Starting /dee2/code/volunteer_pipeline.sh SRR7180143 current disk space = 3057664864256 free memory = 1576040208 SRR7180143 SRAfilesize 13205fe87f00409561ee8cebc34b1341 SRR7180143.sra SRR7180143.sra file validated SRR7180143 is paired end SRR7180143 is conventional basespace SRR7180143 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180143_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.58425 33.0 31.0 33.0 18.0 34.0 2 32.343 33.0 33.0 34.0 28.0 34.0 3 32.84925 33.0 33.0 34.0 32.0 34.0 4 32.48675 33.0 33.0 34.0 31.0 34.0 5 33.04625 33.0 33.0 34.0 32.0 34.0 6 36.5555 38.0 37.0 38.0 34.0 38.0 7 37.28425 38.0 38.0 38.0 36.0 38.0 8 37.475 38.0 38.0 38.0 37.0 38.0 9 37.58075 38.0 38.0 38.0 37.0 38.0 10-14 37.56085 38.0 38.0 38.0 38.0 38.0 15-19 37.5389 38.0 38.0 38.0 38.0 38.0 20-24 37.5345 38.0 38.0 38.0 37.6 38.0 25-29 37.5004 38.0 38.0 38.0 37.8 38.0 30-34 37.41175 38.0 38.0 38.0 37.4 38.0 35-39 37.3791 38.0 38.0 38.0 37.0 38.0 40-44 37.4123 38.0 38.0 38.0 37.4 38.0 45-49 37.3852 38.0 38.0 38.0 37.2 38.0 50-54 37.33155000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.2803 38.0 38.0 38.0 37.0 38.0 60-64 37.22305 38.0 38.0 38.0 37.0 38.0 65-69 37.2392 38.0 38.0 38.0 37.0 38.0 70-74 37.133849999999995 38.0 38.0 38.0 36.4 38.0 75-79 37.082499999999996 38.0 38.0 38.0 36.2 38.0 80-84 37.02405 38.0 38.0 38.0 36.0 38.0 85-89 36.95425 38.0 38.0 38.0 36.0 38.0 90-94 36.87125 38.0 38.0 38.0 36.0 38.0 95-99 36.843399999999995 38.0 38.0 38.0 35.8 38.0 100-104 36.64945 38.0 38.0 38.0 35.0 38.0 105-109 36.64365 38.0 38.0 38.0 35.0 38.0 110-114 36.47025000000001 38.0 38.0 38.0 34.2 38.0 115-119 36.3963 38.0 38.0 38.0 34.0 38.0 120-124 36.2976 38.0 38.0 38.0 34.0 38.0 125-129 36.066199999999995 38.0 38.0 38.0 33.6 38.0 130-134 35.86755000000001 38.0 37.6 38.0 33.0 38.0 135-139 35.658500000000004 38.0 36.6 38.0 32.2 38.0 140-144 35.49555 38.0 36.2 38.0 31.6 38.0 145-149 35.05525 38.0 36.0 38.0 31.0 38.0 150-151 32.12425 36.5 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 3.0 8 1.0 9 2.0 10 3.0 11 0.0 12 2.0 13 1.0 14 2.0 15 1.0 16 1.0 17 3.0 18 3.0 19 2.0 20 5.0 21 3.0 22 2.0 23 7.0 24 7.0 25 7.0 26 14.0 27 8.0 28 11.0 29 24.0 30 30.0 31 42.0 32 50.0 33 73.0 34 101.0 35 224.0 36 458.0 37 2908.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.649385355424904 15.713522180652056 14.59112773917691 34.04596472474613 2 20.849999999999998 18.625 36.925000000000004 23.599999999999998 3 18.025 24.95 27.875 29.15 4 20.075000000000003 32.975 22.55 24.4 5 20.625 33.35 26.775 19.25 6 17.575 35.35 26.8 20.275000000000002 7 14.274999999999999 24.3 43.675000000000004 17.75 8 18.3 24.9 30.9 25.900000000000002 9 17.299999999999997 25.25 33.0 24.45 10-14 19.32 30.53 27.055 23.095 15-19 18.945 29.975 27.68 23.400000000000002 20-24 19.025 29.78 28.17 23.025000000000002 25-29 19.265 30.320000000000004 27.26 23.155 30-34 19.29 29.43 28.155 23.125 35-39 19.12 29.625 27.639999999999997 23.615 40-44 19.445 29.609999999999996 27.715 23.23 45-49 19.765 29.604999999999997 27.57 23.06 50-54 19.43 29.544999999999998 27.560000000000002 23.465 55-59 20.025000000000002 29.294999999999998 27.54 23.14 60-64 19.86 29.13 27.805000000000003 23.205000000000002 65-69 19.875 29.48 27.47 23.175 70-74 20.225 28.605000000000004 27.775 23.395 75-79 20.005 28.720000000000002 28.249999999999996 23.025000000000002 80-84 19.655 28.660000000000004 28.15 23.535 85-89 19.645000000000003 29.315 27.655 23.385 90-94 19.955000000000002 29.020000000000003 27.145000000000003 23.880000000000003 95-99 19.950000000000003 28.794999999999998 27.465 23.79 100-104 20.03 29.26 27.485 23.225 105-109 20.27 28.355000000000004 27.265 24.11 110-114 20.025000000000002 29.235 27.33 23.41 115-119 20.535 28.804999999999996 27.185 23.474999999999998 120-124 20.525 28.525 27.205000000000002 23.745 125-129 20.885 28.33 26.88 23.905 130-134 20.880000000000003 28.139999999999997 27.63 23.35 135-139 20.830000000000002 28.32 26.889999999999997 23.96 140-144 20.724999999999998 28.505000000000003 26.735 24.035 145-149 20.87 28.605000000000004 26.35 24.175 150-151 21.0375 28.725 25.5625 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 1.0 4 2.0 5 2.5 6 1.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 2.0 25 4.5 26 8.0 27 10.5 28 17.0 29 26.0 30 36.0 31 44.5 32 50.5 33 60.0 34 70.0 35 92.0 36 113.0 37 127.5 38 149.0 39 173.5 40 192.0 41 206.5 42 233.0 43 252.0 44 261.0 45 266.5 46 258.0 47 238.0 48 225.5 49 193.0 50 151.5 51 128.5 52 101.0 53 81.0 54 60.0 55 38.5 56 24.5 57 16.5 58 15.0 59 12.0 60 11.0 61 9.5 62 5.5 63 2.0 64 3.0 65 5.0 66 3.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.425 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 3.0875 0.0 0.0 0.0 0.0 124-125 3.6125 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.5625 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.637499999999999 0.0 0.0 0.0 0.0 134-135 6.1 0.0 0.0 0.0 0.0 136-137 6.9 0.0 0.0 0.0 0.0 138-139 7.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCAT 10 0.0068378756 144.95 5 ACACGTC 40 0.0056290138 54.35625 145 >>END_MODULE SRR7180143 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180143_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77425 33.0 33.0 34.0 32.0 34.0 2 32.8905 33.0 33.0 34.0 32.0 34.0 3 32.91225 34.0 33.0 34.0 32.0 34.0 4 32.86925 34.0 33.0 34.0 32.0 34.0 5 32.81175 34.0 33.0 34.0 32.0 34.0 6 36.9875 38.0 38.0 38.0 36.0 38.0 7 36.9265 38.0 38.0 38.0 36.0 38.0 8 36.87575 38.0 38.0 38.0 36.0 38.0 9 36.90475 38.0 38.0 38.0 37.0 38.0 10-14 36.88035 38.0 38.0 38.0 36.2 38.0 15-19 36.82115 38.0 38.0 38.0 36.4 38.0 20-24 36.841 38.0 38.0 38.0 36.2 38.0 25-29 36.7702 38.0 38.0 38.0 36.2 38.0 30-34 36.68855 38.0 38.0 38.0 36.0 38.0 35-39 36.65365 38.0 38.0 38.0 36.0 38.0 40-44 36.66065 38.0 38.0 38.0 36.0 38.0 45-49 36.67914999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.679700000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.65535 38.0 38.0 38.0 36.0 38.0 60-64 36.572 38.0 38.0 38.0 35.4 38.0 65-69 36.51925 38.0 38.0 38.0 35.2 38.0 70-74 36.5048 38.0 38.0 38.0 35.4 38.0 75-79 36.46645 38.0 38.0 38.0 35.0 38.0 80-84 36.4223 38.0 38.0 38.0 35.0 38.0 85-89 36.2273 38.0 38.0 38.0 34.0 38.0 90-94 36.1591 38.0 38.0 38.0 34.0 38.0 95-99 36.0676 38.0 38.0 38.0 34.0 38.0 100-104 35.8668 38.0 38.0 38.0 33.2 38.0 105-109 35.6973 38.0 37.8 38.0 32.2 38.0 110-114 35.7475 38.0 38.0 38.0 33.0 38.0 115-119 35.67325 38.0 37.8 38.0 32.8 38.0 120-124 35.34845 38.0 37.0 38.0 30.6 38.0 125-129 35.207350000000005 38.0 36.2 38.0 30.2 38.0 130-134 34.83075000000001 38.0 36.0 38.0 28.2 38.0 135-139 34.4777 38.0 35.4 38.0 26.2 38.0 140-144 34.3365 38.0 35.2 38.0 25.2 38.0 145-149 33.8394 38.0 35.0 38.0 22.4 38.0 150-151 30.342374999999997 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 14.0 4 5.0 5 1.0 6 7.0 7 2.0 8 1.0 9 3.0 10 7.0 11 2.0 12 2.0 13 3.0 14 5.0 15 6.0 16 5.0 17 4.0 18 6.0 19 4.0 20 5.0 21 5.0 22 9.0 23 11.0 24 9.0 25 10.0 26 22.0 27 20.0 28 20.0 29 45.0 30 39.0 31 47.0 32 65.0 33 100.0 34 133.0 35 199.0 36 527.0 37 2645.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.275 16.725 17.349999999999998 27.650000000000002 2 24.05 23.65 34.300000000000004 18.0 3 22.975 26.474999999999998 30.125 20.424999999999997 4 25.275 33.550000000000004 22.325 18.85 5 24.5 35.425000000000004 22.825 17.25 6 19.475 36.75 25.0 18.775 7 19.525000000000002 18.425 39.475 22.575 8 20.325 23.625 27.650000000000002 28.4 9 21.575 26.0 28.875 23.549999999999997 10-14 23.65 27.97 26.575 21.805 15-19 23.89 27.905 27.26 20.945 20-24 23.66564954229403 27.912560652293532 27.56240308138662 20.85938672402581 25-29 23.833600320384463 28.3189827793352 26.727072486984383 21.120344413295953 30-34 24.043086172344687 28.537074148296593 26.77855711422846 20.64128256513026 35-39 23.612573319296136 27.959091592720707 27.527949065022312 20.900386022960845 40-44 23.426222935044105 28.46331194867682 27.556134723336008 20.55433039294306 45-49 24.268054651919325 27.546168860417396 28.066663330163657 20.119113157499623 50-54 23.830957739434858 27.906976744186046 27.44186046511628 20.820205051262818 55-59 23.50735073507351 27.69276927692769 28.38783878387839 20.412041204120413 60-64 24.02 27.639999999999997 27.975 20.365 65-69 23.810000000000002 28.255000000000003 27.775 20.16 70-74 24.555 27.689999999999998 27.794999999999998 19.96 75-79 23.685000000000002 27.865000000000002 28.205000000000002 20.244999999999997 80-84 24.099999999999998 28.165000000000003 27.525 20.21 85-89 23.94 27.52 27.98 20.560000000000002 90-94 24.215 27.634999999999998 28.08 20.07 95-99 23.405 27.815 28.384999999999998 20.395 100-104 24.16 27.79 27.88 20.169999999999998 105-109 23.990000000000002 28.325 28.060000000000002 19.625 110-114 23.985 27.365000000000002 28.595 20.055 115-119 23.985 27.884999999999998 28.21 19.919999999999998 120-124 23.945 27.834999999999997 28.595 19.625 125-129 24.75 28.115000000000002 27.87 19.265 130-134 24.64 28.025 27.705000000000002 19.63 135-139 25.124999999999996 28.22 27.465 19.189999999999998 140-144 25.474999999999998 27.33 27.72 19.475 145-149 25.61 27.725 27.705000000000002 18.96 150-151 25.1219207202701 28.185569588595722 27.49781167937977 19.194698011754408 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 2.0 26 2.0 27 3.0 28 6.0 29 12.0 30 14.5 31 14.0 32 16.5 33 27.0 34 38.5 35 52.5 36 65.5 37 94.0 38 123.0 39 147.0 40 179.0 41 212.0 42 254.0 43 274.0 44 281.0 45 289.0 46 299.5 47 289.0 48 254.0 49 228.5 50 190.5 51 157.0 52 129.5 53 91.0 54 63.5 55 45.0 56 34.5 57 26.5 58 21.0 59 18.0 60 9.5 61 9.0 62 8.5 63 4.0 64 3.0 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.045 25-29 0.12 30-34 0.2 35-39 0.265 40-44 0.24 45-49 0.095 50-54 0.025 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.2 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.775 0.0 0.0 0.0 0.0 126-127 4.2875 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.925000000000001 0.0 0.0 0.0 0.0 134-135 6.387499999999999 0.0 0.0 0.0 0.0 136-137 7.1625 0.0 0.0 0.0 0.0 138-139 7.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTGC 10 0.0068573058 144.8125 145 AGAGAGT 10 0.0068573058 144.8125 145 >>END_MODULE Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885393 spots for SRR7180143.sra Written 885393 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra Read 885382 spots for SRR7180143.sra Written 885382 spots for SRR7180143.sra SRR ids: ['SRR7180143.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n886d2rv SRR7180143.sra spots: 17707651 blocks: [[1, 885382], [885383, 1770764], [1770765, 2656146], [2656147, 3541528], [3541529, 4426910], [4426911, 5312292], [5312293, 6197674], [6197675, 7083056], [7083057, 7968438], [7968439, 8853820], [8853821, 9739202], [9739203, 10624584], [10624585, 11509966], [11509967, 12395348], [12395349, 13280730], [13280731, 14166112], [14166113, 15051494], [15051495, 15936876], [15936877, 16822258], [16822259, 17707651]] SRR7180143 file size 5978841 SRR7180143 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180143 SRR7180143_1.fastq SRR7180143_2.fastq Input file: SRR7180143_1.fastq Paired file: SRR7180143_2.fastq trimmed: SRR7180143-trimmed-pair1.fastq, SRR7180143-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:27:37 2025 >> started Mon Feb 10 23:27:57 2025 >> done (19.727s) 17707651 read pairs processed; of these: 47064 ( 0.27%) short read pairs filtered out after trimming by size control 29238 ( 0.17%) empty read pairs filtered out after trimming by size control 17631349 (99.57%) read pairs available; of these: 6728499 (38.16%) trimmed read pairs available after processing 10902850 (61.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 9 0.00% 21 10 0.00% 22 6 0.00% 23 14 0.00% 24 15 0.00% 25 26 0.00% 26 19 0.00% 27 18 0.00% 28 24 0.00% 29 25 0.00% 30 29 0.00% 31 24 0.00% 32 23 0.00% 33 16 0.00% 34 28 0.00% 35 18 0.00% 36 18 0.00% 37 19 0.00% 38 14 0.00% 39 23 0.00% 40 23 0.00% 41 22 0.00% 42 24 0.00% 43 24 0.00% 44 30 0.00% 45 28 0.00% 46 38 0.00% 47 42 0.00% 48 38 0.00% 49 46 0.00% 50 53 0.00% 51 40 0.00% 52 61 0.00% 53 67 0.00% 54 70 0.00% 55 88 0.00% 56 85 0.00% 57 104 0.00% 58 110 0.00% 59 136 0.00% 60 145 0.00% 61 155 0.00% 62 146 0.00% 63 204 0.00% 64 237 0.00% 65 210 0.00% 66 276 0.00% 67 294 0.00% 68 318 0.00% 69 356 0.00% 70 436 0.00% 71 442 0.00% 72 554 0.00% 73 664 0.00% 74 778 0.00% 75 866 0.00% 76 1076 0.01% 77 1153 0.01% 78 1344 0.01% 79 1492 0.01% 80 1736 0.01% 81 1937 0.01% 82 2257 0.01% 83 2671 0.02% 84 4969 0.03% 85 6742 0.04% 86 7421 0.04% 87 8631 0.05% 88 9156 0.05% 89 9347 0.05% 90 9829 0.06% 91 9992 0.06% 92 10226 0.06% 93 10273 0.06% 94 10583 0.06% 95 11128 0.06% 96 11623 0.07% 97 12525 0.07% 98 13220 0.07% 99 14054 0.08% 100 14765 0.08% 101 15775 0.09% 102 16810 0.10% 103 17682 0.10% 104 18860 0.11% 105 20037 0.11% 106 21308 0.12% 107 22542 0.13% 108 24000 0.14% 109 24860 0.14% 110 26700 0.15% 111 28167 0.16% 112 29770 0.17% 113 30574 0.17% 114 32432 0.18% 115 34135 0.19% 116 35656 0.20% 117 37631 0.21% 118 38843 0.22% 119 40749 0.23% 120 43156 0.24% 121 44608 0.25% 122 44750 0.25% 123 46632 0.26% 124 48340 0.27% 125 49615 0.28% 126 51487 0.29% 127 53144 0.30% 128 54524 0.31% 129 57749 0.33% 130 59236 0.34% 131 61586 0.35% 132 64584 0.37% 133 67312 0.38% 134 69255 0.39% 135 72404 0.41% 136 74606 0.42% 137 77909 0.44% 138 81867 0.46% 139 86202 0.49% 140 89723 0.51% 141 95632 0.54% 142 102651 0.58% 143 110992 0.63% 144 122519 0.69% 145 137370 0.78% 146 159135 0.90% 147 200509 1.14% 148 284519 1.61% 149 515649 2.92% 150 2988559 16.95% 151 10902850 61.84% 17631349 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=37 prefix-density=0.19 prefix-fanout=2.0 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=308.27 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=30.1 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=6.23 fanout-score-rank=9 prefix-density=0.50 prefix-fanout=3.9 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=158.80 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=24.4 sequence=GAGAAGAAGGAT SRR7180143 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:28:43 Started mapping on | Feb 10 23:28:43 Finished on | Feb 10 23:31:03 Mapping speed, Million of reads per hour | 453.38 Number of input reads | 17631349 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16400243 Uniquely mapped reads % | 93.02% Average mapped length | 293.54 Number of splices: Total | 15115477 Number of splices: Annotated (sjdb) | 14839407 Number of splices: GT/AG | 14866989 Number of splices: GC/AG | 190992 Number of splices: AT/AC | 12333 Number of splices: Non-canonical | 45163 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450289 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 43418 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 829309 829309 829309 N_multimapping 450289 450289 450289 N_noFeature 385413 16231703 444991 N_ambiguous 188485 1197 78693 UnstrandedReadsAssigned:15826345 PositiveStrandReadsAssigned:167343 NegativeStrandReadsAssigned:15876559 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180143 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180143-trimmed-pair1.fastq SRR7180143-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,631,349 reads, 15,801,131 reads pseudoaligned [quant] estimated average fragment length: 223.22 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52401 SRR7180143.ke.tsv 34699 SRR7180143.se.tsv 87100 total ==> SRR7180143.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.78 840 24.72 Potri.005G024800.1.v4.1 1035 812.78 271 17.6205 Potri.004G059700.1.v4.1 961 738.79 33 2.36056 Potri.007G009000.2.v4.1 1416 1193.78 0 0 Potri.003G141000.2.v4.1 2943 2720.78 523.382 10.1659 Potri.016G087400.1.v4.1 270 83.6174 1515.46 957.792 Potri.015G069301.1.v4.1 564 343.84 0 0 Potri.010G195200.1.v4.1 1773 1550.78 195 6.64518 Potri.012G127500.1.v4.1 977 754.785 2737 191.634 ==> SRR7180143.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 775 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 254 SRR7180143 completed mapping pipeline successfully