Starting /dee2/code/volunteer_pipeline.sh SRR7180141 current disk space = 3057352118272 free memory = 1015965816 SRR7180141 SRAfilesize 9be4371b632075dfacb5c48dca0cc8b6 SRR7180141.sra SRR7180141.sra file validated SRR7180141 is paired end SRR7180141 is conventional basespace SRR7180141 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180141_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.7165 33.0 27.0 33.0 18.0 34.0 2 31.58075 33.0 31.0 33.0 27.0 34.0 3 31.31125 33.0 31.0 33.0 27.0 34.0 4 31.166 32.0 31.0 33.0 27.0 33.0 5 32.5435 33.0 33.0 33.0 32.0 33.0 6 36.57175 38.0 37.0 38.0 34.0 38.0 7 37.357 38.0 38.0 38.0 36.0 38.0 8 37.54225 38.0 38.0 38.0 37.0 38.0 9 37.6245 38.0 38.0 38.0 38.0 38.0 10-14 37.6653 38.0 38.0 38.0 38.0 38.0 15-19 37.650400000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.66645 38.0 38.0 38.0 38.0 38.0 25-29 37.66415 38.0 38.0 38.0 38.0 38.0 30-34 37.59595 38.0 38.0 38.0 38.0 38.0 35-39 37.60235 38.0 38.0 38.0 38.0 38.0 40-44 37.558550000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.55605 38.0 38.0 38.0 38.0 38.0 50-54 37.4782 38.0 38.0 38.0 37.6 38.0 55-59 37.455349999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.4139 38.0 38.0 38.0 37.0 38.0 65-69 37.32915 38.0 38.0 38.0 37.0 38.0 70-74 37.38844999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.30195 38.0 38.0 38.0 37.0 38.0 80-84 37.218900000000005 38.0 38.0 38.0 36.4 38.0 85-89 37.16795 38.0 38.0 38.0 36.4 38.0 90-94 37.111549999999994 38.0 38.0 38.0 36.0 38.0 95-99 37.00920000000001 38.0 38.0 38.0 36.0 38.0 100-104 36.8906 38.0 38.0 38.0 36.0 38.0 105-109 36.81525 38.0 38.0 38.0 35.2 38.0 110-114 36.72435 38.0 38.0 38.0 34.8 38.0 115-119 36.655150000000006 38.0 38.0 38.0 34.8 38.0 120-124 36.562650000000005 38.0 38.0 38.0 34.6 38.0 125-129 36.41685 38.0 38.0 38.0 34.0 38.0 130-134 36.135450000000006 38.0 37.4 38.0 33.2 38.0 135-139 35.961800000000004 38.0 36.8 38.0 33.0 38.0 140-144 35.704299999999996 38.0 36.2 38.0 32.2 38.0 145-149 35.41435 38.0 36.0 38.0 32.2 38.0 150-151 32.60425 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 2.0 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 1.0 23 6.0 24 3.0 25 14.0 26 11.0 27 4.0 28 18.0 29 24.0 30 17.0 31 43.0 32 47.0 33 60.0 34 89.0 35 187.0 36 528.0 37 2938.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.28318817629982 13.882290841910795 11.480601741884403 31.353919239904986 2 21.8 18.65 35.65 23.9 3 18.875 27.275 26.875 26.974999999999998 4 24.05 31.075000000000003 23.474999999999998 21.4 5 21.625 35.699999999999996 23.7 18.975 6 18.4 36.15 24.275 21.175 7 14.274999999999999 22.0 44.425 19.3 8 17.625 22.2 30.65 29.525000000000002 9 18.625 22.45 31.75 27.175 10-14 20.669999999999998 28.134999999999998 27.025 24.169999999999998 15-19 19.825 28.09 28.07 24.015 20-24 20.405 28.515 27.750000000000004 23.330000000000002 25-29 20.27 28.199999999999996 28.065 23.465 30-34 19.259999999999998 28.660000000000004 27.794999999999998 24.285 35-39 20.03 28.005000000000003 28.055000000000003 23.91 40-44 20.555 28.355000000000004 27.765 23.325000000000003 45-49 20.119999999999997 28.084999999999997 27.67 24.125 50-54 20.155 28.265 27.825 23.755000000000003 55-59 19.895 29.015 27.700000000000003 23.39 60-64 20.39 27.87 28.255000000000003 23.485 65-69 20.595 27.889999999999997 28.01 23.505000000000003 70-74 20.365 27.91 28.294999999999998 23.43 75-79 20.735 27.860000000000003 27.655 23.75 80-84 20.585 28.01 27.810000000000002 23.595 85-89 20.5 28.33 27.644999999999996 23.525 90-94 20.23 27.58 28.59 23.599999999999998 95-99 20.75 27.189999999999998 28.29 23.77 100-104 20.11 28.115000000000002 28.42 23.355 105-109 21.14 27.339999999999996 28.235 23.285 110-114 20.895 27.650000000000002 28.17 23.285 115-119 21.01 28.189999999999998 27.689999999999998 23.11 120-124 20.485 28.199999999999996 27.54 23.775 125-129 20.785 28.215 27.675 23.325000000000003 130-134 20.86 27.83 27.965 23.345 135-139 20.919999999999998 27.845 27.675 23.56 140-144 21.215 28.29 27.47 23.025000000000002 145-149 20.515 27.805000000000003 27.950000000000003 23.73 150-151 20.44800400450507 27.618570892253786 27.656113127268178 24.27731197597297 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 2.0 24 0.0 25 3.0 26 4.0 27 5.0 28 9.0 29 11.0 30 15.0 31 22.0 32 25.5 33 33.5 34 47.5 35 62.5 36 84.0 37 116.0 38 130.0 39 153.5 40 202.5 41 236.0 42 264.5 43 267.5 44 259.5 45 268.5 46 278.0 47 263.5 48 232.5 49 208.5 50 165.0 51 138.0 52 125.0 53 94.0 54 72.0 55 54.5 56 38.0 57 23.5 58 19.0 59 13.0 60 7.5 61 8.0 62 4.0 63 4.5 64 9.0 65 9.0 66 4.5 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.2749999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5875 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.15 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.5750000000000002 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 2.05 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.4625 0.0 0.0 0.0 0.0 130-131 2.6625 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.1625 0.0 0.0 0.0 0.0 136-137 3.5 0.0 0.0 0.0 0.0 138-139 3.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180141 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180141_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93 33.0 33.0 34.0 33.0 34.0 2 33.07625 34.0 33.0 34.0 33.0 34.0 3 33.15275 34.0 33.0 34.0 33.0 34.0 4 33.151 34.0 33.0 34.0 33.0 34.0 5 33.06375 34.0 33.0 34.0 33.0 34.0 6 37.25375 38.0 38.0 38.0 37.0 38.0 7 37.31025 38.0 38.0 38.0 37.0 38.0 8 37.29575 38.0 38.0 38.0 37.0 38.0 9 37.15175 38.0 38.0 38.0 37.0 38.0 10-14 37.238 38.0 38.0 38.0 37.0 38.0 15-19 37.174699999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.14215 38.0 38.0 38.0 37.0 38.0 25-29 37.221349999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.17184999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.043549999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.0495 38.0 38.0 38.0 37.0 38.0 45-49 37.0351 38.0 38.0 38.0 37.0 38.0 50-54 37.04325 38.0 38.0 38.0 37.0 38.0 55-59 36.9692 38.0 38.0 38.0 36.0 38.0 60-64 36.92445 38.0 38.0 38.0 36.4 38.0 65-69 36.84025 38.0 38.0 38.0 36.0 38.0 70-74 36.849799999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.8106 38.0 38.0 38.0 36.0 38.0 80-84 36.715999999999994 38.0 38.0 38.0 35.8 38.0 85-89 36.57685 38.0 38.0 38.0 35.2 38.0 90-94 36.4362 38.0 38.0 38.0 34.6 38.0 95-99 36.4196 38.0 38.0 38.0 34.6 38.0 100-104 36.2452 38.0 38.0 38.0 34.0 38.0 105-109 36.12165 38.0 38.0 38.0 33.8 38.0 110-114 36.081450000000004 38.0 38.0 38.0 34.0 38.0 115-119 35.94755 38.0 38.0 38.0 33.2 38.0 120-124 35.768299999999996 38.0 37.6 38.0 33.0 38.0 125-129 35.4176 38.0 36.6 38.0 30.8 38.0 130-134 35.194900000000004 38.0 36.0 38.0 30.2 38.0 135-139 34.96405 38.0 36.0 38.0 29.0 38.0 140-144 34.5258 38.0 35.4 38.0 26.6 38.0 145-149 33.939949999999996 38.0 35.0 38.0 24.0 38.0 150-151 30.495625 36.5 29.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 1.0 5 0.0 6 0.0 7 3.0 8 7.0 9 0.0 10 1.0 11 3.0 12 3.0 13 3.0 14 1.0 15 2.0 16 2.0 17 3.0 18 5.0 19 9.0 20 5.0 21 4.0 22 8.0 23 7.0 24 11.0 25 15.0 26 13.0 27 16.0 28 28.0 29 35.0 30 38.0 31 39.0 32 48.0 33 66.0 34 114.0 35 203.0 36 566.0 37 2726.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.87945755901557 18.50828729281768 15.268709191361124 26.343545956805624 2 25.275275275275277 21.346346346346344 34.45945945945946 18.91891891891892 3 20.3 27.450000000000003 31.674999999999997 20.575 4 24.05 34.699999999999996 21.85 19.400000000000002 5 23.1 37.25 21.3 18.35 6 18.95 36.675000000000004 23.7 20.674999999999997 7 17.849999999999998 18.85 41.4 21.9 8 20.025000000000002 24.175 27.0 28.799999999999997 9 21.325 25.75 27.6 25.324999999999996 10-14 23.05 28.665000000000003 26.165 22.12 15-19 22.689999999999998 28.375 27.334999999999997 21.6 20-24 22.59 28.54 27.224999999999998 21.645 25-29 22.425 28.585 27.76 21.23 30-34 23.05615280764038 27.78138906945347 27.806390319515977 21.356067803390168 35-39 22.729774353329667 28.22834842647721 27.758042727773052 21.283834492420073 40-44 23.31365092073659 27.577061649319457 28.012409927942354 21.0968775020016 45-49 22.625 28.28 27.794999999999998 21.3 50-54 22.85 27.98 27.839999999999996 21.33 55-59 23.255 27.985 27.529999999999998 21.23 60-64 23.044999999999998 27.99 27.32 21.645 65-69 23.385 28.725 27.075 20.815 70-74 23.075000000000003 27.99 27.650000000000002 21.285 75-79 23.325000000000003 27.705000000000002 27.55 21.42 80-84 23.435 28.42 27.255000000000003 20.89 85-89 23.445 28.155 27.625 20.775 90-94 23.49 28.825 27.36 20.325 95-99 23.04 28.18 27.534999999999997 21.245 100-104 23.57 28.299999999999997 27.13 21.0 105-109 24.18 27.92 27.229999999999997 20.669999999999998 110-114 23.805 27.935 27.705000000000002 20.555 115-119 23.625 27.82 27.93 20.625 120-124 23.75 28.42 27.275 20.555 125-129 24.060000000000002 28.610000000000003 27.125 20.205000000000002 130-134 23.595 28.375 27.205000000000002 20.825 135-139 24.18 27.485 27.634999999999998 20.7 140-144 24.154999999999998 28.194999999999997 27.665 19.985 145-149 24.38 28.015 27.22 20.385 150-151 24.367009275507645 28.02707445475057 27.676109300576584 19.929806969165202 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 2.0 26 1.5 27 1.0 28 2.5 29 5.0 30 7.0 31 11.5 32 21.5 33 29.5 34 38.0 35 52.0 36 80.0 37 108.5 38 124.5 39 150.5 40 189.5 41 247.5 42 276.5 43 277.5 44 277.0 45 273.5 46 283.0 47 281.0 48 263.0 49 218.0 50 167.0 51 147.0 52 120.0 53 79.0 54 55.5 55 44.5 56 38.5 57 30.0 58 20.5 59 18.5 60 14.0 61 6.5 62 8.5 63 10.0 64 5.5 65 2.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.065 40-44 0.08 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0125 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0125 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.037500000000000006 0.0 0.0 0.025 0.0 84-85 0.05 0.0 0.0 0.025 0.0 86-87 0.0625 0.0 0.0 0.025 0.0 88-89 0.075 0.0 0.0 0.025 0.0 90-91 0.075 0.0 0.0 0.025 0.0 92-93 0.1375 0.0 0.0 0.025 0.0 94-95 0.225 0.0 0.0 0.025 0.0 96-97 0.2875 0.0 0.0 0.025 0.0 98-99 0.325 0.0 0.0 0.025 0.0 100-101 0.4 0.0 0.0 0.025 0.0 102-103 0.4375 0.0 0.0 0.025 0.0 104-105 0.475 0.0 0.0 0.025 0.0 106-107 0.5875 0.0 0.0 0.025 0.0 108-109 0.7124999999999999 0.0 0.0 0.025 0.0 110-111 0.825 0.0 0.0 0.025 0.0 112-113 0.9625 0.0 0.0 0.025 0.0 114-115 1.0625 0.0 0.0 0.025 0.0 116-117 1.15 0.0 0.0 0.025 0.0 118-119 1.275 0.0 0.0 0.025 0.0 120-121 1.5750000000000002 0.0 0.0 0.025 0.0 122-123 1.7875 0.0 0.0 0.025 0.0 124-125 2.05 0.0 0.0 0.025 0.0 126-127 2.25 0.0 0.0 0.025 0.0 128-129 2.4375 0.0 0.0 0.025 0.0 130-131 2.6375 0.0 0.0 0.025 0.0 132-133 2.8499999999999996 0.0 0.0 0.025 0.0 134-135 3.1375 0.0 0.0 0.025 0.0 136-137 3.475 0.0 0.0 0.025 0.0 138-139 3.7375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCTTC 10 0.0068343505 144.975 9 >>END_MODULE Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788762 spots for SRR7180141.sra Written 788762 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra Read 788751 spots for SRR7180141.sra Written 788751 spots for SRR7180141.sra SRR ids: ['SRR7180141.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zlkbsmd9 SRR7180141.sra spots: 15775031 blocks: [[1, 788751], [788752, 1577502], [1577503, 2366253], [2366254, 3155004], [3155005, 3943755], [3943756, 4732506], [4732507, 5521257], [5521258, 6310008], [6310009, 7098759], [7098760, 7887510], [7887511, 8676261], [8676262, 9465012], [9465013, 10253763], [10253764, 11042514], [11042515, 11831265], [11831266, 12620016], [12620017, 13408767], [13408768, 14197518], [14197519, 14986269], [14986270, 15775031]] SRR7180141 file size 5323940 SRR7180141 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180141 SRR7180141_1.fastq SRR7180141_2.fastq Input file: SRR7180141_1.fastq Paired file: SRR7180141_2.fastq trimmed: SRR7180141-trimmed-pair1.fastq, SRR7180141-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:26:46 2025 >> started Mon Feb 10 22:27:02 2025 >> done (16.696s) 15775031 read pairs processed; of these: 19100 ( 0.12%) short read pairs filtered out after trimming by size control 16142 ( 0.10%) empty read pairs filtered out after trimming by size control 15739789 (99.78%) read pairs available; of these: 5537562 (35.18%) trimmed read pairs available after processing 10202227 (64.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 5 0.00% 25 1 0.00% 26 7 0.00% 27 4 0.00% 28 4 0.00% 29 2 0.00% 30 2 0.00% 31 2 0.00% 32 10 0.00% 33 1 0.00% 34 4 0.00% 35 4 0.00% 36 1 0.00% 37 5 0.00% 38 14 0.00% 39 40 0.00% 40 5 0.00% 41 9 0.00% 42 14 0.00% 43 11 0.00% 44 8 0.00% 45 34 0.00% 46 15 0.00% 47 14 0.00% 48 12 0.00% 49 14 0.00% 50 16 0.00% 51 15 0.00% 52 24 0.00% 53 48 0.00% 54 39 0.00% 55 110 0.00% 56 136 0.00% 57 52 0.00% 58 35 0.00% 59 46 0.00% 60 62 0.00% 61 90 0.00% 62 145 0.00% 63 102 0.00% 64 88 0.00% 65 104 0.00% 66 111 0.00% 67 119 0.00% 68 125 0.00% 69 166 0.00% 70 178 0.00% 71 216 0.00% 72 265 0.00% 73 309 0.00% 74 361 0.00% 75 388 0.00% 76 508 0.00% 77 612 0.00% 78 659 0.00% 79 783 0.00% 80 775 0.00% 81 927 0.01% 82 1001 0.01% 83 1226 0.01% 84 2034 0.01% 85 2715 0.02% 86 2866 0.02% 87 3257 0.02% 88 3344 0.02% 89 3402 0.02% 90 3707 0.02% 91 3917 0.02% 92 4300 0.03% 93 4388 0.03% 94 4797 0.03% 95 5138 0.03% 96 5354 0.03% 97 5953 0.04% 98 6237 0.04% 99 6529 0.04% 100 6990 0.04% 101 7612 0.05% 102 7989 0.05% 103 8493 0.05% 104 8971 0.06% 105 9999 0.06% 106 10576 0.07% 107 11076 0.07% 108 11672 0.07% 109 12175 0.08% 110 12760 0.08% 111 13566 0.09% 112 14551 0.09% 113 15287 0.10% 114 16420 0.10% 115 17218 0.11% 116 18145 0.12% 117 19120 0.12% 118 19895 0.13% 119 21452 0.14% 120 23016 0.15% 121 24317 0.15% 122 23528 0.15% 123 25027 0.16% 124 26297 0.17% 125 27426 0.17% 126 28441 0.18% 127 29792 0.19% 128 31147 0.20% 129 32623 0.21% 130 34015 0.22% 131 35653 0.23% 132 38190 0.24% 133 40436 0.26% 134 41735 0.27% 135 44459 0.28% 136 46220 0.29% 137 49309 0.31% 138 52120 0.33% 139 55238 0.35% 140 59943 0.38% 141 64854 0.41% 142 70944 0.45% 143 78721 0.50% 144 89640 0.57% 145 102930 0.65% 146 122184 0.78% 147 162085 1.03% 148 243202 1.55% 149 488395 3.10% 150 3003676 19.08% 151 10202227 64.82% 15739789 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=30 prefix-density=0.30 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=418.91 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=34.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=35 prefix-density=0.27 prefix-fanout=2.3 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=380.33 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=31.9 sequence=AAGAAGAAGAAA SRR7180141 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:27:49 Started mapping on | Feb 10 22:27:49 Finished on | Feb 10 22:29:44 Mapping speed, Million of reads per hour | 492.72 Number of input reads | 15739789 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14646941 Uniquely mapped reads % | 93.06% Average mapped length | 296.36 Number of splices: Total | 15003405 Number of splices: Annotated (sjdb) | 14724423 Number of splices: GT/AG | 14762848 Number of splices: GC/AG | 192400 Number of splices: AT/AC | 11425 Number of splices: Non-canonical | 36732 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362314 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 31620 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.39% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 748318 748318 748318 N_multimapping 362314 362314 362314 N_noFeature 352140 14499041 423676 N_ambiguous 151522 913 74530 UnstrandedReadsAssigned:14143279 PositiveStrandReadsAssigned:146987 NegativeStrandReadsAssigned:14148735 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180141 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180141-trimmed-pair1.fastq SRR7180141-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,739,789 reads, 14,055,078 reads pseudoaligned [quant] estimated average fragment length: 249.653 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR7180141.ke.tsv 34699 SRR7180141.se.tsv 87100 total ==> SRR7180141.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.35 1071 42.8325 Potri.005G024800.1.v4.1 1035 786.347 192 17.2776 Potri.004G059700.1.v4.1 961 712.368 53 5.26464 Potri.007G009000.2.v4.1 1416 1167.35 0 0 Potri.003G141000.2.v4.1 2943 2694.35 502 13.184 Potri.016G087400.1.v4.1 270 75.626 1071 1002.11 Potri.015G069301.1.v4.1 564 320.504 0 0 Potri.010G195200.1.v4.1 1773 1524.35 263 12.2087 Potri.012G127500.1.v4.1 977 728.363 5700 553.764 ==> SRR7180141.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 182 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 401 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 195 SRR7180141 completed mapping pipeline successfully