Starting /dee2/code/volunteer_pipeline.sh SRR7180140 current disk space = 3057644736512 free memory = 1507028972 SRR7180140 SRAfilesize dcb73b6fc244eccddcf27f0500b7eb40 SRR7180140.sra SRR7180140.sra file validated SRR7180140 is paired end SRR7180140 is conventional basespace SRR7180140 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180140_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.19375 33.0 32.0 34.0 28.0 34.0 2 32.70475 33.0 33.0 34.0 31.0 34.0 3 32.184 33.0 33.0 33.0 29.0 34.0 4 32.51975 33.0 33.0 33.0 31.0 34.0 5 33.09975 33.0 33.0 34.0 33.0 34.0 6 36.75875 38.0 37.0 38.0 34.0 38.0 7 37.33725 38.0 38.0 38.0 36.0 38.0 8 37.2845 38.0 38.0 38.0 36.0 38.0 9 37.59025 38.0 38.0 38.0 38.0 38.0 10-14 37.616949999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.63125 38.0 38.0 38.0 38.0 38.0 20-24 37.6573 38.0 38.0 38.0 38.0 38.0 25-29 37.60424999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.5376 38.0 38.0 38.0 38.0 38.0 35-39 37.524950000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.51265000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.44199999999999 38.0 38.0 38.0 38.0 38.0 50-54 37.4319 38.0 38.0 38.0 38.0 38.0 55-59 37.3615 38.0 38.0 38.0 37.8 38.0 60-64 37.32935 38.0 38.0 38.0 37.0 38.0 65-69 37.26105 38.0 38.0 38.0 37.0 38.0 70-74 37.24575 38.0 38.0 38.0 37.0 38.0 75-79 37.18344999999999 38.0 38.0 38.0 37.0 38.0 80-84 37.1411 38.0 38.0 38.0 37.0 38.0 85-89 37.09605 38.0 38.0 38.0 36.8 38.0 90-94 37.04585 38.0 38.0 38.0 36.2 38.0 95-99 36.9995 38.0 38.0 38.0 36.2 38.0 100-104 36.863 38.0 38.0 38.0 36.0 38.0 105-109 36.7625 38.0 38.0 38.0 35.8 38.0 110-114 36.698699999999995 38.0 38.0 38.0 35.4 38.0 115-119 36.56055 38.0 38.0 38.0 35.0 38.0 120-124 36.458 38.0 38.0 38.0 34.6 38.0 125-129 36.28045 38.0 38.0 38.0 34.0 38.0 130-134 36.051100000000005 38.0 38.0 38.0 33.6 38.0 135-139 35.874399999999994 38.0 38.0 38.0 33.0 38.0 140-144 35.652100000000004 38.0 37.2 38.0 32.8 38.0 145-149 35.425 38.0 36.6 38.0 33.0 38.0 150-151 32.834625 37.0 34.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 2.0 8 2.0 9 1.0 10 1.0 11 0.0 12 3.0 13 2.0 14 1.0 15 5.0 16 2.0 17 1.0 18 2.0 19 1.0 20 4.0 21 3.0 22 3.0 23 5.0 24 11.0 25 8.0 26 7.0 27 9.0 28 20.0 29 21.0 30 23.0 31 24.0 32 47.0 33 37.0 34 98.0 35 152.0 36 401.0 37 3102.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.54860568152202 15.063851967683087 13.187385978629138 36.20015637216575 2 19.779944986246562 18.00450112528132 37.70942735683921 24.50612653163291 3 19.1 24.25 27.675 28.975 4 21.8 28.425 24.224999999999998 25.55 5 20.9 33.324999999999996 26.450000000000003 19.325 6 17.849999999999998 33.225 28.1 20.825 7 15.1 24.975 42.0 17.925 8 18.0 25.55 32.1 24.349999999999998 9 17.7 25.525 33.125 23.65 10-14 19.57 30.43 27.29 22.71 15-19 19.2 30.055 27.76 22.985 20-24 19.245 29.885 28.199999999999996 22.67 25-29 19.685 28.95 28.1 23.265 30-34 19.36 29.715000000000003 28.095 22.830000000000002 35-39 19.82 29.29 27.825 23.064999999999998 40-44 19.650000000000002 28.895 28.205000000000002 23.25 45-49 19.91 28.815 27.955000000000002 23.32 50-54 19.939999999999998 29.459999999999997 27.689999999999998 22.91 55-59 19.255 29.065 27.975 23.705000000000002 60-64 19.755 29.13 27.68 23.435 65-69 19.88 28.660000000000004 27.935 23.525 70-74 20.115 28.249999999999996 28.73 22.905 75-79 20.380000000000003 28.225 28.144999999999996 23.25 80-84 20.07 28.560000000000002 28.215 23.155 85-89 19.845 28.48 28.365000000000002 23.31 90-94 19.744999999999997 28.32 27.79 24.145 95-99 20.095 28.585 27.54 23.78 100-104 20.45 28.904999999999998 27.66 22.985 105-109 20.395 28.13 27.860000000000003 23.615 110-114 20.200000000000003 28.595 27.63 23.575 115-119 20.265 28.050000000000004 28.38 23.305 120-124 20.65 28.625 27.384999999999998 23.34 125-129 20.4 28.349999999999998 27.084999999999997 24.165 130-134 21.17 28.395 26.99 23.445 135-139 20.34 28.015 27.725 23.919999999999998 140-144 21.44 28.465 26.985 23.11 145-149 20.794999999999998 28.884999999999998 27.025 23.294999999999998 150-151 20.47047047047047 28.866366366366364 26.276276276276278 24.386886886886888 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 9.0 1 4.5 2 0.5 3 0.5 4 1.0 5 1.0 6 0.5 7 1.0 8 1.0 9 1.0 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.5 18 1.5 19 1.0 20 2.0 21 2.0 22 2.5 23 4.5 24 6.5 25 7.5 26 8.5 27 11.0 28 18.0 29 23.0 30 31.5 31 41.5 32 47.0 33 55.0 34 73.0 35 98.0 36 108.0 37 106.5 38 123.0 39 161.0 40 195.0 41 216.5 42 228.0 43 240.0 44 265.5 45 272.0 46 250.0 47 232.5 48 222.0 49 203.5 50 169.5 51 123.5 52 98.0 53 87.0 54 70.0 55 50.5 56 33.0 57 21.0 58 12.0 59 12.0 60 9.0 61 7.5 62 6.5 63 4.5 64 3.5 65 1.0 66 2.5 67 4.5 68 4.0 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.075 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57232704402516 98.95 2 0.37735849056603776 0.75 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025157232704402514 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.85 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 4.075 0.0 0.0 0.0 0.0 128-129 4.4625 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.2375 0.0 0.0 0.0 0.0 134-135 5.8375 0.0 0.0 0.0 0.0 136-137 6.425 0.0 0.0 0.0 0.0 138-139 7.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCCA 20 0.005945122 28.99 80-84 >>END_MODULE SRR7180140 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180140_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.983 33.0 33.0 34.0 32.0 34.0 2 33.03475 34.0 33.0 34.0 33.0 34.0 3 33.08475 34.0 33.0 34.0 33.0 34.0 4 32.979 34.0 33.0 34.0 33.0 34.0 5 33.058 34.0 33.0 34.0 33.0 34.0 6 37.091 38.0 38.0 38.0 37.0 38.0 7 37.066 38.0 38.0 38.0 37.0 38.0 8 37.18375 38.0 38.0 38.0 38.0 38.0 9 37.12325 38.0 38.0 38.0 38.0 38.0 10-14 37.01305 38.0 38.0 38.0 37.2 38.0 15-19 36.993849999999995 38.0 38.0 38.0 37.2 38.0 20-24 36.9639 38.0 38.0 38.0 37.2 38.0 25-29 36.89215 38.0 38.0 38.0 37.0 38.0 30-34 36.844300000000004 38.0 38.0 38.0 37.0 38.0 35-39 36.76635 38.0 38.0 38.0 37.0 38.0 40-44 36.74935000000001 38.0 38.0 38.0 37.0 38.0 45-49 36.782849999999996 38.0 38.0 38.0 37.0 38.0 50-54 36.83535 38.0 38.0 38.0 36.8 38.0 55-59 36.82855 38.0 38.0 38.0 37.0 38.0 60-64 36.73524999999999 38.0 38.0 38.0 36.4 38.0 65-69 36.74165000000001 38.0 38.0 38.0 36.6 38.0 70-74 36.6283 38.0 38.0 38.0 36.0 38.0 75-79 36.6683 38.0 38.0 38.0 36.0 38.0 80-84 36.6114 38.0 38.0 38.0 36.0 38.0 85-89 36.52535 38.0 38.0 38.0 36.0 38.0 90-94 36.4156 38.0 38.0 38.0 35.4 38.0 95-99 36.2941 38.0 38.0 38.0 34.8 38.0 100-104 36.242799999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.032399999999996 38.0 38.0 38.0 34.0 38.0 110-114 35.97965 38.0 38.0 38.0 34.0 38.0 115-119 35.7961 38.0 38.0 38.0 33.6 38.0 120-124 35.721050000000005 38.0 38.0 38.0 33.2 38.0 125-129 35.53295 38.0 38.0 38.0 32.6 38.0 130-134 35.27140000000001 38.0 36.6 38.0 31.4 38.0 135-139 34.871950000000005 38.0 36.0 38.0 28.4 38.0 140-144 34.464299999999994 38.0 36.0 38.0 27.4 38.0 145-149 34.12155 38.0 36.0 38.0 25.2 38.0 150-151 30.55675 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 8.0 4 9.0 5 4.0 6 2.0 7 3.0 8 0.0 9 5.0 10 2.0 11 1.0 12 5.0 13 5.0 14 4.0 15 3.0 16 7.0 17 5.0 18 5.0 19 7.0 20 6.0 21 7.0 22 10.0 23 9.0 24 10.0 25 9.0 26 13.0 27 11.0 28 21.0 29 22.0 30 22.0 31 33.0 32 52.0 33 59.0 34 89.0 35 185.0 36 492.0 37 2856.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.824999999999996 18.175 17.45 26.55 2 24.15 24.175 32.85 18.825 3 21.375 28.325 29.5 20.8 4 24.875 32.675 23.575 18.875 5 23.625 34.599999999999994 23.175 18.6 6 20.115086314736054 35.27645734300726 25.769326995246434 18.839129347010257 7 20.505126281570394 19.379844961240313 38.30957739434859 21.80545136284071 8 21.475 24.05 28.050000000000004 26.424999999999997 9 22.71135567783892 26.638319159579787 27.763881940970485 22.886443221610804 10-14 23.58533046480212 28.603592335017762 25.62665732726272 22.184419872917395 15-19 23.439923935345046 28.108892558674874 27.753590551969175 20.69759295401091 20-24 23.515570241313707 28.887553819965955 27.1402823670772 20.456593571643136 25-29 23.24847148441415 28.716046907888142 27.493234439210184 20.54224716848752 30-34 23.954467957075522 28.292046936114733 27.2289639955872 20.524521111222548 35-39 22.708343786061914 28.88966935928955 27.80091315036877 20.601073704279766 40-44 23.714185358020977 28.355662602237945 27.171458678307992 20.758693361433085 45-49 22.415865384615387 28.114983974358974 28.48056891025641 20.988581730769234 50-54 23.37486863834259 28.314066956913376 27.68353100135115 20.627533403392885 55-59 23.75400320256205 28.31765412329864 27.53702962369896 20.391313050440353 60-64 23.324826102186858 28.25902016714207 27.51839063203723 20.89776309863384 65-69 23.92294220665499 28.091068301225917 27.335501626219667 20.650487865899425 70-74 23.804282569541723 28.176906143686214 27.476485891534917 20.542325395237143 75-79 23.361352947062944 28.019613729610725 27.874512158510957 20.74452116481537 80-84 23.592976136875283 27.695232377807795 28.00040022012107 20.711391265195857 85-89 23.475258918296895 27.858107770050534 28.128283384199733 20.538349927452845 90-94 23.567356735673567 28.18781878187819 27.59275927592759 20.652065206520653 95-99 24.201210060503026 27.736386819340968 28.091404570228512 19.970998549927497 100-104 23.73237323732373 28.18781878187819 27.732773277327734 20.347034703470346 105-109 23.376168808440422 28.07140357017851 28.106405320266013 20.446022301115054 110-114 24.21242124212421 27.987798779877988 27.672767276727672 20.12701270127013 115-119 24.00860129019353 28.179226884032605 28.234235135270293 19.577936690503574 120-124 24.213632044806722 28.0892133820073 27.829174376156423 19.867980197029556 125-129 24.134826965393078 28.510702140428084 27.515503100620126 19.838967793558712 130-134 24.454781912765107 27.826130452180877 27.921168467386952 19.797919167667068 135-139 24.54490898179636 28.370674134826967 27.340468093618725 19.74394878975795 140-144 25.026251312565627 28.421421071053555 27.531376568828442 19.02095104755238 145-149 24.91 28.49 27.435 19.165 150-151 25.683128603660066 27.275006267234897 27.06192028077212 19.979944848332913 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 1.5 22 1.0 23 2.0 24 2.5 25 1.5 26 1.5 27 6.0 28 8.0 29 7.5 30 11.0 31 18.5 32 26.5 33 34.0 34 40.5 35 55.0 36 84.0 37 98.5 38 129.5 39 170.5 40 188.0 41 231.5 42 244.5 43 240.5 44 264.0 45 291.0 46 295.5 47 272.0 48 252.5 49 226.5 50 178.0 51 141.5 52 125.0 53 87.0 54 56.5 55 45.0 56 37.0 57 30.5 58 25.0 59 19.5 60 13.5 61 6.5 62 3.5 63 3.0 64 3.5 65 3.5 66 2.0 67 2.0 68 1.0 69 0.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.025 8 0.0 9 0.05 10-14 0.065 15-19 0.08499999999999999 20-24 0.13 25-29 0.22999999999999998 30-34 0.29 35-39 0.345 40-44 0.35500000000000004 45-49 0.16 50-54 0.08499999999999999 55-59 0.08 60-64 0.08499999999999999 65-69 0.075 70-74 0.06 75-79 0.06999999999999999 80-84 0.055 85-89 0.065 90-94 0.01 95-99 0.005 100-104 0.01 105-109 0.005 110-114 0.01 115-119 0.015 120-124 0.015 125-129 0.02 130-134 0.04 135-139 0.02 140-144 0.005 145-149 0.0 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4462622703247 98.775 2 0.45305814246161585 0.8999999999999999 3 0.07550969041026932 0.22499999999999998 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.9624999999999999 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.8375000000000004 0.0 0.0 0.0 0.0 122-123 3.275 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 4.862500000000001 0.0 0.0 0.0 0.0 132-133 5.2875 0.0 0.0 0.0 0.0 134-135 5.862500000000001 0.0 0.0 0.0 0.0 136-137 6.4125 0.0 0.0 0.0 0.0 138-139 7.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609211 spots for SRR7180140.sra Written 609211 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra Read 609208 spots for SRR7180140.sra Written 609208 spots for SRR7180140.sra SRR ids: ['SRR7180140.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o9iy3uuf SRR7180140.sra spots: 12184163 blocks: [[1, 609208], [609209, 1218416], [1218417, 1827624], [1827625, 2436832], [2436833, 3046040], [3046041, 3655248], [3655249, 4264456], [4264457, 4873664], [4873665, 5482872], [5482873, 6092080], [6092081, 6701288], [6701289, 7310496], [7310497, 7919704], [7919705, 8528912], [8528913, 9138120], [9138121, 9747328], [9747329, 10356536], [10356537, 10965744], [10965745, 11574952], [11574953, 12184163]] SRR7180140 file size 4107112 SRR7180140 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180140 SRR7180140_1.fastq SRR7180140_2.fastq Input file: SRR7180140_1.fastq Paired file: SRR7180140_2.fastq trimmed: SRR7180140-trimmed-pair1.fastq, SRR7180140-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:44:59 2025 >> started Mon Feb 10 22:45:14 2025 >> done (15.385s) 12184163 read pairs processed; of these: 43820 ( 0.36%) short read pairs filtered out after trimming by size control 26422 ( 0.22%) empty read pairs filtered out after trimming by size control 12113921 (99.42%) read pairs available; of these: 4500202 (37.15%) trimmed read pairs available after processing 7613719 (62.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 9 0.00% 23 13 0.00% 24 16 0.00% 25 16 0.00% 26 10 0.00% 27 22 0.00% 28 12 0.00% 29 13 0.00% 30 14 0.00% 31 20 0.00% 32 16 0.00% 33 16 0.00% 34 19 0.00% 35 16 0.00% 36 23 0.00% 37 43 0.00% 38 17 0.00% 39 19 0.00% 40 15 0.00% 41 21 0.00% 42 34 0.00% 43 38 0.00% 44 30 0.00% 45 40 0.00% 46 43 0.00% 47 60 0.00% 48 38 0.00% 49 59 0.00% 50 38 0.00% 51 83 0.00% 52 72 0.00% 53 101 0.00% 54 69 0.00% 55 129 0.00% 56 129 0.00% 57 91 0.00% 58 77 0.00% 59 53 0.00% 60 90 0.00% 61 86 0.00% 62 109 0.00% 63 108 0.00% 64 115 0.00% 65 143 0.00% 66 134 0.00% 67 151 0.00% 68 195 0.00% 69 200 0.00% 70 224 0.00% 71 267 0.00% 72 328 0.00% 73 334 0.00% 74 376 0.00% 75 459 0.00% 76 573 0.00% 77 663 0.01% 78 718 0.01% 79 831 0.01% 80 886 0.01% 81 1072 0.01% 82 1153 0.01% 83 1417 0.01% 84 3064 0.03% 85 4257 0.04% 86 4851 0.04% 87 5742 0.05% 88 6087 0.05% 89 6104 0.05% 90 6231 0.05% 91 6146 0.05% 92 6682 0.06% 93 6596 0.05% 94 6713 0.06% 95 6941 0.06% 96 7324 0.06% 97 7565 0.06% 98 7915 0.07% 99 8488 0.07% 100 8934 0.07% 101 9468 0.08% 102 10151 0.08% 103 10808 0.09% 104 11493 0.09% 105 12473 0.10% 106 13444 0.11% 107 14016 0.12% 108 14661 0.12% 109 16089 0.13% 110 16796 0.14% 111 17644 0.15% 112 18607 0.15% 113 19811 0.16% 114 21248 0.18% 115 22039 0.18% 116 23126 0.19% 117 23734 0.20% 118 25109 0.21% 119 27073 0.22% 120 27745 0.23% 121 28829 0.24% 122 28814 0.24% 123 30051 0.25% 124 31701 0.26% 125 32495 0.27% 126 33745 0.28% 127 34965 0.29% 128 35941 0.30% 129 37079 0.31% 130 38619 0.32% 131 40070 0.33% 132 41343 0.34% 133 43755 0.36% 134 45627 0.38% 135 47211 0.39% 136 48842 0.40% 137 50563 0.42% 138 52396 0.43% 139 55164 0.46% 140 57242 0.47% 141 61039 0.50% 142 65268 0.54% 143 70366 0.58% 144 77417 0.64% 145 85949 0.71% 146 99668 0.82% 147 124436 1.03% 148 175734 1.45% 149 333421 2.75% 150 2115099 17.46% 151 7613719 62.85% 12113921 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=29 prefix-density=0.94 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=208.59 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=19.0 sequence=AAACAGAAACTAATTAAGCATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=1.17 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=27 prefix-density=1.19 prefix-fanout=2.1 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=25 fanout-score=16.39 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=7.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7180140 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:46:00 Started mapping on | Feb 10 22:46:00 Finished on | Feb 10 22:48:17 Mapping speed, Million of reads per hour | 318.32 Number of input reads | 12113921 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11144918 Uniquely mapped reads % | 92.00% Average mapped length | 294.11 Number of splices: Total | 10345687 Number of splices: Annotated (sjdb) | 10129998 Number of splices: GT/AG | 10165895 Number of splices: GC/AG | 133851 Number of splices: AT/AC | 8653 Number of splices: Non-canonical | 37288 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346994 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 25891 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.86% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 660686 660686 660686 N_multimapping 346994 346994 346994 N_noFeature 324033 11019508 378355 N_ambiguous 128009 526 56777 UnstrandedReadsAssigned:10692876 PositiveStrandReadsAssigned:124884 NegativeStrandReadsAssigned:10709786 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180140 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180140-trimmed-pair1.fastq SRR7180140-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,113,921 reads, 10,625,489 reads pseudoaligned [quant] estimated average fragment length: 228.673 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR7180140.ke.tsv 34699 SRR7180140.se.tsv 87100 total ==> SRR7180140.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.33 1058 44.1157 Potri.005G024800.1.v4.1 1035 807.327 497 45.9565 Potri.004G059700.1.v4.1 961 733.353 72 7.32924 Potri.007G009000.2.v4.1 1416 1188.33 2 0.125642 Potri.003G141000.2.v4.1 2943 2715.33 452 12.4267 Potri.016G087400.1.v4.1 270 82.1751 831 754.919 Potri.015G069301.1.v4.1 564 339.032 0 0 Potri.010G195200.1.v4.1 1773 1545.33 328 15.845 Potri.012G127500.1.v4.1 977 749.338 2769 275.858 ==> SRR7180140.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 698 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 612 Potri.001G452600.v4.1 518 SRR7180140 completed mapping pipeline successfully