Starting /dee2/code/volunteer_pipeline.sh SRR7180138 current disk space = 3057154760704 free memory = 1170810856 SRR7180138 SRAfilesize 4d433562c016c6df95928e903273bd25 SRR7180138.sra SRR7180138.sra file validated SRR7180138 is paired end SRR7180138 is conventional basespace SRR7180138 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180138_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.17625 33.0 33.0 34.0 30.0 34.0 2 32.712 33.0 33.0 34.0 31.0 34.0 3 32.51325 33.0 33.0 34.0 30.0 34.0 4 32.9 33.0 33.0 34.0 31.0 34.0 5 33.24875 34.0 33.0 34.0 33.0 34.0 6 36.719 38.0 37.0 38.0 34.0 38.0 7 37.27625 38.0 38.0 38.0 36.0 38.0 8 37.41925 38.0 38.0 38.0 37.0 38.0 9 37.612 38.0 38.0 38.0 38.0 38.0 10-14 37.6406 38.0 38.0 38.0 38.0 38.0 15-19 37.62815 38.0 38.0 38.0 38.0 38.0 20-24 37.6453 38.0 38.0 38.0 38.0 38.0 25-29 37.6072 38.0 38.0 38.0 38.0 38.0 30-34 37.60305 38.0 38.0 38.0 38.0 38.0 35-39 37.5605 38.0 38.0 38.0 38.0 38.0 40-44 37.54395 38.0 38.0 38.0 38.0 38.0 45-49 37.48895 38.0 38.0 38.0 38.0 38.0 50-54 37.4709 38.0 38.0 38.0 37.8 38.0 55-59 37.4544 38.0 38.0 38.0 37.2 38.0 60-64 37.4046 38.0 38.0 38.0 37.0 38.0 65-69 37.33455 38.0 38.0 38.0 37.0 38.0 70-74 37.33985 38.0 38.0 38.0 37.0 38.0 75-79 37.278 38.0 38.0 38.0 37.0 38.0 80-84 37.21124999999999 38.0 38.0 38.0 36.6 38.0 85-89 37.111450000000005 38.0 38.0 38.0 36.4 38.0 90-94 37.09060000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.987300000000005 38.0 38.0 38.0 36.0 38.0 100-104 36.87065 38.0 38.0 38.0 35.8 38.0 105-109 36.8477 38.0 38.0 38.0 35.6 38.0 110-114 36.70615 38.0 38.0 38.0 35.0 38.0 115-119 36.622400000000006 38.0 38.0 38.0 34.6 38.0 120-124 36.549549999999996 38.0 38.0 38.0 34.2 38.0 125-129 36.2893 38.0 38.0 38.0 34.0 38.0 130-134 36.1404 38.0 38.0 38.0 33.6 38.0 135-139 35.92855 38.0 37.2 38.0 33.0 38.0 140-144 35.7183 38.0 36.4 38.0 32.6 38.0 145-149 35.42195 38.0 36.0 38.0 32.2 38.0 150-151 32.639625 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 1.0 16 2.0 17 2.0 18 2.0 19 1.0 20 0.0 21 3.0 22 2.0 23 8.0 24 5.0 25 7.0 26 8.0 27 12.0 28 12.0 29 20.0 30 27.0 31 33.0 32 42.0 33 55.0 34 86.0 35 186.0 36 505.0 37 2974.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.14323258869908 14.086727989487516 14.480946123521681 40.289093298291725 2 19.424280350438046 18.523153942428035 39.44931163954944 22.60325406758448 3 18.475 25.55 26.924999999999997 29.049999999999997 4 21.975 32.875 21.425 23.724999999999998 5 20.95 36.225 24.575 18.25 6 17.224999999999998 36.675000000000004 25.124999999999996 20.974999999999998 7 14.149999999999999 20.95 44.55 20.349999999999998 8 18.2 21.175 30.875000000000004 29.75 9 16.725 24.099999999999998 32.725 26.450000000000003 10-14 19.425 28.895 26.584999999999997 25.095 15-19 19.744999999999997 28.175 28.04 24.04 20-24 19.57 27.834999999999997 28.285 24.310000000000002 25-29 20.06 28.585 27.71 23.645 30-34 19.400000000000002 28.64 28.050000000000004 23.91 35-39 19.939999999999998 28.09 27.675 24.295 40-44 19.655 29.160000000000004 27.589999999999996 23.595 45-49 19.755 27.905 27.529999999999998 24.81 50-54 19.23 28.525 27.805000000000003 24.44 55-59 19.605 28.744999999999997 27.82 23.830000000000002 60-64 19.905 27.894999999999996 27.445000000000004 24.755 65-69 20.349999999999998 27.92 27.965 23.765 70-74 20.200000000000003 27.560000000000002 28.125 24.115000000000002 75-79 19.73 27.87 28.52 23.880000000000003 80-84 20.01 28.04 27.445000000000004 24.505 85-89 19.705000000000002 28.03 27.68 24.585 90-94 20.375 28.29 27.315 24.02 95-99 20.095 28.29 27.560000000000002 24.055 100-104 21.240000000000002 27.565 27.54 23.655 105-109 19.939999999999998 27.925 28.26 23.875 110-114 20.525 27.625 27.845 24.005000000000003 115-119 21.25 28.275 27.1 23.375 120-124 20.3 28.07 27.765 23.865 125-129 20.849999999999998 28.12 27.150000000000002 23.880000000000003 130-134 21.145 27.589999999999996 27.860000000000003 23.405 135-139 21.135 27.71 27.235 23.919999999999998 140-144 20.945 27.365000000000002 27.865000000000002 23.825 145-149 20.845 27.994999999999997 27.975 23.185 150-151 21.188242651657283 27.204502814258912 27.717323327079423 23.889931207004377 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.5 24 1.5 25 3.0 26 5.0 27 4.5 28 6.5 29 10.0 30 13.0 31 18.0 32 30.5 33 43.0 34 53.5 35 63.5 36 81.0 37 104.0 38 131.5 39 162.5 40 190.0 41 228.5 42 256.5 43 270.5 44 279.5 45 288.5 46 270.0 47 243.0 48 240.5 49 212.0 50 169.0 51 129.0 52 114.0 53 104.0 54 73.0 55 54.0 56 38.0 57 28.0 58 20.5 59 14.5 60 12.0 61 7.5 62 4.5 63 3.5 64 3.0 65 2.5 66 2.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.875 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.7250000000000001 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 1.0 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.4 0.0 0.0 0.0 0.0 136-137 1.5125000000000002 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTTCT 10 0.0068396386 144.9375 145 >>END_MODULE SRR7180138 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180138_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06775 34.0 33.0 34.0 32.0 34.0 2 33.196 34.0 33.0 34.0 33.0 34.0 3 33.30425 34.0 33.0 34.0 33.0 34.0 4 33.2775 34.0 33.0 34.0 33.0 34.0 5 33.331 34.0 33.0 34.0 33.0 34.0 6 37.3945 38.0 38.0 38.0 37.0 38.0 7 37.498 38.0 38.0 38.0 38.0 38.0 8 37.51725 38.0 38.0 38.0 38.0 38.0 9 37.51825 38.0 38.0 38.0 38.0 38.0 10-14 37.4411 38.0 38.0 38.0 38.0 38.0 15-19 37.3845 38.0 38.0 38.0 37.4 38.0 20-24 37.3404 38.0 38.0 38.0 37.4 38.0 25-29 37.3244 38.0 38.0 38.0 37.2 38.0 30-34 37.2553 38.0 38.0 38.0 37.0 38.0 35-39 37.16495 38.0 38.0 38.0 37.0 38.0 40-44 37.1589 38.0 38.0 38.0 37.0 38.0 45-49 37.20155 38.0 38.0 38.0 37.0 38.0 50-54 37.21745 38.0 38.0 38.0 37.0 38.0 55-59 37.19545 38.0 38.0 38.0 37.0 38.0 60-64 37.05035 38.0 38.0 38.0 36.4 38.0 65-69 37.04355 38.0 38.0 38.0 36.2 38.0 70-74 36.9445 38.0 38.0 38.0 36.0 38.0 75-79 36.980000000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.887299999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.80015 38.0 38.0 38.0 35.4 38.0 90-94 36.71875 38.0 38.0 38.0 35.2 38.0 95-99 36.6034 38.0 38.0 38.0 35.0 38.0 100-104 36.48185 38.0 38.0 38.0 34.0 38.0 105-109 36.29205 38.0 38.0 38.0 34.0 38.0 110-114 36.2826 38.0 38.0 38.0 33.8 38.0 115-119 36.07685 38.0 38.0 38.0 33.8 38.0 120-124 35.929899999999996 38.0 37.6 38.0 33.2 38.0 125-129 35.805 38.0 37.0 38.0 33.0 38.0 130-134 35.59195 38.0 36.4 38.0 31.8 38.0 135-139 35.08895 38.0 36.0 38.0 28.6 38.0 140-144 34.8343 38.0 35.6 38.0 28.2 38.0 145-149 34.491550000000004 38.0 35.4 38.0 27.2 38.0 150-151 30.906 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 3.0 11 1.0 12 2.0 13 2.0 14 3.0 15 2.0 16 2.0 17 5.0 18 4.0 19 2.0 20 4.0 21 5.0 22 6.0 23 5.0 24 5.0 25 12.0 26 12.0 27 20.0 28 25.0 29 29.0 30 39.0 31 35.0 32 68.0 33 66.0 34 114.0 35 224.0 36 571.0 37 2726.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.675 16.1 18.8 32.425 2 25.3 20.625 37.275000000000006 16.8 3 20.1 25.224999999999998 32.824999999999996 21.85 4 24.099999999999998 32.25 22.775000000000002 20.875 5 22.95 36.925000000000004 22.625 17.5 6 18.3295823955989 37.65941485371343 22.980745186296573 21.030257564391096 7 17.90447611902976 18.00450112528132 42.56064016004001 21.530382595648913 8 19.575 22.650000000000002 28.050000000000004 29.725 9 21.255313828457115 25.93148287071768 29.207301825456366 23.605901475368842 10-14 23.16079019754939 27.926981745436358 25.941485371342836 22.970742685671418 15-19 22.930732683170792 27.67691922980745 27.431857964491122 21.960490122530633 20-24 21.976592977893368 28.48854656396919 27.87336200860258 21.66149844953486 25-29 22.416382936110555 28.11936711395954 27.66372922090927 21.80052072902063 30-34 22.547349433811004 28.078965828239305 27.833450245515586 21.540234492434113 35-39 23.14020566842237 27.75018811136193 27.43917732631051 21.670428893905193 40-44 22.218320457509783 28.092705929567575 28.117788702718972 21.571184910203673 45-49 22.842131598699027 27.74080560420315 27.675756817613212 21.74130597948461 50-54 22.925731432858214 28.29707426856714 27.871967991997998 20.905226306576644 55-59 22.840710177544384 27.94698674668667 28.092023005751436 21.120280070017504 60-64 23.710927731932983 28.00700175043761 27.721930482620653 20.560140035008754 65-69 23.53088272068017 28.00700175043761 27.506876719179797 20.955238809702426 70-74 23.44586146536634 28.60715178794699 27.261815453863463 20.685171292823206 75-79 23.355838959739934 28.207051762940733 27.62190547636909 20.81520380095024 80-84 23.700925231307828 28.142035508877218 26.961740435108776 21.195298824706178 85-89 23.390847711927982 27.901975493873472 27.9869967491873 20.72018004501125 90-94 23.411170558527928 27.546377318865943 27.40137006850343 21.641082054102707 95-99 23.244999999999997 27.915 27.66 21.18 100-104 23.592359235923592 27.337733773377337 28.11781178117812 20.95209520952095 105-109 24.055 28.01 27.41 20.525 110-114 23.466173308665432 27.736386819340968 28.171408570428518 20.626031301565078 115-119 24.376218810940546 27.246362318115906 27.67138356917846 20.706035301765088 120-124 24.381219060953047 27.10635531776589 27.706385319265962 20.8060403020151 125-129 23.357335733573358 27.432743274327432 28.232823282328233 20.977097709770977 130-134 23.299659931986398 28.225645129025807 27.560512102420482 20.914182836567313 135-139 24.127412741274128 27.312731273127312 27.987798779877988 20.572057205720572 140-144 23.881194059702985 27.796389819490976 27.641382069103454 20.681034051702586 145-149 24.08 27.894999999999996 27.455000000000002 20.57 150-151 25.006276675872456 28.16972131559126 27.02736630680392 19.796635701732363 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 1.0 26 2.5 27 3.5 28 4.5 29 6.0 30 8.0 31 11.5 32 14.0 33 27.0 34 39.0 35 59.0 36 76.5 37 89.0 38 122.5 39 164.5 40 202.0 41 233.5 42 271.0 43 276.0 44 285.5 45 289.5 46 283.0 47 281.5 48 252.5 49 213.5 50 169.0 51 137.0 52 104.0 53 88.0 54 75.5 55 48.0 56 34.5 57 29.5 58 24.5 59 17.5 60 14.0 61 9.0 62 8.0 63 8.5 64 3.5 65 1.5 66 0.5 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.0 9 0.025 10-14 0.025 15-19 0.025 20-24 0.03 25-29 0.13999999999999999 30-34 0.21 35-39 0.325 40-44 0.33 45-49 0.075 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.005 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.005 115-119 0.005 120-124 0.005 125-129 0.01 130-134 0.02 135-139 0.01 140-144 0.005 145-149 0.0 150-151 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.1124999999999998 0.0 0.0 0.0 0.0 132-133 1.275 0.0 0.0 0.0 0.0 134-135 1.4 0.0 0.0 0.0 0.0 136-137 1.5125000000000002 0.0 0.0 0.0 0.0 138-139 1.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757268 spots for SRR7180138.sra Written 757268 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra Read 757258 spots for SRR7180138.sra Written 757258 spots for SRR7180138.sra SRR ids: ['SRR7180138.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tp82pg9_ SRR7180138.sra spots: 15145170 blocks: [[1, 757258], [757259, 1514516], [1514517, 2271774], [2271775, 3029032], [3029033, 3786290], [3786291, 4543548], [4543549, 5300806], [5300807, 6058064], [6058065, 6815322], [6815323, 7572580], [7572581, 8329838], [8329839, 9087096], [9087097, 9844354], [9844355, 10601612], [10601613, 11358870], [11358871, 12116128], [12116129, 12873386], [12873387, 13630644], [13630645, 14387902], [14387903, 15145170]] SRR7180138 file size 5110500 SRR7180138 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180138 SRR7180138_1.fastq SRR7180138_2.fastq Input file: SRR7180138_1.fastq Paired file: SRR7180138_2.fastq trimmed: SRR7180138-trimmed-pair1.fastq, SRR7180138-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:11:53 2025 >> started Mon Feb 10 22:12:09 2025 >> done (15.622s) 15145170 read pairs processed; of these: 16469 ( 0.11%) short read pairs filtered out after trimming by size control 9641 ( 0.06%) empty read pairs filtered out after trimming by size control 15119060 (99.83%) read pairs available; of these: 4777358 (31.60%) trimmed read pairs available after processing 10341702 (68.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 3 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 4 0.00% 26 1 0.00% 27 3 0.00% 28 1 0.00% 29 9 0.00% 30 5 0.00% 31 2 0.00% 32 2 0.00% 33 5 0.00% 34 3 0.00% 35 2 0.00% 36 4 0.00% 37 23 0.00% 38 6 0.00% 39 12 0.00% 40 7 0.00% 41 3 0.00% 42 10 0.00% 43 12 0.00% 44 20 0.00% 45 40 0.00% 46 38 0.00% 47 60 0.00% 48 25 0.00% 49 63 0.00% 50 18 0.00% 51 92 0.00% 52 54 0.00% 53 89 0.00% 54 64 0.00% 55 126 0.00% 56 124 0.00% 57 63 0.00% 58 33 0.00% 59 29 0.00% 60 40 0.00% 61 53 0.00% 62 36 0.00% 63 49 0.00% 64 41 0.00% 65 58 0.00% 66 49 0.00% 67 86 0.00% 68 80 0.00% 69 83 0.00% 70 101 0.00% 71 106 0.00% 72 142 0.00% 73 161 0.00% 74 190 0.00% 75 216 0.00% 76 272 0.00% 77 270 0.00% 78 331 0.00% 79 344 0.00% 80 375 0.00% 81 432 0.00% 82 497 0.00% 83 572 0.00% 84 1098 0.01% 85 1455 0.01% 86 1592 0.01% 87 1787 0.01% 88 1896 0.01% 89 1960 0.01% 90 1995 0.01% 91 2108 0.01% 92 2263 0.01% 93 2293 0.02% 94 2388 0.02% 95 2548 0.02% 96 2773 0.02% 97 2925 0.02% 98 3048 0.02% 99 3179 0.02% 100 3386 0.02% 101 3567 0.02% 102 3697 0.02% 103 3904 0.03% 104 4275 0.03% 105 4543 0.03% 106 4763 0.03% 107 5194 0.03% 108 5523 0.04% 109 5741 0.04% 110 5967 0.04% 111 6386 0.04% 112 6553 0.04% 113 7080 0.05% 114 7708 0.05% 115 8128 0.05% 116 8677 0.06% 117 9137 0.06% 118 9735 0.06% 119 11673 0.08% 120 12006 0.08% 121 12079 0.08% 122 11407 0.08% 123 11917 0.08% 124 12603 0.08% 125 13223 0.09% 126 13825 0.09% 127 14980 0.10% 128 15544 0.10% 129 16516 0.11% 130 17627 0.12% 131 18672 0.12% 132 20219 0.13% 133 21557 0.14% 134 22879 0.15% 135 24282 0.16% 136 26787 0.18% 137 28811 0.19% 138 31086 0.21% 139 34143 0.23% 140 37655 0.25% 141 41358 0.27% 142 47353 0.31% 143 54418 0.36% 144 64398 0.43% 145 77244 0.51% 146 98177 0.65% 147 136530 0.90% 148 218684 1.45% 149 468015 3.10% 150 2986770 19.75% 151 10341702 68.40% 15119060 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=8.05 fanout-score-rank=17 prefix-density=0.87 prefix-fanout=2.5 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=367.32 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=33.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=29 prefix-density=0.60 prefix-fanout=2.4 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=102.20 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=19.9 sequence=CAAAGAAGAAGAT SRR7180138 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:12:50 Started mapping on | Feb 10 22:12:50 Finished on | Feb 10 22:14:27 Mapping speed, Million of reads per hour | 561.12 Number of input reads | 15119060 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14428724 Uniquely mapped reads % | 95.43% Average mapped length | 298.43 Number of splices: Total | 15337801 Number of splices: Annotated (sjdb) | 15106708 Number of splices: GT/AG | 15109958 Number of splices: GC/AG | 185871 Number of splices: AT/AC | 10391 Number of splices: Non-canonical | 31581 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380625 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 30149 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.80% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 320690 320690 320690 N_multimapping 380625 380625 380625 N_noFeature 240575 14312146 287979 N_ambiguous 136915 722 67293 UnstrandedReadsAssigned:14051234 PositiveStrandReadsAssigned:115856 NegativeStrandReadsAssigned:14073452 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7180138 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180138-trimmed-pair1.fastq SRR7180138-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,119,060 reads, 13,867,258 reads pseudoaligned [quant] estimated average fragment length: 290.963 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52401 SRR7180138.ke.tsv 34699 SRR7180138.se.tsv 87100 total ==> SRR7180138.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.04 753 27.4474 Potri.005G024800.1.v4.1 1035 745.037 215 18.1769 Potri.004G059700.1.v4.1 961 671.073 36 3.37903 Potri.007G009000.2.v4.1 1416 1126.04 0 0 Potri.003G141000.2.v4.1 2943 2653.04 466 11.0638 Potri.016G087400.1.v4.1 270 60.3239 1309 1366.82 Potri.015G069301.1.v4.1 564 282.087 0 0 Potri.010G195200.1.v4.1 1773 1483.04 148 6.28593 Potri.012G127500.1.v4.1 977 687.056 2267 207.835 ==> SRR7180138.se.tsv <== Potri.001G166300.v4.1 4 Potri.001G448400.v4.1 34 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 376 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 167 SRR7180138 completed mapping pipeline successfully