0 0.0 0.0 136-137 6.4 0.0 0.0 0.0 0.0 138-139 7.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788547 spots for SRR7180136.sra Written 788547 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra Read 788541 spots for SRR7180136.sra Written 788541 spots for SRR7180136.sra SRR ids: ['SRR7180136.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uyifu7wy SRR7180136.sra spots: 15770826 blocks: [[1, 788541], [788542, 1577082], [1577083, 2365623], [2365624, 3154164], [3154165, 3942705], [3942706, 4731246], [4731247, 5519787], [5519788, 6308328], [6308329, 7096869], [7096870, 7885410], [7885411, 8673951], [8673952, 9462492], [9462493, 10251033], [10251034, 11039574], [11039575, 11828115], [11828116, 12616656], [12616657, 13405197], [13405198, 14193738], [14193739, 14982279], [14982280, 15770826]] SRR7180136 file size 5322515 SRR7180136 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180136 SRR7180136_1.fastq SRR7180136_2.fastq Input file: SRR7180136_1.fastq Paired file: SRR7180136_2.fastq trimmed: SRR7180136-trimmed-pair1.fastq, SRR7180136-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:16:10 2025 >> started Mon Feb 10 22:16:25 2025 >> done (15.729s) 15770826 read pairs processed; of these: 21323 ( 0.14%) short read pairs filtered out after trimming by size control 20247 ( 0.13%) empty read pairs filtered out after trimming by size control 15729256 (99.74%) read pairs available; of these: 6182878 (39.31%) trimmed read pairs available after processing 9546378 (60.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 8 0.00% 24 9 0.00% 25 3 0.00% 26 6 0.00% 27 8 0.00% 28 4 0.00% 29 4 0.00% 30 4 0.00% 31 6 0.00% 32 9 0.00% 33 7 0.00% 34 9 0.00% 35 3 0.00% 36 9 0.00% 37 19 0.00% 38 5 0.00% 39 7 0.00% 40 31 0.00% 41 34 0.00% 42 11 0.00% 43 11 0.00% 44 35 0.00% 45 94 0.00% 46 65 0.00% 47 31 0.00% 48 35 0.00% 49 59 0.00% 50 97 0.00% 51 61 0.00% 52 57 0.00% 53 42 0.00% 54 76 0.00% 55 157 0.00% 56 47 0.00% 57 37 0.00% 58 71 0.00% 59 199 0.00% 60 111 0.00% 61 93 0.00% 62 95 0.00% 63 107 0.00% 64 137 0.00% 65 142 0.00% 66 175 0.00% 67 224 0.00% 68 208 0.00% 69 273 0.00% 70 297 0.00% 71 317 0.00% 72 405 0.00% 73 468 0.00% 74 523 0.00% 75 566 0.00% 76 737 0.00% 77 864 0.01% 78 1027 0.01% 79 1078 0.01% 80 1140 0.01% 81 1325 0.01% 82 1553 0.01% 83 1814 0.01% 84 2823 0.02% 85 3676 0.02% 86 4129 0.03% 87 4882 0.03% 88 5300 0.03% 89 5497 0.03% 90 5605 0.04% 91 5859 0.04% 92 6370 0.04% 93 6450 0.04% 94 6970 0.04% 95 7541 0.05% 96 8086 0.05% 97 8786 0.06% 98 9428 0.06% 99 9927 0.06% 100 10881 0.07% 101 11298 0.07% 102 12163 0.08% 103 13012 0.08% 104 13718 0.09% 105 14915 0.09% 106 15859 0.10% 107 16878 0.11% 108 18127 0.12% 109 19221 0.12% 110 19880 0.13% 111 21035 0.13% 112 22361 0.14% 113 23512 0.15% 114 24732 0.16% 115 25844 0.16% 116 27358 0.17% 117 29029 0.18% 118 30338 0.19% 119 32027 0.20% 120 32996 0.21% 121 35750 0.23% 122 36193 0.23% 123 37550 0.24% 124 39090 0.25% 125 40237 0.26% 126 41438 0.26% 127 43693 0.28% 128 45321 0.29% 129 47162 0.30% 130 49643 0.32% 131 51274 0.33% 132 54076 0.34% 133 56221 0.36% 134 58598 0.37% 135 60338 0.38% 136 63194 0.40% 137 66534 0.42% 138 70061 0.45% 139 73441 0.47% 140 78299 0.50% 141 82927 0.53% 142 89691 0.57% 143 97721 0.62% 144 108902 0.69% 145 124569 0.79% 146 148944 0.95% 147 188338 1.20% 148 271376 1.73% 149 507965 3.23% 150 2962760 18.84% 151 9546378 60.69% 15729256 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=25 prefix-density=0.59 prefix-fanout=2.8 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=212.07 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=12.9 sequence=AGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=29 prefix-density=0.79 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=28 fanout-score=32.03 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.7 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7180136 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:17:16 Started mapping on | Feb 10 22:17:16 Finished on | Feb 10 22:20:21 Mapping speed, Million of reads per hour | 306.08 Number of input reads | 15729256 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14157156 Uniquely mapped reads % | 90.01% Average mapped length | 294.62 Number of splices: Total | 13341643 Number of splices: Annotated (sjdb) | 13065547 Number of splices: GT/AG | 13121333 Number of splices: GC/AG | 171675 Number of splices: AT/AC | 10744 Number of splices: Non-canonical | 37891 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356255 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 42897 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.38% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1234134 1234134 1234134 N_multimapping 356255 356255 356255 N_noFeature 407894 14016294 467917 N_ambiguous 147856 1079 66276 UnstrandedReadsAssigned:13601406 PositiveStrandReadsAssigned:139783 NegativeStrandReadsAssigned:13622963 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180136 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180136-trimmed-pair1.fastq SRR7180136-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,729,256 reads, 13,510,745 reads pseudoaligned [quant] estimated average fragment length: 227.656 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7180136.ke.tsv 34699 SRR7180136.se.tsv 87100 total ==> SRR7180136.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.34 1273 47.0482 Potri.005G024800.1.v4.1 1035 808.344 211 17.2815 Potri.004G059700.1.v4.1 961 734.354 36 3.24557 Potri.007G009000.2.v4.1 1416 1189.34 0 0 Potri.003G141000.2.v4.1 2943 2716.34 514 12.5277 Potri.016G087400.1.v4.1 270 82.1641 991 798.519 Potri.015G069301.1.v4.1 564 339.958 0 0 Potri.010G195200.1.v4.1 1773 1546.34 481 20.5936 Potri.012G127500.1.v4.1 977 750.354 14357 1266.75 ==> SRR7180136.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 62 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 425 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 659 SRR7180136 completed mapping pipeline successfully