Starting /dee2/code/volunteer_pipeline.sh SRR7180139 current disk space = 3057452355584 free memory = 1504366424 SRR7180139 SRAfilesize ab7419a8816cc812e142cb4e506e8365 SRR7180139.sra SRR7180139.sra file validated SRR7180139 is paired end SRR7180139 is conventional basespace SRR7180139 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.61675 33.0 32.0 34.0 25.0 34.0 2 32.444 33.0 33.0 34.0 29.0 34.0 3 32.14875 33.0 33.0 34.0 29.0 34.0 4 32.25025 33.0 33.0 34.0 31.0 34.0 5 32.378 33.0 33.0 33.0 31.0 34.0 6 36.8085 38.0 37.0 38.0 34.0 38.0 7 37.32025 38.0 38.0 38.0 36.0 38.0 8 37.40975 38.0 38.0 38.0 37.0 38.0 9 37.54825 38.0 38.0 38.0 37.0 38.0 10-14 37.6343 38.0 38.0 38.0 38.0 38.0 15-19 37.650999999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.6655 38.0 38.0 38.0 38.0 38.0 25-29 37.6586 38.0 38.0 38.0 38.0 38.0 30-34 37.6539 38.0 38.0 38.0 38.0 38.0 35-39 37.61945000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.624399999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.58755 38.0 38.0 38.0 38.0 38.0 50-54 37.5612 38.0 38.0 38.0 38.0 38.0 55-59 37.5162 38.0 38.0 38.0 38.0 38.0 60-64 37.47185 38.0 38.0 38.0 37.0 38.0 65-69 37.42205 38.0 38.0 38.0 37.0 38.0 70-74 37.43775 38.0 38.0 38.0 37.0 38.0 75-79 37.388850000000005 38.0 38.0 38.0 37.0 38.0 80-84 37.31125000000001 38.0 38.0 38.0 37.0 38.0 85-89 37.310249999999996 38.0 38.0 38.0 37.0 38.0 90-94 37.23524999999999 38.0 38.0 38.0 36.6 38.0 95-99 37.1792 38.0 38.0 38.0 36.0 38.0 100-104 37.0965 38.0 38.0 38.0 36.0 38.0 105-109 37.00985000000001 38.0 38.0 38.0 36.0 38.0 110-114 36.92715 38.0 38.0 38.0 35.6 38.0 115-119 36.8126 38.0 38.0 38.0 35.0 38.0 120-124 36.7341 38.0 38.0 38.0 35.0 38.0 125-129 36.53125 38.0 38.0 38.0 34.2 38.0 130-134 36.32105 38.0 38.0 38.0 34.0 38.0 135-139 36.169799999999995 38.0 37.6 38.0 33.4 38.0 140-144 35.98715 38.0 37.4 38.0 33.0 38.0 145-149 35.65265 38.0 36.0 38.0 33.0 38.0 150-151 32.77725 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 4.0 22 4.0 23 2.0 24 4.0 25 8.0 26 6.0 27 8.0 28 10.0 29 21.0 30 29.0 31 26.0 32 37.0 33 58.0 34 93.0 35 176.0 36 459.0 37 3051.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.924855491329478 14.976353126642145 12.716763005780345 41.38202837624803 2 19.989992494370778 20.390292719539655 38.779084313234925 20.84063047285464 3 17.849999999999998 27.175 25.874999999999996 29.099999999999998 4 21.025 34.9 22.275 21.8 5 20.474999999999998 35.475 24.875 19.175 6 17.549999999999997 35.85 26.25 20.349999999999998 7 13.700000000000001 21.349999999999998 45.1 19.85 8 17.724999999999998 21.075 31.075000000000003 30.125 9 18.15 22.425 32.324999999999996 27.1 10-14 20.145 28.515 26.855 24.485 15-19 20.14 28.155 28.435 23.27 20-24 19.85 28.785 27.625 23.74 25-29 19.255 29.38 27.689999999999998 23.674999999999997 30-34 19.765 29.205 27.71 23.32 35-39 19.61 29.085 27.805000000000003 23.5 40-44 19.895 28.83 27.76 23.515 45-49 20.119999999999997 28.854999999999997 27.595 23.43 50-54 20.305 28.865000000000002 27.845 22.985 55-59 19.66 28.799999999999997 27.939999999999998 23.599999999999998 60-64 20.135 28.499999999999996 27.700000000000003 23.665 65-69 20.05 27.860000000000003 28.095 23.995 70-74 19.97 28.375 28.044999999999998 23.61 75-79 20.1 28.375 27.950000000000003 23.575 80-84 20.01 28.54 28.13 23.32 85-89 20.655 28.660000000000004 27.3 23.385 90-94 20.555 28.42 27.965 23.06 95-99 20.195 28.575 27.715 23.515 100-104 20.195 28.025 27.83 23.95 105-109 20.5 28.08 27.665 23.755000000000003 110-114 20.49 28.07 28.055000000000003 23.385 115-119 20.435 27.83 28.725 23.01 120-124 20.29 28.24 27.825 23.645 125-129 20.27 28.194999999999997 27.744999999999997 23.79 130-134 20.175 28.685 27.875 23.265 135-139 20.355 27.51 28.395 23.74 140-144 21.065 27.800000000000004 28.050000000000004 23.085 145-149 20.595 27.93 27.93 23.544999999999998 150-151 20.34767383691846 27.801400700350175 28.05152576288144 23.799399699849925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 2.0 25 3.0 26 3.5 27 5.0 28 5.5 29 11.0 30 20.5 31 27.5 32 42.0 33 50.5 34 56.5 35 81.5 36 102.5 37 119.5 38 140.5 39 178.0 40 213.0 41 227.0 42 254.5 43 271.0 44 278.0 45 272.0 46 256.5 47 240.0 48 208.0 49 182.0 50 156.5 51 134.0 52 112.0 53 87.0 54 66.0 55 46.5 56 33.5 57 28.0 58 20.0 59 15.5 60 15.0 61 9.0 62 4.0 63 5.0 64 5.0 65 2.5 66 1.0 67 0.5 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8500000000000005 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7625 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1875 0.0 0.0 0.0 0.0 126-127 1.2375 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.6124999999999998 0.0 0.0 0.0 0.0 132-133 1.75 0.0 0.0 0.0 0.0 134-135 1.9625 0.0 0.0 0.0 0.0 136-137 2.125 0.0 0.0 0.0 0.0 138-139 2.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACGG 10 0.0068396386 144.9375 2 TTGCAAT 10 0.0068396386 144.9375 9 ACGTTCA 10 0.0068396386 144.9375 3 CAACGGT 10 0.0068396386 144.9375 3 >>END_MODULE SRR7180139 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180139_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14075 34.0 33.0 34.0 33.0 34.0 2 33.27375 34.0 33.0 34.0 33.0 34.0 3 33.354 34.0 33.0 34.0 33.0 34.0 4 33.36825 34.0 33.0 34.0 33.0 34.0 5 33.3575 34.0 33.0 34.0 33.0 34.0 6 37.58525 38.0 38.0 38.0 38.0 38.0 7 37.6005 38.0 38.0 38.0 38.0 38.0 8 37.62 38.0 38.0 38.0 38.0 38.0 9 37.61525 38.0 38.0 38.0 38.0 38.0 10-14 37.53145 38.0 38.0 38.0 38.0 38.0 15-19 37.472249999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.443099999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.42975 38.0 38.0 38.0 38.0 38.0 30-34 37.4028 38.0 38.0 38.0 38.0 38.0 35-39 37.345349999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.314 38.0 38.0 38.0 37.6 38.0 45-49 37.35155 38.0 38.0 38.0 37.4 38.0 50-54 37.37595 38.0 38.0 38.0 37.0 38.0 55-59 37.35850000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.28415 38.0 38.0 38.0 37.0 38.0 65-69 37.239399999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.21445 38.0 38.0 38.0 37.0 38.0 75-79 37.182900000000004 38.0 38.0 38.0 36.8 38.0 80-84 37.1473 38.0 38.0 38.0 36.6 38.0 85-89 37.03145 38.0 38.0 38.0 36.0 38.0 90-94 36.92065 38.0 38.0 38.0 36.0 38.0 95-99 36.84205 38.0 38.0 38.0 35.8 38.0 100-104 36.75915 38.0 38.0 38.0 35.2 38.0 105-109 36.6202 38.0 38.0 38.0 35.0 38.0 110-114 36.63525 38.0 38.0 38.0 35.0 38.0 115-119 36.516099999999994 38.0 38.0 38.0 34.2 38.0 120-124 36.27255000000001 38.0 38.0 38.0 34.0 38.0 125-129 36.21339999999999 38.0 38.0 38.0 34.0 38.0 130-134 35.90345 38.0 37.2 38.0 33.0 38.0 135-139 35.63995 38.0 36.4 38.0 32.2 38.0 140-144 35.268299999999996 38.0 36.0 38.0 31.0 38.0 145-149 34.879 38.0 36.0 38.0 30.6 38.0 150-151 31.56925 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 4.0 18 3.0 19 4.0 20 3.0 21 4.0 22 3.0 23 8.0 24 11.0 25 6.0 26 12.0 27 18.0 28 17.0 29 27.0 30 25.0 31 33.0 32 54.0 33 59.0 34 101.0 35 186.0 36 456.0 37 2957.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.15 15.55 16.35 32.95 2 22.525000000000002 22.175 38.375 16.925 3 20.575 25.4 33.25 20.775 4 23.775 34.4 21.2 20.625 5 23.474999999999998 35.625 23.599999999999998 17.299999999999997 6 18.2 37.824999999999996 25.074999999999996 18.9 7 17.2 16.975 44.425 21.4 8 20.025000000000002 22.675 28.675 28.625 9 21.9 24.85 28.799999999999997 24.45 10-14 22.571128556427823 28.451422571128553 26.401320066003297 22.57612880644032 15-19 22.43285149802431 28.60501175411394 27.374581103386188 21.587555644475568 20-24 22.536409589109656 28.482057955057304 27.49612131524949 21.485411140583555 25-29 22.46471118230053 28.4212633897287 28.010811893082387 21.103213534888376 30-34 22.167142356416804 27.90045566070803 28.916929547844372 21.015472435030794 35-39 22.61701914403127 28.8864388092613 27.332865590858972 21.163676455848453 40-44 23.110865968008827 27.528456099884675 28.20538534824249 21.155292583864014 45-49 22.74774774774775 28.133133133133132 28.183183183183186 20.935935935935937 50-54 23.14119883918743 28.83518462924047 27.26408485940158 20.75953167217052 55-59 23.046523261630817 28.209104552276138 28.019009504752372 20.72536268134067 60-64 22.62518133159922 28.39277674953729 28.297733980291127 20.684307938572356 65-69 23.254301720688275 28.661464585834334 27.17587034813926 20.908363345338135 70-74 23.369999999999997 28.765 27.48 20.385 75-79 23.455000000000002 28.33 27.68 20.535 80-84 23.27 28.575 27.98 20.175 85-89 23.91 28.044999999999998 27.700000000000003 20.345 90-94 23.39 28.165000000000003 27.595 20.849999999999998 95-99 23.485 27.935 27.93 20.65 100-104 23.72 28.1 27.99 20.19 105-109 23.505000000000003 28.21 27.85 20.435 110-114 23.185 28.205000000000002 27.700000000000003 20.91 115-119 23.82 27.85 28.000000000000004 20.330000000000002 120-124 23.59 27.785 28.09 20.535 125-129 24.115000000000002 27.62 28.050000000000004 20.215 130-134 23.150000000000002 28.694999999999997 27.72 20.435 135-139 23.95 28.265 27.495000000000005 20.29 140-144 23.53 28.185 27.810000000000002 20.474999999999998 145-149 24.575 28.21 27.345000000000002 19.869999999999997 150-151 24.27926798696415 28.11481574329406 26.84883429430935 20.75708197543244 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.0 25 3.0 26 4.5 27 3.5 28 4.0 29 6.0 30 12.5 31 16.0 32 18.0 33 28.0 34 46.5 35 63.0 36 80.5 37 100.0 38 139.0 39 178.0 40 211.0 41 250.0 42 278.5 43 306.5 44 301.5 45 285.5 46 278.0 47 249.0 48 231.5 49 208.0 50 155.0 51 116.0 52 95.0 53 79.5 54 58.5 55 46.5 56 39.0 57 26.0 58 21.0 59 16.0 60 10.5 61 7.0 62 6.0 63 6.5 64 4.5 65 2.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.034999999999999996 20-24 0.095 25-29 0.11 30-34 0.145 35-39 0.22999999999999998 40-44 0.28500000000000003 45-49 0.1 50-54 0.06999999999999999 55-59 0.05 60-64 0.045 65-69 0.04 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.2625 0.0 0.0 0.0 0.0 128-129 1.4625 0.0 0.0 0.0 0.0 130-131 1.6375000000000002 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 1.9874999999999998 0.0 0.0 0.0 0.0 136-137 2.1500000000000004 0.0 0.0 0.0 0.0 138-139 2.4000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCCAT 10 0.006830828 145.0 1 CTGTTTC 10 0.006830828 145.0 9 >>END_MODULE Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803016 spots for SRR7180139.sra Written 803016 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra Read 803009 spots for SRR7180139.sra Written 803009 spots for SRR7180139.sra SRR ids: ['SRR7180139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v4ousbxm SRR7180139.sra spots: 16060187 blocks: [[1, 803009], [803010, 1606018], [1606019, 2409027], [2409028, 3212036], [3212037, 4015045], [4015046, 4818054], [4818055, 5621063], [5621064, 6424072], [6424073, 7227081], [7227082, 8030090], [8030091, 8833099], [8833100, 9636108], [9636109, 10439117], [10439118, 11242126], [11242127, 12045135], [12045136, 12848144], [12848145, 13651153], [13651154, 14454162], [14454163, 15257171], [15257172, 16060187]] SRR7180139 file size 5420570 SRR7180139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180139 SRR7180139_1.fastq SRR7180139_2.fastq Input file: SRR7180139_1.fastq Paired file: SRR7180139_2.fastq trimmed: SRR7180139-trimmed-pair1.fastq, SRR7180139-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:34:58 2025 >> started Mon Feb 10 22:35:16 2025 >> done (17.789s) 16060187 read pairs processed; of these: 11728 ( 0.07%) short read pairs filtered out after trimming by size control 3935 ( 0.02%) empty read pairs filtered out after trimming by size control 16044524 (99.90%) read pairs available; of these: 4971483 (30.99%) trimmed read pairs available after processing 11073041 (69.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 1 0.00% 23 3 0.00% 24 1 0.00% 25 6 0.00% 26 3 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 3 0.00% 33 2 0.00% 34 2 0.00% 35 7 0.00% 36 12 0.00% 37 30 0.00% 38 7 0.00% 39 11 0.00% 40 3 0.00% 41 7 0.00% 42 8 0.00% 43 12 0.00% 44 26 0.00% 45 27 0.00% 46 43 0.00% 47 74 0.00% 48 22 0.00% 49 65 0.00% 50 14 0.00% 51 64 0.00% 52 57 0.00% 53 84 0.00% 54 46 0.00% 55 124 0.00% 56 139 0.00% 57 53 0.00% 58 33 0.00% 59 27 0.00% 60 52 0.00% 61 53 0.00% 62 38 0.00% 63 61 0.00% 64 58 0.00% 65 71 0.00% 66 76 0.00% 67 83 0.00% 68 98 0.00% 69 113 0.00% 70 111 0.00% 71 136 0.00% 72 181 0.00% 73 211 0.00% 74 225 0.00% 75 288 0.00% 76 306 0.00% 77 347 0.00% 78 413 0.00% 79 468 0.00% 80 465 0.00% 81 491 0.00% 82 594 0.00% 83 725 0.00% 84 1048 0.01% 85 1269 0.01% 86 1457 0.01% 87 1648 0.01% 88 1865 0.01% 89 1896 0.01% 90 2009 0.01% 91 2194 0.01% 92 2310 0.01% 93 2567 0.02% 94 2680 0.02% 95 2801 0.02% 96 3171 0.02% 97 3347 0.02% 98 3626 0.02% 99 3807 0.02% 100 3950 0.02% 101 4216 0.03% 102 4707 0.03% 103 4953 0.03% 104 5182 0.03% 105 5690 0.04% 106 6154 0.04% 107 6436 0.04% 108 6729 0.04% 109 7350 0.05% 110 7665 0.05% 111 8175 0.05% 112 8559 0.05% 113 9058 0.06% 114 9629 0.06% 115 10341 0.06% 116 10877 0.07% 117 11495 0.07% 118 12132 0.08% 119 14266 0.09% 120 14719 0.09% 121 15016 0.09% 122 14302 0.09% 123 15009 0.09% 124 16112 0.10% 125 16542 0.10% 126 17295 0.11% 127 18441 0.11% 128 19221 0.12% 129 21089 0.13% 130 21704 0.14% 131 22885 0.14% 132 24113 0.15% 133 25694 0.16% 134 27430 0.17% 135 29056 0.18% 136 30876 0.19% 137 33569 0.21% 138 36126 0.23% 139 38911 0.24% 140 42267 0.26% 141 46646 0.29% 142 52394 0.33% 143 58690 0.37% 144 67600 0.42% 145 81039 0.51% 146 99734 0.62% 147 136466 0.85% 148 214677 1.34% 149 452519 2.82% 150 3059389 19.07% 151 11073041 69.01% 16044524 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.20 fanout-score-rank=20 prefix-density=0.39 prefix-fanout=3.6 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=404.57 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=30.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=38 prefix-density=0.30 prefix-fanout=1.2 sequence=AGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATT criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=363.12 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=31.7 sequence=AAGAAGAAGAAA SRR7180139 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:36:01 Started mapping on | Feb 10 22:36:01 Finished on | Feb 10 22:37:42 Mapping speed, Million of reads per hour | 571.88 Number of input reads | 16044524 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15240464 Uniquely mapped reads % | 94.99% Average mapped length | 298.13 Number of splices: Total | 15287228 Number of splices: Annotated (sjdb) | 14971428 Number of splices: GT/AG | 15022070 Number of splices: GC/AG | 208653 Number of splices: AT/AC | 13250 Number of splices: Non-canonical | 43255 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352602 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 26164 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 457720 457720 457720 N_multimapping 352602 352602 352602 N_noFeature 408469 15088804 468998 N_ambiguous 173329 1115 81572 UnstrandedReadsAssigned:14658666 PositiveStrandReadsAssigned:150545 NegativeStrandReadsAssigned:14689894 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7180139 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180139-trimmed-pair1.fastq SRR7180139-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,044,524 reads, 14,543,828 reads pseudoaligned [quant] estimated average fragment length: 268.285 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7180139.ke.tsv 34699 SRR7180139.se.tsv 87100 total ==> SRR7180139.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.72 824.037 31.5147 Potri.005G024800.1.v4.1 1035 767.715 120 10.4656 Potri.004G059700.1.v4.1 961 693.751 76 7.33487 Potri.007G009000.2.v4.1 1416 1148.72 0 0 Potri.003G141000.2.v4.1 2943 2675.72 525.355 13.1461 Potri.016G087400.1.v4.1 270 65.738 876 892.217 Potri.015G069301.1.v4.1 564 302.809 0 0 Potri.010G195200.1.v4.1 1773 1505.72 316.618 14.0791 Potri.012G127500.1.v4.1 977 709.733 14277 1346.87 ==> SRR7180139.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 296 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 564 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 254 SRR7180139 completed mapping pipeline successfully