Starting /dee2/code/volunteer_pipeline.sh SRR7180137 current disk space = 2818724450304 free memory = 1580975788 SRR7180137 SRAfilesize 8289d3a1c21a107946527d144439df41 SRR7180137.sra SRR7180137.sra file validated SRR7180137 is paired end SRR7180137 is conventional basespace SRR7180137 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180137_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.31425 33.0 25.0 33.0 18.0 34.0 2 31.39 33.0 31.0 33.0 27.0 34.0 3 31.699 33.0 31.0 33.0 28.0 34.0 4 32.20725 33.0 32.0 33.0 31.0 34.0 5 32.9645 33.0 33.0 34.0 32.0 34.0 6 36.78875 38.0 37.0 38.0 34.0 38.0 7 37.4635 38.0 38.0 38.0 37.0 38.0 8 37.63975 38.0 38.0 38.0 38.0 38.0 9 37.70725 38.0 38.0 38.0 38.0 38.0 10-14 37.682050000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.7047 38.0 38.0 38.0 38.0 38.0 20-24 37.694849999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.7022 38.0 38.0 38.0 38.0 38.0 30-34 37.6347 38.0 38.0 38.0 38.0 38.0 35-39 37.62435000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.602999999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.61185 38.0 38.0 38.0 38.0 38.0 50-54 37.5476 38.0 38.0 38.0 38.0 38.0 55-59 37.51365 38.0 38.0 38.0 38.0 38.0 60-64 37.4752 38.0 38.0 38.0 37.2 38.0 65-69 37.36955 38.0 38.0 38.0 37.0 38.0 70-74 37.4024 38.0 38.0 38.0 37.0 38.0 75-79 37.33105 38.0 38.0 38.0 37.0 38.0 80-84 37.28015 38.0 38.0 38.0 37.0 38.0 85-89 37.25424999999999 38.0 38.0 38.0 36.8 38.0 90-94 37.16985 38.0 38.0 38.0 36.6 38.0 95-99 37.17495 38.0 38.0 38.0 36.6 38.0 100-104 37.0365 38.0 38.0 38.0 36.0 38.0 105-109 36.9895 38.0 38.0 38.0 36.0 38.0 110-114 36.856550000000006 38.0 38.0 38.0 35.8 38.0 115-119 36.7915 38.0 38.0 38.0 35.0 38.0 120-124 36.65599999999999 38.0 38.0 38.0 34.8 38.0 125-129 36.58989999999999 38.0 38.0 38.0 34.4 38.0 130-134 36.3604 38.0 38.0 38.0 34.0 38.0 135-139 36.119150000000005 38.0 38.0 38.0 33.4 38.0 140-144 35.9585 38.0 37.2 38.0 33.2 38.0 145-149 35.62185 38.0 36.0 38.0 32.6 38.0 150-151 32.89375 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 2.0 17 2.0 18 1.0 19 0.0 20 1.0 21 2.0 22 4.0 23 2.0 24 5.0 25 5.0 26 7.0 27 11.0 28 11.0 29 15.0 30 20.0 31 23.0 32 42.0 33 53.0 34 84.0 35 168.0 36 490.0 37 3046.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.015620863118876 13.132115435530844 13.688112258406143 40.16415144294413 2 21.4 19.400000000000002 39.35 19.85 3 18.625 28.175 27.400000000000002 25.8 4 22.35 34.449999999999996 22.1 21.099999999999998 5 21.3 36.0 25.05 17.65 6 17.05426356589147 37.30932733183296 25.10627656914228 20.530132533133283 7 13.925 19.875 46.25 19.950000000000003 8 18.099999999999998 21.925 31.525 28.449999999999996 9 18.5 21.675 33.074999999999996 26.75 10-14 20.015 29.125 26.0 24.86 15-19 19.66 27.82 28.67 23.849999999999998 20-24 19.61 27.985 28.275 24.13 25-29 19.5 28.9 28.244999999999997 23.355 30-34 20.415 28.335 27.565 23.685000000000002 35-39 19.794999999999998 29.085 27.55 23.57 40-44 20.025000000000002 28.685 27.889999999999997 23.400000000000002 45-49 20.080000000000002 27.77 27.884999999999998 24.265 50-54 20.13 28.735 27.605 23.53 55-59 20.085 28.249999999999996 27.98 23.685000000000002 60-64 19.955000000000002 28.12 27.655 24.27 65-69 20.405 27.750000000000004 28.199999999999996 23.645 70-74 20.14 27.705000000000002 28.425 23.73 75-79 20.165 27.875 27.900000000000002 24.060000000000002 80-84 19.794999999999998 28.610000000000003 27.975 23.62 85-89 20.22 27.93 28.005000000000003 23.845 90-94 20.349999999999998 28.1 27.93 23.62 95-99 20.26 28.64 27.425 23.674999999999997 100-104 20.5 27.6 28.115000000000002 23.785 105-109 20.385 27.224999999999998 28.365000000000002 24.025 110-114 20.635 28.475 27.615000000000002 23.275000000000002 115-119 20.635 28.675 27.560000000000002 23.13 120-124 20.424999999999997 28.485 27.48 23.61 125-129 20.005 27.994999999999997 28.09 23.91 130-134 20.560000000000002 28.395 27.55 23.494999999999997 135-139 20.515 28.249999999999996 27.83 23.405 140-144 21.075 28.205000000000002 27.544999999999998 23.175 145-149 21.025 27.955000000000002 27.405 23.615 150-151 20.37778333750313 28.596447335501622 27.007755816862648 24.0180135101326 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 0.5 24 1.5 25 1.0 26 3.0 27 6.0 28 6.5 29 13.0 30 18.5 31 18.5 32 23.0 33 31.5 34 48.0 35 74.0 36 93.0 37 104.5 38 128.5 39 178.5 40 226.5 41 236.5 42 255.0 43 269.5 44 274.5 45 280.0 46 271.5 47 250.5 48 223.0 49 205.5 50 172.5 51 137.5 52 110.0 53 85.5 54 69.0 55 48.5 56 30.5 57 25.5 58 22.0 59 16.0 60 9.5 61 5.5 62 5.0 63 4.5 64 3.0 65 2.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.2999999999999998 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.7125 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.475 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 3.0125 0.0 0.0 0.0 0.0 134-135 3.3375 0.0 0.0 0.0 0.0 136-137 3.6125 0.0 0.0 0.0 0.0 138-139 3.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACCA 10 0.0068396386 144.9375 4 >>END_MODULE SRR7180137 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180137_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.085 33.0 33.0 34.0 33.0 34.0 2 33.22275 34.0 33.0 34.0 33.0 34.0 3 33.31125 34.0 33.0 34.0 33.0 34.0 4 33.27725 34.0 33.0 34.0 33.0 34.0 5 33.2745 34.0 33.0 34.0 33.0 34.0 6 37.42825 38.0 38.0 38.0 38.0 38.0 7 37.43 38.0 38.0 38.0 38.0 38.0 8 37.472 38.0 38.0 38.0 38.0 38.0 9 37.38725 38.0 38.0 38.0 38.0 38.0 10-14 37.441700000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.400400000000005 38.0 38.0 38.0 37.8 38.0 20-24 37.3908 38.0 38.0 38.0 37.4 38.0 25-29 37.4314 38.0 38.0 38.0 38.0 38.0 30-34 37.3861 38.0 38.0 38.0 37.6 38.0 35-39 37.33685 38.0 38.0 38.0 37.2 38.0 40-44 37.3235 38.0 38.0 38.0 37.0 38.0 45-49 37.344100000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.31705 38.0 38.0 38.0 37.0 38.0 55-59 37.24085 38.0 38.0 38.0 37.0 38.0 60-64 37.20665 38.0 38.0 38.0 36.8 38.0 65-69 37.1108 38.0 38.0 38.0 36.6 38.0 70-74 37.146950000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.0966 38.0 38.0 38.0 36.2 38.0 80-84 37.03775 38.0 38.0 38.0 36.0 38.0 85-89 36.90259999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.8491 38.0 38.0 38.0 35.8 38.0 95-99 36.78 38.0 38.0 38.0 35.6 38.0 100-104 36.649249999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.56925 38.0 38.0 38.0 34.2 38.0 110-114 36.499900000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.36735 38.0 38.0 38.0 34.0 38.0 120-124 36.2528 38.0 38.0 38.0 33.8 38.0 125-129 35.94995 38.0 37.4 38.0 33.0 38.0 130-134 35.77905 38.0 36.2 38.0 32.4 38.0 135-139 35.5137 38.0 36.0 38.0 31.4 38.0 140-144 35.174249999999994 38.0 36.0 38.0 30.6 38.0 145-149 34.68975 38.0 35.6 38.0 29.0 38.0 150-151 31.11275 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 0.0 12 2.0 13 1.0 14 0.0 15 2.0 16 1.0 17 3.0 18 0.0 19 1.0 20 1.0 21 3.0 22 7.0 23 5.0 24 8.0 25 12.0 26 14.0 27 11.0 28 24.0 29 21.0 30 25.0 31 48.0 32 54.0 33 83.0 34 106.0 35 182.0 36 537.0 37 2839.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.52858575727182 15.270812437311937 18.50551654964895 31.695085255767303 2 24.362181090545274 20.885442721360683 38.444222111055524 16.30815407703852 3 20.830207551887973 24.63115778944736 31.657914478619652 22.88072018004501 4 22.475 33.875 23.45 20.200000000000003 5 23.455863965991497 36.55913978494624 22.455613903475868 17.5293823455864 6 17.45 39.324999999999996 23.825 19.400000000000002 7 17.525 17.025000000000002 43.6 21.85 8 19.900000000000002 22.75 28.749999999999996 28.599999999999998 9 22.5 23.974999999999998 28.925 24.6 10-14 23.64 27.889999999999997 25.869999999999997 22.6 15-19 23.225 28.015 27.52 21.240000000000002 20-24 22.935 28.225 27.279999999999998 21.560000000000002 25-29 22.705000000000002 28.505000000000003 27.975 20.815 30-34 22.80570142535634 28.442110527631908 27.861965491372843 20.89022255563891 35-39 22.343406043626178 28.46708024814889 27.65159095457274 21.537922753652193 40-44 22.82597818472931 27.96457520264185 27.799459621735213 21.409986990893625 45-49 23.03 28.449999999999996 27.73 20.79 50-54 23.01 28.74 27.224999999999998 21.025 55-59 23.185 28.645 27.24 20.93 60-64 23.3 28.07 27.76 20.87 65-69 23.69 27.83 27.935 20.544999999999998 70-74 23.395 28.244999999999997 27.61 20.75 75-79 23.150000000000002 28.575 27.584999999999997 20.69 80-84 23.345 28.285 27.66 20.71 85-89 23.419999999999998 28.09 27.98 20.51 90-94 23.75 28.63 27.455000000000002 20.165 95-99 23.915 28.16 27.229999999999997 20.695 100-104 23.35 28.455000000000002 27.884999999999998 20.31 105-109 23.71 27.400000000000002 28.62 20.27 110-114 24.104999999999997 27.855 27.77 20.27 115-119 23.485 28.15 27.944999999999997 20.419999999999998 120-124 24.51 28.060000000000002 27.525 19.905 125-129 24.224999999999998 27.93 27.665 20.18 130-134 24.445 28.244999999999997 27.49 19.82 135-139 24.37 27.855 27.55 20.225 140-144 25.15 27.685 27.615000000000002 19.55 145-149 24.375 28.535 27.425 19.665 150-151 24.486215538847116 27.869674185463662 27.819548872180448 19.824561403508774 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 0.5 26 1.5 27 3.0 28 6.5 29 8.0 30 11.5 31 15.5 32 20.0 33 27.0 34 38.5 35 51.0 36 67.0 37 88.5 38 124.5 39 168.5 40 197.5 41 235.0 42 270.0 43 292.5 44 324.5 45 313.0 46 284.0 47 270.0 48 242.5 49 203.0 50 170.0 51 142.5 52 98.0 53 77.0 54 64.0 55 46.5 56 39.0 57 29.5 58 17.5 59 10.5 60 8.0 61 7.0 62 7.5 63 5.0 64 3.0 65 2.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.05 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.025 35-39 0.06 40-44 0.06999999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.0875000000000004 0.0 0.0 0.0 0.0 126-127 2.1875 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.6625 0.0 0.0 0.0 0.0 132-133 2.9875 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.5875000000000004 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGTTG 10 0.006830828 145.0 1 AGGGAAA 20 0.00593511 29.0 140-144 TTTTTTT 40 0.0076550315 18.125 110-114 >>END_MODULE Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904725 spots for SRR7180137.sra Written 904725 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra Read 904713 spots for SRR7180137.sra Written 904713 spots for SRR7180137.sra SRR ids: ['SRR7180137.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1kcwt6_d SRR7180137.sra spots: 18094272 blocks: [[1, 904713], [904714, 1809426], [1809427, 2714139], [2714140, 3618852], [3618853, 4523565], [4523566, 5428278], [5428279, 6332991], [6332992, 7237704], [7237705, 8142417], [8142418, 9047130], [9047131, 9951843], [9951844, 10856556], [10856557, 11761269], [11761270, 12665982], [12665983, 13570695], [13570696, 14475408], [14475409, 15380121], [15380122, 16284834], [16284835, 17189547], [17189548, 18094272]] SRR7180137 file size 6109854 SRR7180137 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180137 SRR7180137_1.fastq SRR7180137_2.fastq Input file: SRR7180137_1.fastq Paired file: SRR7180137_2.fastq trimmed: SRR7180137-trimmed-pair1.fastq, SRR7180137-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 16:04:04 2025 >> started Thu Apr 10 16:04:22 2025 >> done (17.971s) 18094272 read pairs processed; of these: 8121 ( 0.04%) short read pairs filtered out after trimming by size control 5953 ( 0.03%) empty read pairs filtered out after trimming by size control 18080198 (99.92%) read pairs available; of these: 6219727 (34.40%) trimmed read pairs available after processing 11860471 (65.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 4 0.00% 27 3 0.00% 28 1 0.00% 29 2 0.00% 30 5 0.00% 31 2 0.00% 32 3 0.00% 33 8 0.00% 34 5 0.00% 35 2 0.00% 36 2 0.00% 37 6 0.00% 38 14 0.00% 39 45 0.00% 40 9 0.00% 41 7 0.00% 42 16 0.00% 43 12 0.00% 44 7 0.00% 45 33 0.00% 46 3 0.00% 47 8 0.00% 48 7 0.00% 49 10 0.00% 50 14 0.00% 51 15 0.00% 52 24 0.00% 53 36 0.00% 54 30 0.00% 55 104 0.00% 56 140 0.00% 57 53 0.00% 58 38 0.00% 59 37 0.00% 60 59 0.00% 61 76 0.00% 62 138 0.00% 63 100 0.00% 64 90 0.00% 65 105 0.00% 66 111 0.00% 67 137 0.00% 68 149 0.00% 69 171 0.00% 70 204 0.00% 71 191 0.00% 72 259 0.00% 73 341 0.00% 74 371 0.00% 75 425 0.00% 76 519 0.00% 77 561 0.00% 78 665 0.00% 79 823 0.00% 80 823 0.00% 81 906 0.01% 82 1092 0.01% 83 1234 0.01% 84 1739 0.01% 85 2197 0.01% 86 2367 0.01% 87 2693 0.01% 88 3039 0.02% 89 3214 0.02% 90 3447 0.02% 91 3696 0.02% 92 4072 0.02% 93 4365 0.02% 94 4714 0.03% 95 5053 0.03% 96 5548 0.03% 97 5850 0.03% 98 6421 0.04% 99 6863 0.04% 100 7354 0.04% 101 7831 0.04% 102 8339 0.05% 103 8949 0.05% 104 9600 0.05% 105 10391 0.06% 106 11165 0.06% 107 11833 0.07% 108 12576 0.07% 109 13231 0.07% 110 13931 0.08% 111 14747 0.08% 112 15761 0.09% 113 16411 0.09% 114 17548 0.10% 115 18437 0.10% 116 20102 0.11% 117 20958 0.12% 118 22036 0.12% 119 23481 0.13% 120 25602 0.14% 121 27219 0.15% 122 26381 0.15% 123 27061 0.15% 124 29202 0.16% 125 30432 0.17% 126 31200 0.17% 127 33039 0.18% 128 34299 0.19% 129 35911 0.20% 130 38123 0.21% 131 39466 0.22% 132 41570 0.23% 133 43890 0.24% 134 45869 0.25% 135 48530 0.27% 136 51182 0.28% 137 54260 0.30% 138 57420 0.32% 139 61622 0.34% 140 66111 0.37% 141 71184 0.39% 142 77857 0.43% 143 85908 0.48% 144 98227 0.54% 145 111613 0.62% 146 133271 0.74% 147 177008 0.98% 148 267842 1.48% 149 544531 3.01% 150 3443669 19.05% 151 11860471 65.60% 18080198 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.75 fanout-score-rank=13 prefix-density=0.31 prefix-fanout=3.8 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=22.11 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.1 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=27 prefix-density=0.37 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=13.66 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=3.2 sequence=AGACCATCACCTTGGAGGTGGAGAGCTCTGA SRR7180137 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 16:05:08 Started mapping on | Apr 10 16:05:08 Finished on | Apr 10 16:07:28 Mapping speed, Million of reads per hour | 464.92 Number of input reads | 18080198 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16919443 Uniquely mapped reads % | 93.58% Average mapped length | 296.83 Number of splices: Total | 17546117 Number of splices: Annotated (sjdb) | 17257031 Number of splices: GT/AG | 17266208 Number of splices: GC/AG | 224686 Number of splices: AT/AC | 12363 Number of splices: Non-canonical | 42860 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426328 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 42601 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 742889 742889 742889 N_multimapping 426328 426328 426328 N_noFeature 376788 16778880 435275 N_ambiguous 165486 936 82968 UnstrandedReadsAssigned:16377169 PositiveStrandReadsAssigned:139627 NegativeStrandReadsAssigned:16401200 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180137 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180137-trimmed-pair1.fastq SRR7180137-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,080,198 reads, 16,293,693 reads pseudoaligned [quant] estimated average fragment length: 248.7 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52401 SRR7180137.ke.tsv 34699 SRR7180137.se.tsv 87100 total ==> SRR7180137.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.3 1226 43.8646 Potri.005G024800.1.v4.1 1035 787.3 176 14.1593 Potri.004G059700.1.v4.1 961 713.326 34 3.01899 Potri.007G009000.2.v4.1 1416 1168.3 0 0 Potri.003G141000.2.v4.1 2943 2695.3 640 15.0399 Potri.016G087400.1.v4.1 270 74.9838 1247 1053.34 Potri.015G069301.1.v4.1 564 320.564 0 0 Potri.010G195200.1.v4.1 1773 1525.3 391 16.2365 Potri.012G127500.1.v4.1 977 729.316 3736 324.461 ==> SRR7180137.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 37 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 396 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 180 SRR7180137 completed mapping pipeline successfully