Starting /dee2/code/volunteer_pipeline.sh SRR7180142 current disk space = 3057340321792 free memory = 1145068688 SRR7180142 SRAfilesize 5daf359bcecfe2f8f6b35124714551b5 SRR7180142.sra SRR7180142.sra file validated SRR7180142 is paired end SRR7180142 is conventional basespace SRR7180142 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.70925 33.0 33.0 34.0 31.0 34.0 2 32.79575 33.0 33.0 34.0 31.0 34.0 3 32.3085 33.0 33.0 33.0 31.0 34.0 4 32.65025 33.0 33.0 33.0 31.0 34.0 5 33.20225 33.0 33.0 34.0 33.0 34.0 6 37.07875 38.0 37.0 38.0 35.0 38.0 7 37.33325 38.0 38.0 38.0 36.0 38.0 8 37.37625 38.0 38.0 38.0 36.0 38.0 9 37.617 38.0 38.0 38.0 38.0 38.0 10-14 37.68435 38.0 38.0 38.0 38.0 38.0 15-19 37.700900000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.64575000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.605599999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.59009999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.557500000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.49830000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.47175 38.0 38.0 38.0 38.0 38.0 50-54 37.4368 38.0 38.0 38.0 38.0 38.0 55-59 37.391000000000005 38.0 38.0 38.0 37.8 38.0 60-64 37.3802 38.0 38.0 38.0 37.4 38.0 65-69 37.3141 38.0 38.0 38.0 37.2 38.0 70-74 37.32125 38.0 38.0 38.0 37.0 38.0 75-79 37.24915 38.0 38.0 38.0 37.0 38.0 80-84 37.1854 38.0 38.0 38.0 37.0 38.0 85-89 37.153099999999995 38.0 38.0 38.0 37.0 38.0 90-94 37.104049999999994 38.0 38.0 38.0 36.8 38.0 95-99 37.0526 38.0 38.0 38.0 36.6 38.0 100-104 36.93725 38.0 38.0 38.0 36.0 38.0 105-109 36.87045 38.0 38.0 38.0 36.0 38.0 110-114 36.82695 38.0 38.0 38.0 35.8 38.0 115-119 36.68405 38.0 38.0 38.0 35.0 38.0 120-124 36.57535 38.0 38.0 38.0 35.0 38.0 125-129 36.4659 38.0 38.0 38.0 34.8 38.0 130-134 36.291399999999996 38.0 38.0 38.0 33.8 38.0 135-139 36.110299999999995 38.0 38.0 38.0 34.0 38.0 140-144 35.8803 38.0 38.0 38.0 33.4 38.0 145-149 35.6093 38.0 37.6 38.0 33.0 38.0 150-151 33.081375 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 2.0 6 1.0 7 0.0 8 2.0 9 1.0 10 2.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 2.0 18 4.0 19 4.0 20 3.0 21 8.0 22 5.0 23 7.0 24 3.0 25 5.0 26 11.0 27 12.0 28 10.0 29 21.0 30 19.0 31 18.0 32 39.0 33 48.0 34 87.0 35 125.0 36 372.0 37 3185.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.46940356312936 15.182029434546862 13.477924089852827 36.870642912470956 2 20.77596996245307 17.99749687108886 36.69586983729662 24.53066332916145 3 18.625 21.65 26.900000000000002 32.824999999999996 4 22.375 28.95 22.8 25.874999999999996 5 19.3 32.4 26.900000000000002 21.4 6 18.224999999999998 34.300000000000004 27.35 20.125 7 14.249999999999998 27.3 40.125 18.325 8 17.8 26.674999999999997 32.425 23.1 9 16.175 26.525 34.55 22.75 10-14 18.709999999999997 31.259999999999998 27.925 22.105 15-19 18.65 30.195 27.855 23.3 20-24 19.195 29.62 28.435 22.75 25-29 18.65 30.159999999999997 28.17 23.02 30-34 19.42 29.925 27.79 22.865 35-39 19.085 30.28 27.77 22.865 40-44 18.81 30.520000000000003 27.384999999999998 23.285 45-49 19.38 29.635 27.415 23.57 50-54 18.990000000000002 29.875 27.694999999999997 23.44 55-59 19.555 29.815 27.155 23.474999999999998 60-64 19.025 29.509999999999998 28.055000000000003 23.41 65-69 19.314999999999998 29.310000000000002 27.700000000000003 23.674999999999997 70-74 19.545 29.349999999999998 27.845 23.26 75-79 19.29 29.145 27.67 23.895 80-84 19.71 28.994999999999997 27.77 23.525 85-89 20.330000000000002 28.720000000000002 27.560000000000002 23.39 90-94 20.11 28.439999999999998 27.755000000000003 23.695 95-99 20.424999999999997 28.62 27.845 23.11 100-104 20.345 28.98 27.310000000000002 23.365 105-109 20.36 28.32 27.62 23.7 110-114 20.200000000000003 28.1 27.73 23.97 115-119 20.185 29.154999999999998 26.87 23.79 120-124 20.23 29.005 26.87 23.895 125-129 20.32 28.475 27.189999999999998 24.015 130-134 20.575 28.34 27.015 24.07 135-139 20.24 28.835 26.889999999999997 24.035 140-144 20.615 28.9 26.435 24.05 145-149 21.37 28.799999999999997 25.795 24.035 150-151 20.907840440165064 28.110541453044892 26.68500687757909 24.296611229210953 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 3.5 2 2.5 3 0.5 4 0.5 5 0.5 6 1.0 7 1.0 8 0.5 9 1.5 10 1.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.0 21 1.0 22 3.5 23 4.0 24 4.0 25 5.5 26 9.5 27 17.0 28 19.0 29 26.0 30 29.0 31 36.0 32 51.5 33 70.0 34 80.0 35 86.5 36 119.5 37 145.5 38 155.5 39 169.5 40 195.0 41 209.5 42 226.5 43 259.0 44 261.0 45 248.0 46 221.5 47 224.5 48 238.5 49 193.0 50 155.5 51 136.0 52 101.5 53 70.0 54 56.5 55 41.5 56 28.0 57 27.0 58 21.0 59 9.5 60 5.0 61 3.5 62 3.5 63 2.5 64 2.0 65 2.5 66 1.0 67 1.0 68 1.5 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.175 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01440485216074 97.95 2 0.9097801364670205 1.7999999999999998 3 0.050543340914834464 0.15 4 0.025271670457417232 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.3624999999999998 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 4.0875 0.0 0.0 0.0 0.0 124-125 4.574999999999999 0.0 0.0 0.0 0.0 126-127 4.875 0.0 0.0 0.0 0.0 128-129 5.35 0.0 0.0 0.0 0.0 130-131 5.85 0.0 0.0 0.0 0.0 132-133 6.35 0.0 0.0 0.0 0.0 134-135 7.1625 0.0 0.0 0.0 0.0 136-137 7.762499999999999 0.0 0.0 0.0 0.0 138-139 8.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180142 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180142_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10925 34.0 33.0 34.0 33.0 34.0 2 33.18375 34.0 33.0 34.0 33.0 34.0 3 33.24725 34.0 33.0 34.0 33.0 34.0 4 33.211 34.0 33.0 34.0 33.0 34.0 5 33.24375 34.0 33.0 34.0 33.0 34.0 6 37.413 38.0 38.0 38.0 38.0 38.0 7 37.3255 38.0 38.0 38.0 38.0 38.0 8 37.348 38.0 38.0 38.0 38.0 38.0 9 37.2945 38.0 38.0 38.0 38.0 38.0 10-14 37.28435 38.0 38.0 38.0 38.0 38.0 15-19 37.25605 38.0 38.0 38.0 38.0 38.0 20-24 37.2586 38.0 38.0 38.0 38.0 38.0 25-29 37.223699999999994 38.0 38.0 38.0 37.8 38.0 30-34 37.1965 38.0 38.0 38.0 37.8 38.0 35-39 37.120850000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.149300000000004 38.0 38.0 38.0 37.2 38.0 45-49 37.1593 38.0 38.0 38.0 37.0 38.0 50-54 37.14395 38.0 38.0 38.0 37.0 38.0 55-59 37.1371 38.0 38.0 38.0 37.0 38.0 60-64 37.089150000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.04385 38.0 38.0 38.0 37.0 38.0 70-74 36.95485 38.0 38.0 38.0 36.6 38.0 75-79 36.98365 38.0 38.0 38.0 36.4 38.0 80-84 36.91235 38.0 38.0 38.0 36.0 38.0 85-89 36.83585 38.0 38.0 38.0 36.0 38.0 90-94 36.7628 38.0 38.0 38.0 36.0 38.0 95-99 36.66865 38.0 38.0 38.0 35.8 38.0 100-104 36.59615 38.0 38.0 38.0 35.6 38.0 105-109 36.437650000000005 38.0 38.0 38.0 34.6 38.0 110-114 36.32435 38.0 38.0 38.0 34.0 38.0 115-119 36.24105 38.0 38.0 38.0 34.0 38.0 120-124 36.1032 38.0 38.0 38.0 34.0 38.0 125-129 35.950300000000006 38.0 38.0 38.0 33.6 38.0 130-134 35.68575 38.0 37.6 38.0 33.0 38.0 135-139 35.37075 38.0 36.2 38.0 31.4 38.0 140-144 34.97425 38.0 36.0 38.0 30.0 38.0 145-149 34.75665 38.0 36.0 38.0 29.4 38.0 150-151 31.400875 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 3.0 4 2.0 5 2.0 6 3.0 7 1.0 8 1.0 9 0.0 10 2.0 11 1.0 12 3.0 13 2.0 14 1.0 15 1.0 16 0.0 17 5.0 18 8.0 19 5.0 20 4.0 21 6.0 22 7.0 23 5.0 24 5.0 25 12.0 26 14.0 27 9.0 28 24.0 29 19.0 30 22.0 31 32.0 32 51.0 33 62.0 34 80.0 35 166.0 36 453.0 37 2975.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.9 18.15 17.8 27.150000000000002 2 23.724999999999998 24.224999999999998 34.675 17.375 3 22.175 26.924999999999997 29.725 21.175 4 25.575 33.0 22.900000000000002 18.525 5 24.9 35.125 22.875 17.1 6 20.38009502375594 35.608902225556385 24.60615153788447 19.4048512128032 7 19.979994998749685 19.30482620655164 40.235058764691175 20.4801200300075 8 23.549999999999997 23.25 27.650000000000002 25.55 9 23.005751437859466 25.156289072268066 28.232058014503625 23.605901475368842 10-14 24.24227268180454 28.693608082424728 26.052815844753425 21.011303391017304 15-19 24.029611844737893 27.425970388155264 27.09083633453381 21.453581432573028 20-24 23.71185592796398 28.849424712356175 26.64832416208104 20.790395197598798 25-29 24.00160144129717 28.355519967971176 27.209488539685715 20.43339005104594 30-34 23.61187603264407 28.47343914284284 27.086566865268114 20.82811795924498 35-39 24.549098196392784 28.281563126252507 27.074148296593187 20.095190380761522 40-44 23.860106223068446 27.6630924942379 27.743260847780338 20.733540434913316 45-49 24.11688181727209 27.67437206044231 27.539277494245972 20.669468628039628 50-54 24.18209104552276 28.57928964482241 27.188594297148573 20.050025012506254 55-59 24.32216108054027 28.269134567283643 27.008504252126066 20.400200100050025 60-64 24.317158579289643 27.808904452226113 27.288644322161083 20.58529264632316 65-69 24.352176088044022 27.823911955977987 27.243621810905456 20.580290145072535 70-74 24.726181545386346 27.926981745436358 27.396849212303074 19.94998749687422 75-79 23.895973993498373 27.691922980745186 27.991997999499873 20.420105026256564 80-84 24.15603900975244 27.28182045511378 28.122030507626906 20.44011002750688 85-89 24.14603650912728 27.861965491372843 27.701925481370342 20.29007251812953 90-94 24.17741774177418 28.147814781478147 27.627762776277624 20.047004700470048 95-99 24.206210310515523 28.10140507025351 27.69138456922846 20.001000050002503 100-104 24.427442744274426 28.06280628062806 27.642764276427645 19.866986698669866 105-109 24.24621231061553 27.9813990699535 27.69638481924096 20.07600380019001 110-114 23.741187059352967 27.796389819490976 28.186409320466023 20.276013800690034 115-119 24.392439243924393 27.467746774677465 28.332833283328334 19.806980698069808 120-124 24.52245224522452 28.082808280828083 27.927792779277926 19.466946694669467 125-129 24.818722808421263 27.48412261839276 28.399259888983348 19.297894684202628 130-134 24.3498699739948 28.100620124024804 28.070614122824566 19.47889577915583 135-139 24.652465246524653 28.512851285128516 27.552755275527552 19.28192819281928 140-144 24.8112405620281 28.0314015700785 27.87139356967848 19.28596429821491 145-149 25.15 27.944999999999997 27.445000000000004 19.46 150-151 25.63941825476429 27.444834503510528 28.159478435305918 18.756268806419257 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 2.5 24 3.0 25 2.0 26 1.5 27 3.0 28 7.5 29 8.5 30 10.0 31 18.5 32 18.0 33 19.5 34 34.5 35 45.0 36 53.0 37 78.0 38 108.0 39 136.5 40 181.0 41 224.5 42 253.5 43 279.0 44 309.0 45 309.5 46 294.5 47 276.0 48 255.0 49 225.5 50 190.5 51 157.5 52 123.5 53 100.5 54 72.5 55 56.0 56 38.5 57 22.0 58 15.5 59 15.0 60 14.5 61 7.0 62 4.5 63 5.0 64 3.0 65 2.0 66 3.0 67 2.0 68 1.0 69 1.0 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.0 9 0.025 10-14 0.03 15-19 0.04 20-24 0.05 25-29 0.09 30-34 0.135 35-39 0.2 40-44 0.21 45-49 0.06999999999999999 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.05 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.01 95-99 0.005 100-104 0.01 105-109 0.005 110-114 0.005 115-119 0.01 120-124 0.01 125-129 0.015 130-134 0.02 135-139 0.01 140-144 0.005 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91194331983806 97.725 2 0.9615384615384616 1.9 3 0.12651821862348178 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.6375 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.6625 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.4625 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.1875 0.0 0.0 0.0 0.0 124-125 4.775 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.55 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.525 0.0 0.0 0.0 0.0 134-135 7.2875 0.0 0.0 0.0 0.0 136-137 7.925000000000001 0.0 0.0 0.0 0.0 138-139 8.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAGAC 10 0.006830828 145.0 1 TCGCTAA 10 0.006830828 145.0 9 CGTCTCT 10 0.006830828 145.0 1 TTGCTAG 10 0.006830828 145.0 8 >>END_MODULE Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477049 spots for SRR7180142.sra Written 477049 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra Read 477040 spots for SRR7180142.sra Written 477040 spots for SRR7180142.sra SRR ids: ['SRR7180142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__cvbmdx7 SRR7180142.sra spots: 9540809 blocks: [[1, 477040], [477041, 954080], [954081, 1431120], [1431121, 1908160], [1908161, 2385200], [2385201, 2862240], [2862241, 3339280], [3339281, 3816320], [3816321, 4293360], [4293361, 4770400], [4770401, 5247440], [5247441, 5724480], [5724481, 6201520], [6201521, 6678560], [6678561, 7155600], [7155601, 7632640], [7632641, 8109680], [8109681, 8586720], [8586721, 9063760], [9063761, 9540809]] SRR7180142 file size 3212263 SRR7180142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180142 SRR7180142_1.fastq SRR7180142_2.fastq Input file: SRR7180142_1.fastq Paired file: SRR7180142_2.fastq trimmed: SRR7180142-trimmed-pair1.fastq, SRR7180142-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:26:23 2025 >> started Mon Feb 10 22:26:34 2025 >> done (11.459s) 9540809 read pairs processed; of these: 22907 ( 0.24%) short read pairs filtered out after trimming by size control 18913 ( 0.20%) empty read pairs filtered out after trimming by size control 9498989 (99.56%) read pairs available; of these: 3657661 (38.51%) trimmed read pairs available after processing 5841328 (61.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 7 0.00% 22 5 0.00% 23 8 0.00% 24 10 0.00% 25 10 0.00% 26 11 0.00% 27 7 0.00% 28 9 0.00% 29 14 0.00% 30 6 0.00% 31 7 0.00% 32 10 0.00% 33 10 0.00% 34 7 0.00% 35 9 0.00% 36 11 0.00% 37 23 0.00% 38 12 0.00% 39 15 0.00% 40 11 0.00% 41 15 0.00% 42 14 0.00% 43 14 0.00% 44 33 0.00% 45 33 0.00% 46 20 0.00% 47 57 0.00% 48 31 0.00% 49 55 0.00% 50 31 0.00% 51 58 0.00% 52 45 0.00% 53 70 0.00% 54 58 0.00% 55 104 0.00% 56 101 0.00% 57 81 0.00% 58 51 0.00% 59 69 0.00% 60 78 0.00% 61 99 0.00% 62 104 0.00% 63 126 0.00% 64 105 0.00% 65 136 0.00% 66 137 0.00% 67 165 0.00% 68 180 0.00% 69 191 0.00% 70 241 0.00% 71 271 0.00% 72 325 0.00% 73 344 0.00% 74 460 0.00% 75 582 0.01% 76 998 0.01% 77 942 0.01% 78 764 0.01% 79 833 0.01% 80 975 0.01% 81 1100 0.01% 82 1287 0.01% 83 1407 0.01% 84 2387 0.03% 85 3081 0.03% 86 3375 0.04% 87 4144 0.04% 88 4369 0.05% 89 4612 0.05% 90 4986 0.05% 91 5112 0.05% 92 5449 0.06% 93 5738 0.06% 94 5979 0.06% 95 6158 0.06% 96 6765 0.07% 97 7098 0.07% 98 7469 0.08% 99 8070 0.08% 100 8685 0.09% 101 9265 0.10% 102 10120 0.11% 103 10669 0.11% 104 11146 0.12% 105 12208 0.13% 106 12978 0.14% 107 13660 0.14% 108 14490 0.15% 109 15358 0.16% 110 15797 0.17% 111 17445 0.18% 112 18058 0.19% 113 18974 0.20% 114 20204 0.21% 115 21345 0.22% 116 21914 0.23% 117 22839 0.24% 118 24048 0.25% 119 25772 0.27% 120 26208 0.28% 121 27034 0.28% 122 27744 0.29% 123 29081 0.31% 124 30134 0.32% 125 30277 0.32% 126 31933 0.34% 127 33217 0.35% 128 34073 0.36% 129 34963 0.37% 130 35806 0.38% 131 37163 0.39% 132 38958 0.41% 133 40725 0.43% 134 42373 0.45% 135 43854 0.46% 136 44996 0.47% 137 46842 0.49% 138 48180 0.51% 139 49951 0.53% 140 51318 0.54% 141 53856 0.57% 142 57571 0.61% 143 60839 0.64% 144 66734 0.70% 145 73160 0.77% 146 82171 0.87% 147 99870 1.05% 148 136727 1.44% 149 248239 2.61% 150 1570898 16.54% 151 5841328 61.49% 9498989 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=36 prefix-density=0.86 prefix-fanout=2.3 sequence=CCACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=71.74 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=11.0 sequence=TCTCAACAAAACAGCAAGATAAAAAGATCGACAGGTACACAGAAAGACCTTATTCAGGGGCACTATGGCTACCAACAATTTATTGTGACTGAAGTGGATAGCAGCTGCTTTAATTTTACTTGTTCATGGCAACGACCTTGGACCAAGCTGGCCTCGAGGTGATATCTGCTACCCATGCGCTAACATGGGGTCGGGAATCGAATAGTTTCTTCACGTGTGTCCTCATCGCGCAAGATATGTTAGGGAGATGGTGCAAATCAGCCAAGGTGAAGATATCGCCTCCCAAGTACTTGGACTGAGCCAACCTTGACTCGTAGACATCGAGAACCTTACCGAGCTTAGCCTCGTTTTCCTCCACCGCTGCATTATCTGTGGGAATTCCAAACATTGGCTTAAAAACTAGCTCCCAGTTCAGCTTTGAAGCTACTGGGTCAAATTGGTGAGCCTCAACCTCCATCCACACTGATAATGTTGCCATCTGCTTGCCTGGGATAACAAGCGGAGTCCCCTT criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=30 prefix-density=0.90 prefix-fanout=2.3 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=34.88 fanout-score-rank=1 prefix-density=1.64 prefix-fanout=2.8 sequence=CTGCAAATGAGA SRR7180142 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:27:20 Started mapping on | Feb 10 22:27:20 Finished on | Feb 10 22:28:29 Mapping speed, Million of reads per hour | 495.60 Number of input reads | 9498989 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 8988380 Uniquely mapped reads % | 94.62% Average mapped length | 292.97 Number of splices: Total | 7758122 Number of splices: Annotated (sjdb) | 7593139 Number of splices: GT/AG | 7627762 Number of splices: GC/AG | 97156 Number of splices: AT/AC | 6727 Number of splices: Non-canonical | 26477 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282607 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 30248 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.02% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 248491 248491 248491 N_multimapping 282607 282607 282607 N_noFeature 220360 8882075 260626 N_ambiguous 110662 617 44380 UnstrandedReadsAssigned:8657358 PositiveStrandReadsAssigned:105688 NegativeStrandReadsAssigned:8683374 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180142 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180142-trimmed-pair1.fastq SRR7180142-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,498,989 reads, 8,614,482 reads pseudoaligned [quant] estimated average fragment length: 213.706 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR7180142.ke.tsv 34699 SRR7180142.se.tsv 87100 total ==> SRR7180142.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.29 654 30.8121 Potri.005G024800.1.v4.1 1035 822.294 256 26.4791 Potri.004G059700.1.v4.1 961 748.304 56 6.36503 Potri.007G009000.2.v4.1 1416 1203.29 0 0 Potri.003G141000.2.v4.1 2943 2730.29 289.233 9.0101 Potri.016G087400.1.v4.1 270 86.1629 738 728.496 Potri.015G069301.1.v4.1 564 352.515 0 0 Potri.010G195200.1.v4.1 1773 1560.29 168 9.15786 Potri.012G127500.1.v4.1 977 764.294 1802 200.533 ==> SRR7180142.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 573 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 242 SRR7180142 completed mapping pipeline successfully