Starting /dee2/code/volunteer_pipeline.sh SRR7180144 current disk space = 3057598648320 free memory = 1289977268 SRR7180144 SRAfilesize 58b13f53f20b21ba186c89424be1f721 SRR7180144.sra SRR7180144.sra file validated SRR7180144 is paired end SRR7180144 is conventional basespace SRR7180144 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180144_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.81075 33.0 32.0 34.0 27.0 34.0 2 32.588 33.0 33.0 34.0 29.0 34.0 3 32.6075 33.0 33.0 34.0 31.0 34.0 4 32.96775 34.0 33.0 34.0 31.0 34.0 5 32.9535 33.0 33.0 34.0 32.0 34.0 6 36.68475 38.0 37.0 38.0 34.0 38.0 7 37.3915 38.0 38.0 38.0 37.0 38.0 8 37.37375 38.0 38.0 38.0 37.0 38.0 9 37.49425 38.0 38.0 38.0 37.0 38.0 10-14 37.53639999999999 38.0 38.0 38.0 37.8 38.0 15-19 37.575950000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.53995 38.0 38.0 38.0 38.0 38.0 25-29 37.53830000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.52795 38.0 38.0 38.0 37.6 38.0 35-39 37.4766 38.0 38.0 38.0 37.4 38.0 40-44 37.493700000000004 38.0 38.0 38.0 37.4 38.0 45-49 37.42125 38.0 38.0 38.0 37.0 38.0 50-54 37.379000000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.27974999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.237449999999995 38.0 38.0 38.0 36.8 38.0 65-69 37.26645 38.0 38.0 38.0 37.0 38.0 70-74 37.17785 38.0 38.0 38.0 36.6 38.0 75-79 37.11665000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.04135 38.0 38.0 38.0 36.0 38.0 85-89 37.03435 38.0 38.0 38.0 36.0 38.0 90-94 36.899300000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.85665 38.0 38.0 38.0 35.4 38.0 100-104 36.7507 38.0 38.0 38.0 35.0 38.0 105-109 36.64280000000001 38.0 38.0 38.0 35.0 38.0 110-114 36.54535 38.0 38.0 38.0 34.4 38.0 115-119 36.4736 38.0 38.0 38.0 34.0 38.0 120-124 36.258449999999996 38.0 37.8 38.0 33.8 38.0 125-129 36.05515 38.0 37.6 38.0 33.4 38.0 130-134 35.842 38.0 37.0 38.0 32.6 38.0 135-139 35.610800000000005 38.0 36.4 38.0 31.6 38.0 140-144 35.48315 38.0 36.0 38.0 31.0 38.0 145-149 34.88805 38.0 36.0 38.0 30.0 38.0 150-151 32.041375 36.5 32.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.0 19 2.0 20 3.0 21 5.0 22 2.0 23 8.0 24 6.0 25 12.0 26 4.0 27 13.0 28 21.0 29 28.0 30 35.0 31 31.0 32 50.0 33 83.0 34 115.0 35 228.0 36 510.0 37 2835.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.44403573305308 15.31791907514451 13.583815028901732 35.65423016290069 2 20.575 19.375 35.3 24.75 3 17.65 26.200000000000003 27.55 28.599999999999998 4 21.05 31.900000000000002 23.775 23.275000000000002 5 20.925 34.5 25.25 19.325 6 18.224999999999998 33.575 25.924999999999997 22.275 7 13.875000000000002 23.65 43.475 19.0 8 18.475 24.3 30.125 27.1 9 18.0 23.775 31.95 26.275 10-14 18.94 29.165000000000003 27.73 24.165 15-19 19.439999999999998 28.82 27.925 23.815 20-24 19.155 29.110000000000003 27.939999999999998 23.794999999999998 25-29 18.59 28.610000000000003 28.384999999999998 24.415 30-34 19.21 29.849999999999998 27.395000000000003 23.544999999999998 35-39 19.21 28.744999999999997 28.244999999999997 23.799999999999997 40-44 19.915 28.715000000000003 27.810000000000002 23.56 45-49 19.895 28.075 27.515 24.515 50-54 19.61 28.7 27.71 23.98 55-59 19.950000000000003 28.46 27.900000000000002 23.69 60-64 20.305 28.09 27.98 23.625 65-69 19.415 28.64 27.97 23.974999999999998 70-74 19.665 28.425 28.299999999999997 23.61 75-79 19.99 28.28 27.525 24.205 80-84 19.939999999999998 28.665000000000003 27.025 24.37 85-89 19.925 28.549999999999997 27.689999999999998 23.835 90-94 20.155 28.205000000000002 27.644999999999996 23.995 95-99 20.085 28.050000000000004 28.22 23.645 100-104 20.075000000000003 28.585 27.46 23.880000000000003 105-109 20.244999999999997 28.115000000000002 28.07 23.57 110-114 20.080000000000002 28.62 27.495000000000005 23.805 115-119 20.64 28.575 27.47 23.315 120-124 20.18 27.925 28.48 23.415 125-129 20.244999999999997 28.34 27.339999999999996 24.075 130-134 20.215 28.439999999999998 27.845 23.5 135-139 20.525 27.750000000000004 28.02 23.705000000000002 140-144 20.355 28.43 27.224999999999998 23.990000000000002 145-149 20.325 27.855 27.305 24.515 150-151 20.3125 28.462500000000002 27.2625 23.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 3.0 25 6.0 26 7.5 27 8.5 28 14.0 29 20.0 30 27.5 31 32.0 32 39.5 33 55.0 34 59.0 35 70.5 36 92.0 37 114.0 38 121.0 39 144.5 40 185.0 41 212.5 42 240.0 43 263.5 44 283.5 45 286.0 46 274.5 47 257.0 48 230.5 49 199.5 50 175.0 51 151.5 52 114.5 53 76.5 54 65.0 55 50.5 56 28.5 57 21.0 58 16.5 59 12.5 60 9.0 61 7.0 62 5.0 63 3.5 64 3.0 65 3.0 66 2.5 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8500000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7375 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.3125 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 3.8499999999999996 0.0 0.0 0.0 0.0 134-135 4.125 0.0 0.0 0.0 0.0 136-137 4.425 0.0 0.0 0.0 0.0 138-139 4.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGTAG 10 0.0068396386 144.9375 4 TTGCTCC 10 0.0068396386 144.9375 3 >>END_MODULE SRR7180144 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180144_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74725 33.0 33.0 34.0 32.0 34.0 2 32.792 33.0 33.0 34.0 32.0 34.0 3 32.898 34.0 33.0 34.0 32.0 34.0 4 32.853 34.0 33.0 34.0 32.0 34.0 5 32.7285 34.0 33.0 34.0 32.0 34.0 6 36.92475 38.0 38.0 38.0 36.0 38.0 7 36.92475 38.0 38.0 38.0 37.0 38.0 8 36.81375 38.0 38.0 38.0 36.0 38.0 9 36.918 38.0 38.0 38.0 37.0 38.0 10-14 36.9348 38.0 38.0 38.0 36.8 38.0 15-19 36.88225 38.0 38.0 38.0 36.8 38.0 20-24 36.8371 38.0 38.0 38.0 36.8 38.0 25-29 36.71185 38.0 38.0 38.0 36.2 38.0 30-34 36.68675 38.0 38.0 38.0 36.0 38.0 35-39 36.6226 38.0 38.0 38.0 36.0 38.0 40-44 36.636900000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.6684 38.0 38.0 38.0 36.0 38.0 50-54 36.6509 38.0 38.0 38.0 36.0 38.0 55-59 36.60965 38.0 38.0 38.0 36.0 38.0 60-64 36.58495 38.0 38.0 38.0 35.8 38.0 65-69 36.525549999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.5052 38.0 38.0 38.0 35.4 38.0 75-79 36.45649999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.38095 38.0 38.0 38.0 35.0 38.0 85-89 36.18775 38.0 38.0 38.0 34.0 38.0 90-94 36.163 38.0 38.0 38.0 34.0 38.0 95-99 36.01235 38.0 38.0 38.0 34.0 38.0 100-104 35.848650000000006 38.0 38.0 38.0 33.2 38.0 105-109 35.692600000000006 38.0 37.8 38.0 31.8 38.0 110-114 35.7461 38.0 38.0 38.0 33.0 38.0 115-119 35.6817 38.0 37.2 38.0 33.0 38.0 120-124 35.458349999999996 38.0 37.2 38.0 31.6 38.0 125-129 35.1102 38.0 36.4 38.0 29.2 38.0 130-134 34.846199999999996 38.0 36.0 38.0 28.6 38.0 135-139 34.56195 38.0 35.4 38.0 27.0 38.0 140-144 34.2315 38.0 35.2 38.0 24.2 38.0 145-149 33.6519 38.0 35.0 38.0 19.0 38.0 150-151 30.306125 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 13.0 4 4.0 5 4.0 6 2.0 7 1.0 8 1.0 9 3.0 10 2.0 11 7.0 12 2.0 13 4.0 14 7.0 15 3.0 16 7.0 17 5.0 18 3.0 19 3.0 20 8.0 21 4.0 22 6.0 23 11.0 24 15.0 25 15.0 26 12.0 27 38.0 28 14.0 29 30.0 30 35.0 31 53.0 32 62.0 33 86.0 34 131.0 35 215.0 36 507.0 37 2668.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.050000000000004 17.05 18.375 25.525 2 25.624999999999996 24.125 32.025 18.224999999999998 3 21.425 27.05 30.725 20.8 4 24.9 33.35 22.95 18.8 5 24.45 35.625 22.25 17.675 6 18.975 37.1 24.5 19.425 7 19.675 18.6 41.675000000000004 20.05 8 21.5 23.95 27.950000000000003 26.6 9 22.95 24.45 28.925 23.674999999999997 10-14 23.830000000000002 29.09 25.485000000000003 21.595 15-19 23.21 28.265 27.644999999999996 20.880000000000003 20-24 23.281984595378614 29.17375212563769 26.84305291587476 20.70121036310893 25-29 23.76876876876877 29.134134134134133 26.691691691691695 20.405405405405403 30-34 22.995241672927623 28.70022539444027 27.573253193087904 20.731279739544203 35-39 23.52292658481584 28.45903282385367 27.582059634176897 20.435980957153596 40-44 23.379096101813808 28.43972341918028 27.267261248622106 20.913919230383808 45-49 23.602981639901945 27.700235129321126 27.545149832407823 21.151633398369103 50-54 23.708556283442515 28.16922538380757 27.669150372555883 20.45306796019403 55-59 23.50735073507351 28.222822282228222 27.85778577857786 20.412041204120413 60-64 23.715 28.205000000000002 27.810000000000002 20.27 65-69 23.315 28.205000000000002 27.544999999999998 20.935000000000002 70-74 24.215 28.16 27.445000000000004 20.18 75-79 24.060000000000002 27.694999999999997 27.47 20.775 80-84 23.830000000000002 28.449999999999996 27.525 20.195 85-89 23.661183059152957 28.14140707035352 28.086404320216012 20.111005550277515 90-94 23.849999999999998 28.549999999999997 27.250000000000004 20.349999999999998 95-99 23.87 28.4 27.544999999999998 20.185 100-104 23.935000000000002 28.199999999999996 27.515 20.349999999999998 105-109 24.26 27.810000000000002 27.950000000000003 19.98 110-114 23.925 28.365000000000002 27.505000000000003 20.205000000000002 115-119 23.96 28.09 27.694999999999997 20.255000000000003 120-124 24.36 27.925 27.77 19.945 125-129 24.455 27.615000000000002 28.12 19.81 130-134 25.095 27.884999999999998 27.42 19.6 135-139 24.695 28.375 27.58 19.35 140-144 25.005 28.205000000000002 27.625 19.165 145-149 25.064999999999998 28.345 27.384999999999998 19.205 150-151 24.878109763720467 27.82847855981998 28.328541067633456 18.964870608826104 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.5 23 2.0 24 1.0 25 2.0 26 3.0 27 3.0 28 7.5 29 12.0 30 10.5 31 12.0 32 20.5 33 31.5 34 41.5 35 53.0 36 67.0 37 91.5 38 108.5 39 141.5 40 191.5 41 228.5 42 273.5 43 283.5 44 295.5 45 322.0 46 301.5 47 288.5 48 259.5 49 204.5 50 173.5 51 146.0 52 101.0 53 72.0 54 63.5 55 42.0 56 28.0 57 27.5 58 25.0 59 18.0 60 10.5 61 7.0 62 5.0 63 3.5 64 4.0 65 2.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.1 30-34 0.17500000000000002 35-39 0.22499999999999998 40-44 0.21 45-49 0.055 50-54 0.015 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7749999999999999 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.2374999999999998 0.0 0.0 0.0 0.0 114-115 1.4874999999999998 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.8875000000000002 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.375 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.2 0.0 0.0 0.0 0.0 136-137 4.45 0.0 0.0 0.0 0.0 138-139 4.737500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAATC 10 0.0068573058 144.8125 6 GAATCAA 10 0.0068573058 144.8125 8 TGAATCA 10 0.0068573058 144.8125 7 >>END_MODULE Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768671 spots for SRR7180144.sra Written 768671 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra Read 768664 spots for SRR7180144.sra Written 768664 spots for SRR7180144.sra SRR ids: ['SRR7180144.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x5jkyacb SRR7180144.sra spots: 15373287 blocks: [[1, 768664], [768665, 1537328], [1537329, 2305992], [2305993, 3074656], [3074657, 3843320], [3843321, 4611984], [4611985, 5380648], [5380649, 6149312], [6149313, 6917976], [6917977, 7686640], [7686641, 8455304], [8455305, 9223968], [9223969, 9992632], [9992633, 10761296], [10761297, 11529960], [11529961, 12298624], [12298625, 13067288], [13067289, 13835952], [13835953, 14604616], [14604617, 15373287]] SRR7180144 file size 5187802 SRR7180144 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180144 SRR7180144_1.fastq SRR7180144_2.fastq Input file: SRR7180144_1.fastq Paired file: SRR7180144_2.fastq trimmed: SRR7180144-trimmed-pair1.fastq, SRR7180144-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 22:53:17 2025 >> started Mon Feb 10 22:53:34 2025 >> done (16.737s) 15373287 read pairs processed; of these: 49961 ( 0.32%) short read pairs filtered out after trimming by size control 39898 ( 0.26%) empty read pairs filtered out after trimming by size control 15283428 (99.42%) read pairs available; of these: 5485933 (35.89%) trimmed read pairs available after processing 9797495 (64.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 6 0.00% 21 5 0.00% 22 6 0.00% 23 6 0.00% 24 15 0.00% 25 16 0.00% 26 8 0.00% 27 11 0.00% 28 16 0.00% 29 11 0.00% 30 6 0.00% 31 11 0.00% 32 5 0.00% 33 12 0.00% 34 11 0.00% 35 12 0.00% 36 7 0.00% 37 11 0.00% 38 11 0.00% 39 12 0.00% 40 10 0.00% 41 12 0.00% 42 12 0.00% 43 14 0.00% 44 14 0.00% 45 16 0.00% 46 20 0.00% 47 27 0.00% 48 18 0.00% 49 28 0.00% 50 28 0.00% 51 40 0.00% 52 30 0.00% 53 37 0.00% 54 51 0.00% 55 41 0.00% 56 49 0.00% 57 51 0.00% 58 71 0.00% 59 83 0.00% 60 80 0.00% 61 104 0.00% 62 106 0.00% 63 114 0.00% 64 131 0.00% 65 163 0.00% 66 142 0.00% 67 191 0.00% 68 202 0.00% 69 264 0.00% 70 278 0.00% 71 300 0.00% 72 413 0.00% 73 485 0.00% 74 557 0.00% 75 597 0.00% 76 728 0.00% 77 799 0.01% 78 823 0.01% 79 969 0.01% 80 982 0.01% 81 1247 0.01% 82 1469 0.01% 83 1749 0.01% 84 4000 0.03% 85 5460 0.04% 86 5649 0.04% 87 6021 0.04% 88 6130 0.04% 89 6124 0.04% 90 6177 0.04% 91 6371 0.04% 92 6538 0.04% 93 6668 0.04% 94 6919 0.05% 95 7310 0.05% 96 7736 0.05% 97 7935 0.05% 98 8409 0.06% 99 8734 0.06% 100 9106 0.06% 101 9670 0.06% 102 10321 0.07% 103 10928 0.07% 104 11703 0.08% 105 12380 0.08% 106 12878 0.08% 107 13268 0.09% 108 14100 0.09% 109 14859 0.10% 110 15706 0.10% 111 16472 0.11% 112 17253 0.11% 113 17998 0.12% 114 19158 0.13% 115 19937 0.13% 116 20987 0.14% 117 22038 0.14% 118 22856 0.15% 119 24648 0.16% 120 26124 0.17% 121 26560 0.17% 122 26796 0.18% 123 27724 0.18% 124 29310 0.19% 125 30085 0.20% 126 31234 0.20% 127 32504 0.21% 128 33734 0.22% 129 35371 0.23% 130 36582 0.24% 131 38092 0.25% 132 39710 0.26% 133 42605 0.28% 134 44260 0.29% 135 46641 0.31% 136 48991 0.32% 137 52133 0.34% 138 54929 0.36% 139 57802 0.38% 140 62033 0.41% 141 66777 0.44% 142 72911 0.48% 143 81156 0.53% 144 92951 0.61% 145 107436 0.70% 146 129607 0.85% 147 170989 1.12% 148 253651 1.66% 149 481191 3.15% 150 2769849 18.12% 151 9797495 64.11% 15283428 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.74 fanout-score-rank=19 prefix-density=0.69 prefix-fanout=2.3 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=51.15 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=7.9 sequence=CAAGAACAAAGATCATGCCACCAAAGGCCCAAGCGATCCCTTGAATCCCAACCGTTGTACACTTAGTCTGGTCCTTAACCACACCCATCACAGTCAAAACGGTGATGTACAAAAACAAGAA criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=35 prefix-density=0.67 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=298.31 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=15.1 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7180144 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 22:54:16 Started mapping on | Feb 10 22:54:16 Finished on | Feb 10 22:55:49 Mapping speed, Million of reads per hour | 591.62 Number of input reads | 15283428 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14331530 Uniquely mapped reads % | 93.77% Average mapped length | 295.30 Number of splices: Total | 14176567 Number of splices: Annotated (sjdb) | 13885736 Number of splices: GT/AG | 13950469 Number of splices: GC/AG | 177419 Number of splices: AT/AC | 11067 Number of splices: Non-canonical | 37612 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354923 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 34451 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 641721 641721 641721 N_multimapping 354923 354923 354923 N_noFeature 376257 14192310 431348 N_ambiguous 154692 893 70025 UnstrandedReadsAssigned:13800581 PositiveStrandReadsAssigned:138327 NegativeStrandReadsAssigned:13830157 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180144 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180144-trimmed-pair1.fastq SRR7180144-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,283,428 reads, 13,720,132 reads pseudoaligned [quant] estimated average fragment length: 244.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR7180144.ke.tsv 34699 SRR7180144.se.tsv 87100 total ==> SRR7180144.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.6 1336 48.694 Potri.005G024800.1.v4.1 1035 791.603 510 41.6709 Potri.004G059700.1.v4.1 961 717.623 7 0.630916 Potri.007G009000.2.v4.1 1416 1172.6 0 0 Potri.003G141000.2.v4.1 2943 2699.6 657 15.7411 Potri.016G087400.1.v4.1 270 75.2711 1056.61 907.938 Potri.015G069301.1.v4.1 564 324.1 0 0 Potri.010G195200.1.v4.1 1773 1529.6 545 23.0456 Potri.012G127500.1.v4.1 977 733.613 5679 500.697 ==> SRR7180144.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 513 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 159 SRR7180144 completed mapping pipeline successfully