Starting /dee2/code/volunteer_pipeline.sh SRR7180145 current disk space = 3057581117440 free memory = 1578628480 SRR7180145 SRAfilesize 0b7c6afa4b1a95503e5ac69f98df73a5 SRR7180145.sra SRR7180145.sra file validated SRR7180145 is paired end SRR7180145 is conventional basespace SRR7180145 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180145_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.36225 33.0 33.0 34.0 30.0 34.0 2 32.703 33.0 33.0 34.0 31.0 34.0 3 32.36925 33.0 33.0 33.0 31.0 34.0 4 32.21125 33.0 33.0 33.0 31.0 34.0 5 32.9365 33.0 33.0 33.0 32.0 34.0 6 37.2595 38.0 37.0 38.0 36.0 38.0 7 37.609 38.0 38.0 38.0 37.0 38.0 8 37.66725 38.0 38.0 38.0 38.0 38.0 9 37.68225 38.0 38.0 38.0 38.0 38.0 10-14 37.72735 38.0 38.0 38.0 38.0 38.0 15-19 37.72474999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.70525 38.0 38.0 38.0 38.0 38.0 25-29 37.69785 38.0 38.0 38.0 38.0 38.0 30-34 37.65805 38.0 38.0 38.0 38.0 38.0 35-39 37.650600000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.62365 38.0 38.0 38.0 38.0 38.0 45-49 37.57195 38.0 38.0 38.0 38.0 38.0 50-54 37.527 38.0 38.0 38.0 38.0 38.0 55-59 37.4997 38.0 38.0 38.0 38.0 38.0 60-64 37.4621 38.0 38.0 38.0 38.0 38.0 65-69 37.42620000000001 38.0 38.0 38.0 37.6 38.0 70-74 37.37929999999999 38.0 38.0 38.0 37.2 38.0 75-79 37.33165 38.0 38.0 38.0 37.0 38.0 80-84 37.294850000000004 38.0 38.0 38.0 37.0 38.0 85-89 37.2441 38.0 38.0 38.0 37.0 38.0 90-94 37.2074 38.0 38.0 38.0 37.0 38.0 95-99 37.14895 38.0 38.0 38.0 36.6 38.0 100-104 37.0148 38.0 38.0 38.0 36.0 38.0 105-109 36.97365 38.0 38.0 38.0 36.0 38.0 110-114 36.87555 38.0 38.0 38.0 35.8 38.0 115-119 36.8066 38.0 38.0 38.0 35.4 38.0 120-124 36.735 38.0 38.0 38.0 35.0 38.0 125-129 36.607600000000005 38.0 38.0 38.0 34.6 38.0 130-134 36.3143 38.0 38.0 38.0 34.0 38.0 135-139 36.143600000000006 38.0 38.0 38.0 33.6 38.0 140-144 35.9388 38.0 38.0 38.0 33.0 38.0 145-149 35.766200000000005 38.0 37.6 38.0 33.0 38.0 150-151 33.285 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 3.0 10 0.0 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 3.0 18 2.0 19 0.0 20 0.0 21 1.0 22 4.0 23 7.0 24 3.0 25 4.0 26 8.0 27 10.0 28 17.0 29 21.0 30 19.0 31 24.0 32 35.0 33 53.0 34 80.0 35 156.0 36 360.0 37 3186.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.613222280062466 15.720978656949505 14.601769911504425 37.0640291514836 2 20.185092546273136 19.209604802401202 36.493246623311656 24.112056028014006 3 19.825 24.474999999999998 26.55 29.15 4 21.2 30.5 23.95 24.349999999999998 5 21.075 33.900000000000006 25.674999999999997 19.35 6 17.8 35.825 25.95 20.424999999999997 7 15.0 24.65 42.275 18.075 8 19.225 24.675 30.599999999999998 25.5 9 17.675 24.375 33.875 24.075 10-14 19.525000000000002 30.220000000000002 27.515 22.74 15-19 19.74 28.88 28.134999999999998 23.244999999999997 20-24 19.189999999999998 29.95 28.144999999999996 22.715 25-29 19.75 29.34 28.18 22.73 30-34 19.62 29.7 28.105000000000004 22.575 35-39 20.11 29.585 27.705000000000002 22.6 40-44 20.11 29.615000000000002 27.310000000000002 22.965 45-49 19.465 28.98 27.944999999999997 23.61 50-54 18.91 28.79 28.505000000000003 23.794999999999998 55-59 19.665 29.325000000000003 27.589999999999996 23.419999999999998 60-64 19.685 28.785 27.62 23.91 65-69 20.225 28.74 27.49 23.544999999999998 70-74 19.925 28.52 27.834999999999997 23.72 75-79 19.33 28.395 28.110000000000003 24.165 80-84 19.735 28.895 27.73 23.64 85-89 20.09 28.975 27.72 23.215 90-94 19.375 28.84 27.72 24.065 95-99 20.47 27.87 28.410000000000004 23.25 100-104 19.78 28.335 27.55 24.335 105-109 20.375 28.49 27.68 23.455000000000002 110-114 20.0 29.03 27.3 23.669999999999998 115-119 20.62 29.035 26.810000000000002 23.535 120-124 20.825 28.189999999999998 27.57 23.415 125-129 20.36 28.994999999999997 26.895000000000003 23.75 130-134 20.669999999999998 28.64 27.060000000000002 23.630000000000003 135-139 20.915 28.315 27.04 23.73 140-144 20.93 28.84 27.32 22.91 145-149 21.37 28.975 26.43 23.225 150-151 21.28112098085825 27.186288002001753 27.086200425372205 24.4463905917678 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 2.0 22 3.0 23 4.0 24 4.0 25 3.5 26 6.5 27 11.0 28 14.5 29 21.0 30 27.0 31 37.5 32 54.5 33 60.5 34 74.0 35 91.5 36 109.5 37 130.5 38 143.0 39 162.0 40 208.0 41 236.5 42 252.0 43 262.5 44 247.5 45 227.0 46 230.0 47 244.5 48 219.5 49 176.5 50 149.0 51 129.5 52 106.5 53 87.0 54 65.0 55 50.0 56 38.5 57 27.0 58 17.5 59 14.0 60 9.5 61 4.0 62 5.0 63 6.5 64 5.5 65 1.5 66 0.5 67 2.5 68 3.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.95 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.3875000000000002 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.725 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.2875 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACATT 10 0.006836113 144.9625 9 TCAACAT 10 0.006836113 144.9625 8 >>END_MODULE SRR7180145 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180145_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1065 34.0 33.0 34.0 33.0 34.0 2 33.22375 34.0 33.0 34.0 33.0 34.0 3 33.226 34.0 33.0 34.0 33.0 34.0 4 33.242 34.0 33.0 34.0 33.0 34.0 5 33.229 34.0 33.0 34.0 33.0 34.0 6 37.39525 38.0 38.0 38.0 38.0 38.0 7 37.3695 38.0 38.0 38.0 38.0 38.0 8 37.35 38.0 38.0 38.0 38.0 38.0 9 37.351 38.0 38.0 38.0 38.0 38.0 10-14 37.29935 38.0 38.0 38.0 38.0 38.0 15-19 37.27225 38.0 38.0 38.0 38.0 38.0 20-24 37.27415 38.0 38.0 38.0 38.0 38.0 25-29 37.23125 38.0 38.0 38.0 38.0 38.0 30-34 37.194700000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.0838 38.0 38.0 38.0 37.4 38.0 40-44 37.037600000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.1426 38.0 38.0 38.0 37.0 38.0 50-54 37.16275 38.0 38.0 38.0 37.0 38.0 55-59 37.15705 38.0 38.0 38.0 37.0 38.0 60-64 37.074749999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.024 38.0 38.0 38.0 37.0 38.0 70-74 36.9854 38.0 38.0 38.0 37.0 38.0 75-79 36.936949999999996 38.0 38.0 38.0 36.6 38.0 80-84 36.98215 38.0 38.0 38.0 36.6 38.0 85-89 36.8664 38.0 38.0 38.0 36.0 38.0 90-94 36.7874 38.0 38.0 38.0 36.0 38.0 95-99 36.66865 38.0 38.0 38.0 35.6 38.0 100-104 36.59345 38.0 38.0 38.0 35.2 38.0 105-109 36.397800000000004 38.0 38.0 38.0 34.4 38.0 110-114 36.376650000000005 38.0 38.0 38.0 34.4 38.0 115-119 36.29415 38.0 38.0 38.0 34.0 38.0 120-124 36.214099999999995 38.0 38.0 38.0 34.0 38.0 125-129 35.98775 38.0 38.0 38.0 33.8 38.0 130-134 35.770050000000005 38.0 37.4 38.0 33.2 38.0 135-139 35.43145 38.0 36.2 38.0 31.4 38.0 140-144 34.96375 38.0 36.0 38.0 29.6 38.0 145-149 34.52195 38.0 36.0 38.0 28.2 38.0 150-151 31.066625000000002 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 3.0 4 3.0 5 1.0 6 0.0 7 3.0 8 2.0 9 2.0 10 1.0 11 0.0 12 1.0 13 1.0 14 3.0 15 1.0 16 3.0 17 3.0 18 10.0 19 3.0 20 6.0 21 3.0 22 5.0 23 6.0 24 9.0 25 10.0 26 10.0 27 12.0 28 19.0 29 20.0 30 26.0 31 24.0 32 46.0 33 80.0 34 107.0 35 173.0 36 440.0 37 2952.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.8 14.424999999999999 20.674999999999997 29.099999999999998 2 24.5 22.3 37.05 16.150000000000002 3 22.35 26.1 31.6 19.950000000000003 4 25.025 33.125 23.25 18.6 5 24.025 35.199999999999996 23.3 17.474999999999998 6 19.6 36.7 25.275 18.425 7 19.2 17.1 42.725 20.974999999999998 8 21.375 23.35 28.199999999999996 27.075 9 21.85 25.724999999999998 29.65 22.775000000000002 10-14 24.143621543231486 28.149222383357504 25.78386758013702 21.92328849327399 15-19 23.154261704681872 28.26130452180872 27.70608243297319 20.878351340536213 20-24 22.550785549884917 28.705093565495847 27.684379065345745 21.05974181927349 25-29 23.538839084489407 28.101367255972352 27.430259928882656 20.92953373065558 30-34 23.268864615692955 28.239302535324178 27.773323980358754 20.71850886862411 35-39 23.190731731781934 28.291288429710615 27.839911730778876 20.678068107728574 40-44 23.485418862621092 28.47462731516338 27.832153792099586 20.207800030115948 45-49 23.373047657188625 27.928514217060474 28.243892671205444 20.454545454545457 50-54 23.421710855427712 28.094047023511752 27.538769384692348 20.945472736368185 55-59 23.541770885442723 28.08904452226113 27.878939469734863 20.490245122561284 60-64 23.02151075537769 27.923961980990498 28.339169584792394 20.715357678839418 65-69 23.84192096048024 28.064032016008007 27.57878939469735 20.515257628814407 70-74 23.50735073507351 28.657865786578657 27.86278627862786 19.971997199719972 75-79 23.347334733473346 27.77777777777778 27.767776777677767 21.107110711071105 80-84 23.15231523152315 28.12281228122812 27.95779577957796 20.767076707670768 85-89 23.756187809390468 27.976398819940997 27.94139706985349 20.32601630081504 90-94 23.515 27.889999999999997 27.92 20.674999999999997 95-99 23.674999999999997 27.83 28.310000000000002 20.185 100-104 23.919999999999998 27.875 27.79 20.415 105-109 24.08 27.810000000000002 28.025 20.085 110-114 23.87 27.815 28.044999999999998 20.27 115-119 23.849999999999998 28.194999999999997 27.925 20.03 120-124 24.245 27.689999999999998 28.1 19.965 125-129 24.005000000000003 27.92 28.475 19.6 130-134 24.59 27.694999999999997 28.21 19.505 135-139 24.154999999999998 28.765 27.99 19.09 140-144 25.080000000000002 27.92 27.605 19.395 145-149 25.295 27.800000000000004 27.735 19.17 150-151 25.10664993726474 27.31493099121706 27.841907151819324 19.73651191969887 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 1.5 23 0.5 24 0.5 25 2.0 26 5.5 27 8.0 28 10.0 29 9.0 30 13.0 31 22.0 32 23.5 33 31.0 34 47.5 35 66.0 36 89.0 37 103.5 38 121.5 39 162.5 40 205.5 41 232.0 42 263.0 43 278.0 44 280.5 45 280.5 46 263.0 47 241.5 48 233.5 49 198.0 50 159.0 51 153.5 52 131.5 53 97.0 54 65.0 55 46.5 56 35.0 57 29.5 58 23.5 59 15.5 60 12.0 61 8.0 62 4.5 63 4.5 64 4.5 65 2.5 66 2.5 67 4.0 68 2.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.04 20-24 0.06999999999999999 25-29 0.165 30-34 0.21 35-39 0.305 40-44 0.385 45-49 0.12 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.05 70-74 0.01 75-79 0.01 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.6045340050377833 1.2 3 0.07556675062972291 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.3875000000000002 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.725 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.2875 0.0 0.0 0.0 0.0 132-133 4.7625 0.0 0.0 0.0 0.0 134-135 5.35 0.0 0.0 0.0 0.0 136-137 6.025 0.0 0.0 0.0 0.0 138-139 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608324 spots for SRR7180145.sra Written 608324 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra Read 608320 spots for SRR7180145.sra Written 608320 spots for SRR7180145.sra SRR ids: ['SRR7180145.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aya7dkvh SRR7180145.sra spots: 12166404 blocks: [[1, 608320], [608321, 1216640], [1216641, 1824960], [1824961, 2433280], [2433281, 3041600], [3041601, 3649920], [3649921, 4258240], [4258241, 4866560], [4866561, 5474880], [5474881, 6083200], [6083201, 6691520], [6691521, 7299840], [7299841, 7908160], [7908161, 8516480], [8516481, 9124800], [9124801, 9733120], [9733121, 10341440], [10341441, 10949760], [10949761, 11558080], [11558081, 12166404]] SRR7180145 file size 4101094 SRR7180145 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180145 SRR7180145_1.fastq SRR7180145_2.fastq Input file: SRR7180145_1.fastq Paired file: SRR7180145_2.fastq trimmed: SRR7180145-trimmed-pair1.fastq, SRR7180145-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:36:45 2025 >> started Mon Feb 10 23:36:58 2025 >> done (13.483s) 12166404 read pairs processed; of these: 24567 ( 0.20%) short read pairs filtered out after trimming by size control 16453 ( 0.14%) empty read pairs filtered out after trimming by size control 12125384 (99.66%) read pairs available; of these: 4445280 (36.66%) trimmed read pairs available after processing 7680104 (63.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 3 0.00% 21 3 0.00% 22 8 0.00% 23 4 0.00% 24 7 0.00% 25 7 0.00% 26 6 0.00% 27 10 0.00% 28 14 0.00% 29 7 0.00% 30 3 0.00% 31 7 0.00% 32 5 0.00% 33 9 0.00% 34 9 0.00% 35 11 0.00% 36 16 0.00% 37 27 0.00% 38 13 0.00% 39 12 0.00% 40 6 0.00% 41 10 0.00% 42 12 0.00% 43 20 0.00% 44 28 0.00% 45 45 0.00% 46 31 0.00% 47 63 0.00% 48 27 0.00% 49 59 0.00% 50 21 0.00% 51 69 0.00% 52 61 0.00% 53 110 0.00% 54 66 0.00% 55 114 0.00% 56 129 0.00% 57 89 0.00% 58 68 0.00% 59 75 0.00% 60 78 0.00% 61 101 0.00% 62 131 0.00% 63 126 0.00% 64 109 0.00% 65 144 0.00% 66 172 0.00% 67 157 0.00% 68 222 0.00% 69 234 0.00% 70 285 0.00% 71 351 0.00% 72 374 0.00% 73 476 0.00% 74 482 0.00% 75 651 0.01% 76 785 0.01% 77 899 0.01% 78 959 0.01% 79 1000 0.01% 80 1112 0.01% 81 1336 0.01% 82 1538 0.01% 83 1744 0.01% 84 2724 0.02% 85 3609 0.03% 86 4126 0.03% 87 4785 0.04% 88 5079 0.04% 89 5450 0.04% 90 5589 0.05% 91 5684 0.05% 92 6180 0.05% 93 6332 0.05% 94 6769 0.06% 95 7105 0.06% 96 7321 0.06% 97 8039 0.07% 98 8604 0.07% 99 8820 0.07% 100 9559 0.08% 101 9938 0.08% 102 10336 0.09% 103 11375 0.09% 104 11957 0.10% 105 12625 0.10% 106 13718 0.11% 107 14419 0.12% 108 15344 0.13% 109 16065 0.13% 110 17009 0.14% 111 17604 0.15% 112 18495 0.15% 113 19553 0.16% 114 20941 0.17% 115 22047 0.18% 116 23202 0.19% 117 23781 0.20% 118 25078 0.21% 119 26507 0.22% 120 28253 0.23% 121 28571 0.24% 122 28455 0.23% 123 29678 0.24% 124 31015 0.26% 125 31152 0.26% 126 33000 0.27% 127 34535 0.28% 128 35325 0.29% 129 36923 0.30% 130 38416 0.32% 131 39489 0.33% 132 40585 0.33% 133 42516 0.35% 134 44002 0.36% 135 45436 0.37% 136 47138 0.39% 137 48838 0.40% 138 51508 0.42% 139 53450 0.44% 140 56682 0.47% 141 59912 0.49% 142 63415 0.52% 143 68188 0.56% 144 76127 0.63% 145 84418 0.70% 146 97198 0.80% 147 120742 1.00% 148 171181 1.41% 149 326605 2.69% 150 2102001 17.34% 151 7680104 63.34% 12125384 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=32 prefix-density=0.56 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCCACACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=81.38 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.6 sequence=CATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTA criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=26 prefix-density=0.72 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=41.76 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=5.4 sequence=AAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGGACTATCTCCCAGACCACAATGAAAGCATATCTGTTGTTCTTGACAGGTTTGCTTCCATGGGTATTGACACCCCTGGACTGGTTGCCTTGCTAGGAGCTCACAGTGTTGGGAGAACTCACTGTGTGAAGCTGGTGCACCGTTTGTACCCGGAAGTTGACCCAGCACTAAACCCTGACCATGTTGAGCACATGCTTTACAAGTGCCCTGATTCAATCCCAGACCCTAAAGCTGTCCAATATGTGAGGAATGACAGAGGCACACCCATGGTTCTAGACAACAACTACTACAGAAACATATTGG SRR7180145 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:37:45 Started mapping on | Feb 10 23:37:45 Finished on | Feb 10 23:39:31 Mapping speed, Million of reads per hour | 411.81 Number of input reads | 12125384 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11299767 Uniquely mapped reads % | 93.19% Average mapped length | 294.23 Number of splices: Total | 10219335 Number of splices: Annotated (sjdb) | 9984910 Number of splices: GT/AG | 10047321 Number of splices: GC/AG | 130580 Number of splices: AT/AC | 8983 Number of splices: Non-canonical | 32451 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269678 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 24742 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.34% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 575903 575903 575903 N_multimapping 269678 269678 269678 N_noFeature 357463 11175055 404112 N_ambiguous 130608 1047 51884 UnstrandedReadsAssigned:10811696 PositiveStrandReadsAssigned:123665 NegativeStrandReadsAssigned:10843771 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180145 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180145-trimmed-pair1.fastq SRR7180145-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,125,384 reads, 10,763,186 reads pseudoaligned [quant] estimated average fragment length: 226.443 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7180145.ke.tsv 34699 SRR7180145.se.tsv 87100 total ==> SRR7180145.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.56 783 32.7828 Potri.005G024800.1.v4.1 1035 809.557 203 18.8194 Potri.004G059700.1.v4.1 961 735.571 38 3.87719 Potri.007G009000.2.v4.1 1416 1190.56 0 0 Potri.003G141000.2.v4.1 2943 2717.56 366 10.1079 Potri.016G087400.1.v4.1 270 82.8664 999 904.783 Potri.015G069301.1.v4.1 564 341.189 0 0 Potri.010G195200.1.v4.1 1773 1547.56 255 12.3666 Potri.012G127500.1.v4.1 977 751.566 8433 842.117 ==> SRR7180145.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 180 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 594 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 241 SRR7180145 completed mapping pipeline successfully