Starting /dee2/code/volunteer_pipeline.sh SRR7180146 current disk space = 3057652924416 free memory = 1510629704 SRR7180146 SRAfilesize fe36a975ee57c0eee5d307d5be394868 SRR7180146.sra SRR7180146.sra file validated SRR7180146 is paired end SRR7180146 is conventional basespace SRR7180146 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180146_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.466 31.0 25.0 33.0 18.0 33.0 2 30.5535 31.0 29.0 33.0 27.0 33.0 3 31.71975 33.0 31.0 33.0 28.0 34.0 4 32.6015 33.0 33.0 33.0 32.0 34.0 5 32.84275 33.0 33.0 34.0 32.0 34.0 6 36.251 38.0 36.0 38.0 33.0 38.0 7 37.07025 38.0 37.0 38.0 35.0 38.0 8 37.175 38.0 38.0 38.0 36.0 38.0 9 37.3695 38.0 38.0 38.0 37.0 38.0 10-14 37.411449999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.4743 38.0 38.0 38.0 37.0 38.0 20-24 37.48369999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.450750000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.3956 38.0 38.0 38.0 37.0 38.0 35-39 37.36944999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.3134 38.0 38.0 38.0 37.0 38.0 45-49 37.27995 38.0 38.0 38.0 37.0 38.0 50-54 37.2349 38.0 38.0 38.0 36.8 38.0 55-59 37.24105 38.0 38.0 38.0 36.2 38.0 60-64 37.1777 38.0 38.0 38.0 36.0 38.0 65-69 37.05745 38.0 38.0 38.0 36.0 38.0 70-74 37.09705 38.0 38.0 38.0 36.0 38.0 75-79 36.9979 38.0 38.0 38.0 36.0 38.0 80-84 36.9009 38.0 38.0 38.0 35.6 38.0 85-89 36.87564999999999 38.0 38.0 38.0 35.4 38.0 90-94 36.785399999999996 38.0 38.0 38.0 35.2 38.0 95-99 36.682849999999995 38.0 38.0 38.0 34.8 38.0 100-104 36.588849999999994 38.0 38.0 38.0 34.2 38.0 105-109 36.5013 38.0 38.0 38.0 34.0 38.0 110-114 36.251850000000005 38.0 37.8 38.0 33.8 38.0 115-119 36.26465 38.0 37.8 38.0 33.8 38.0 120-124 36.0471 38.0 37.0 38.0 32.8 38.0 125-129 35.909000000000006 38.0 37.0 38.0 32.6 38.0 130-134 35.624649999999995 38.0 36.0 38.0 31.2 38.0 135-139 35.342949999999995 38.0 36.0 38.0 30.2 38.0 140-144 35.0608 38.0 35.8 38.0 29.6 38.0 145-149 34.549 38.0 35.2 38.0 27.8 38.0 150-151 31.627125 36.5 32.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 0.0 16 1.0 17 3.0 18 3.0 19 1.0 20 2.0 21 4.0 22 4.0 23 4.0 24 6.0 25 11.0 26 19.0 27 15.0 28 29.0 29 33.0 30 34.0 31 44.0 32 69.0 33 100.0 34 142.0 35 255.0 36 632.0 37 2586.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.71665773968934 14.113551151580076 13.095875736475628 36.07391537225496 2 20.05 20.1 38.15 21.7 3 18.875 26.625 27.950000000000003 26.55 4 21.525 33.875 23.05 21.55 5 20.65 36.199999999999996 23.974999999999998 19.175 6 17.0 36.175000000000004 25.0 21.825 7 14.424999999999999 21.525 43.075 20.974999999999998 8 18.2 22.625 29.7 29.475 9 18.525 21.975 33.725 25.775 10-14 20.04 28.910000000000004 26.32 24.73 15-19 19.625 28.720000000000002 27.58 24.075 20-24 19.98 28.194999999999997 28.410000000000004 23.415 25-29 19.400000000000002 28.994999999999997 27.52 24.085 30-34 19.86 27.965 27.905 24.27 35-39 19.900000000000002 28.785 27.839999999999996 23.474999999999998 40-44 20.345 28.360000000000003 27.54 23.755000000000003 45-49 20.095 29.060000000000002 26.855 23.990000000000002 50-54 20.18 28.360000000000003 27.994999999999997 23.465 55-59 19.935 28.33 27.74 23.995 60-64 19.78 28.125 28.055000000000003 24.04 65-69 20.29 28.63 27.435 23.645 70-74 20.51 28.27 27.505000000000003 23.715 75-79 20.16 28.475 27.595 23.77 80-84 20.11 27.900000000000002 27.97 24.02 85-89 20.599999999999998 28.294999999999998 27.334999999999997 23.77 90-94 20.195 28.560000000000002 27.345000000000002 23.9 95-99 20.24 28.32 27.99 23.45 100-104 20.125 28.285 27.305 24.285 105-109 20.285 27.73 28.294999999999998 23.69 110-114 20.825 28.565 27.365000000000002 23.244999999999997 115-119 20.66 27.994999999999997 27.400000000000002 23.945 120-124 20.185 28.144999999999996 27.21 24.46 125-129 20.349999999999998 28.27 27.32 24.060000000000002 130-134 20.825 28.084999999999997 27.465 23.625 135-139 20.89 27.625 27.49 23.995 140-144 20.865000000000002 27.845 27.400000000000002 23.89 145-149 20.7 28.345 27.295 23.66 150-151 20.3125 28.4 26.987499999999997 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 3.0 23 2.0 24 1.5 25 2.5 26 5.0 27 8.0 28 10.0 29 10.5 30 13.5 31 22.0 32 27.5 33 34.5 34 47.5 35 66.0 36 86.5 37 119.0 38 138.5 39 156.0 40 194.5 41 218.0 42 237.5 43 265.0 44 281.5 45 280.0 46 285.0 47 277.0 48 230.5 49 200.5 50 175.5 51 142.0 52 116.5 53 89.5 54 70.5 55 54.5 56 38.5 57 24.5 58 15.0 59 12.5 60 10.0 61 7.0 62 7.0 63 3.0 64 1.0 65 2.0 66 2.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.42500000000000004 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.9125000000000001 0.0 0.0 0.0 0.0 130-131 0.9874999999999999 0.0 0.0 0.0 0.0 132-133 1.1625 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.3375 0.0 0.0 0.0 0.0 138-139 1.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAACG 10 0.0068396386 144.9375 5 ATTCTAG 10 0.0068396386 144.9375 5 >>END_MODULE SRR7180146 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180146_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56525 33.0 33.0 34.0 32.0 34.0 2 32.82125 33.0 33.0 34.0 32.0 34.0 3 32.82775 33.0 33.0 34.0 32.0 34.0 4 32.67625 33.0 33.0 34.0 32.0 34.0 5 32.65475 33.0 33.0 34.0 32.0 34.0 6 36.94575 38.0 38.0 38.0 36.0 38.0 7 36.99825 38.0 38.0 38.0 36.0 38.0 8 36.93325 38.0 38.0 38.0 36.0 38.0 9 36.9135 38.0 38.0 38.0 36.0 38.0 10-14 37.00145 38.0 38.0 38.0 36.0 38.0 15-19 36.89675 38.0 38.0 38.0 36.0 38.0 20-24 36.8964 38.0 38.0 38.0 36.0 38.0 25-29 36.86905 38.0 38.0 38.0 36.0 38.0 30-34 36.87415 38.0 38.0 38.0 36.0 38.0 35-39 36.7842 38.0 38.0 38.0 36.0 38.0 40-44 36.736599999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.76475000000001 38.0 38.0 38.0 35.6 38.0 50-54 36.79005 38.0 38.0 38.0 35.8 38.0 55-59 36.68745 38.0 38.0 38.0 35.2 38.0 60-64 36.55544999999999 38.0 38.0 38.0 34.6 38.0 65-69 36.637150000000005 38.0 38.0 38.0 35.0 38.0 70-74 36.58595 38.0 38.0 38.0 34.6 38.0 75-79 36.47675 38.0 38.0 38.0 34.2 38.0 80-84 36.34140000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.20125 38.0 38.0 38.0 33.2 38.0 90-94 36.115050000000004 38.0 37.4 38.0 33.2 38.0 95-99 36.0173 38.0 37.2 38.0 33.0 38.0 100-104 35.849599999999995 38.0 37.0 38.0 32.6 38.0 105-109 35.727650000000004 38.0 37.0 38.0 31.6 38.0 110-114 35.6274 38.0 37.0 38.0 31.0 38.0 115-119 35.470850000000006 38.0 36.6 38.0 30.4 38.0 120-124 35.29675 38.0 36.0 38.0 29.6 38.0 125-129 34.9107 38.0 35.6 38.0 28.0 38.0 130-134 34.51514999999999 38.0 35.0 38.0 26.0 38.0 135-139 34.3359 38.0 35.0 38.0 25.4 38.0 140-144 33.8793 38.0 34.8 38.0 22.6 38.0 145-149 33.3337 38.0 34.2 38.0 17.2 38.0 150-151 29.701500000000003 36.0 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 4.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 3.0 13 4.0 14 2.0 15 3.0 16 0.0 17 2.0 18 9.0 19 5.0 20 6.0 21 6.0 22 5.0 23 19.0 24 12.0 25 17.0 26 27.0 27 31.0 28 44.0 29 38.0 30 47.0 31 73.0 32 85.0 33 97.0 34 174.0 35 294.0 36 741.0 37 2239.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.81890945472736 16.05802901450725 16.758379189594798 29.364682341170585 2 25.162581290645324 21.885942971485743 34.19209604802401 18.75937968984492 3 20.10502625656414 26.78169542385596 31.782945736434108 21.330332583145786 4 24.5 34.5 21.325 19.675 5 23.6368184092046 37.24362181090545 21.085542771385693 18.034017008504254 6 19.15957978989495 37.543771885942974 23.1615807903952 20.135067533766886 7 18.084042021010504 16.23311655827914 43.44672336168084 22.236118059029515 8 21.05526381595399 23.53088272068017 27.806951737934483 27.60690172543136 9 21.48574287143572 24.437218609304654 28.4392196098049 25.63781890945473 10-14 22.463369505425813 28.789318397759665 25.518827824173623 23.228484272640895 15-19 22.712949532336317 28.104836692842493 27.53963887360576 21.642574901215426 20-24 23.391578631152054 28.493466179342114 27.17668852951485 20.938266659990987 25-29 22.565772989225756 28.088198446504638 27.466800300676525 21.879228263593085 30-34 22.88637047437569 27.670243706749574 28.176712466151844 21.266673352722893 35-39 22.54665863937387 27.914910696367652 27.934978928356415 21.60345173590207 40-44 22.579512390889935 27.515802147085385 28.17798735828233 21.72669810374235 45-49 22.8396915990788 27.876239110844097 27.44067287473716 21.843396415339942 50-54 23.785703566604973 28.39777900055025 26.992146465909663 20.82437096693512 55-59 23.189637927585515 27.89057811562313 27.575515103020603 21.344268853770753 60-64 23.695923980995246 28.00200050012503 27.371842960740185 20.930232558139537 65-69 23.187318731873187 28.69286928692869 27.247724772477248 20.87208720872087 70-74 23.826191309565477 28.036401820091005 27.521376068803438 20.616030801540077 75-79 23.496174808740435 28.136406820341016 27.1963598179909 21.171058552927647 80-84 23.582358235823584 28.302830283028303 27.482748274827486 20.632063206320634 85-89 24.441222061103055 27.876393819690986 27.371368568428423 20.31101555077754 90-94 23.735 27.555000000000003 27.33 21.38 95-99 23.369999999999997 28.005000000000003 27.589999999999996 21.035 100-104 23.544999999999998 27.965 27.575 20.915 105-109 23.275000000000002 28.155 27.560000000000002 21.01 110-114 23.345 27.955000000000002 28.28 20.419999999999998 115-119 23.5 27.63 27.975 20.895 120-124 24.215 27.765 27.884999999999998 20.135 125-129 23.544999999999998 28.1 27.615000000000002 20.74 130-134 23.395 27.589999999999996 28.005000000000003 21.01 135-139 23.94 27.665 27.685 20.71 140-144 23.905 27.515 27.675 20.905 145-149 23.935000000000002 27.884999999999998 27.855 20.325 150-151 23.830957739434858 27.981995498874717 27.91947986996749 20.26756689172293 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 3.5 25 3.5 26 1.5 27 2.0 28 3.5 29 6.0 30 7.5 31 10.0 32 15.5 33 22.5 34 30.0 35 46.5 36 70.0 37 94.0 38 118.0 39 144.0 40 187.0 41 228.5 42 252.5 43 280.5 44 298.5 45 302.0 46 304.0 47 276.5 48 231.0 49 212.0 50 201.0 51 157.0 52 128.0 53 106.5 54 73.0 55 54.5 56 42.5 57 29.0 58 15.5 59 12.0 60 9.0 61 5.5 62 4.0 63 3.5 64 1.0 65 0.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.025 4 0.0 5 0.05 6 0.05 7 0.05 8 0.025 9 0.05 10-14 0.015 15-19 0.034999999999999996 20-24 0.135 25-29 0.22499999999999998 30-34 0.29 35-39 0.33999999999999997 40-44 0.33 45-49 0.13 50-54 0.045 55-59 0.02 60-64 0.025 65-69 0.01 70-74 0.005 75-79 0.005 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.0625 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.8 0.0 0.0 0.0 0.0 126-127 0.8374999999999999 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.3 0.0 0.0 0.0 0.0 136-137 1.3625 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137385 spots for SRR7180146.sra Written 1137385 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra Read 1137374 spots for SRR7180146.sra Written 1137374 spots for SRR7180146.sra SRR ids: ['SRR7180146.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rsqghv3h SRR7180146.sra spots: 22747491 blocks: [[1, 1137374], [1137375, 2274748], [2274749, 3412122], [3412123, 4549496], [4549497, 5686870], [5686871, 6824244], [6824245, 7961618], [7961619, 9098992], [9098993, 10236366], [10236367, 11373740], [11373741, 12511114], [12511115, 13648488], [13648489, 14785862], [14785863, 15923236], [15923237, 17060610], [17060611, 18197984], [18197985, 19335358], [19335359, 20472732], [20472733, 21610106], [21610107, 22747491]] SRR7180146 file size 7686677 SRR7180146 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180146 SRR7180146_1.fastq SRR7180146_2.fastq Input file: SRR7180146_1.fastq Paired file: SRR7180146_2.fastq trimmed: SRR7180146-trimmed-pair1.fastq, SRR7180146-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:28:48 2025 >> started Mon Feb 10 23:29:11 2025 >> done (22.500s) 22747491 read pairs processed; of these: 27170 ( 0.12%) short read pairs filtered out after trimming by size control 40242 ( 0.18%) empty read pairs filtered out after trimming by size control 22680079 (99.70%) read pairs available; of these: 8339256 (36.77%) trimmed read pairs available after processing 14340823 (63.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 3 0.00% 23 4 0.00% 24 7 0.00% 25 9 0.00% 26 8 0.00% 27 4 0.00% 28 9 0.00% 29 8 0.00% 30 2 0.00% 31 7 0.00% 32 6 0.00% 33 5 0.00% 34 7 0.00% 35 9 0.00% 36 18 0.00% 37 21 0.00% 38 11 0.00% 39 12 0.00% 40 41 0.00% 41 45 0.00% 42 7 0.00% 43 5 0.00% 44 50 0.00% 45 89 0.00% 46 79 0.00% 47 29 0.00% 48 40 0.00% 49 108 0.00% 50 175 0.00% 51 96 0.00% 52 76 0.00% 53 56 0.00% 54 107 0.00% 55 189 0.00% 56 51 0.00% 57 42 0.00% 58 84 0.00% 59 257 0.00% 60 117 0.00% 61 79 0.00% 62 82 0.00% 63 97 0.00% 64 119 0.00% 65 98 0.00% 66 141 0.00% 67 164 0.00% 68 165 0.00% 69 225 0.00% 70 223 0.00% 71 248 0.00% 72 288 0.00% 73 272 0.00% 74 354 0.00% 75 388 0.00% 76 415 0.00% 77 675 0.00% 78 723 0.00% 79 576 0.00% 80 620 0.00% 81 787 0.00% 82 908 0.00% 83 1064 0.00% 84 2159 0.01% 85 3020 0.01% 86 3185 0.01% 87 3450 0.02% 88 3569 0.02% 89 3517 0.02% 90 3638 0.02% 91 3898 0.02% 92 3890 0.02% 93 4036 0.02% 94 4248 0.02% 95 4466 0.02% 96 4834 0.02% 97 4983 0.02% 98 5202 0.02% 99 5553 0.02% 100 5829 0.03% 101 6011 0.03% 102 6493 0.03% 103 7072 0.03% 104 7403 0.03% 105 7843 0.03% 106 8369 0.04% 107 9013 0.04% 108 9644 0.04% 109 9920 0.04% 110 10548 0.05% 111 11339 0.05% 112 12018 0.05% 113 12706 0.06% 114 13364 0.06% 115 14224 0.06% 116 15097 0.07% 117 15793 0.07% 118 17281 0.08% 119 18635 0.08% 120 19100 0.08% 121 21289 0.09% 122 21832 0.10% 123 21774 0.10% 124 22777 0.10% 125 23954 0.11% 126 25617 0.11% 127 27008 0.12% 128 28732 0.13% 129 30484 0.13% 130 32678 0.14% 131 34767 0.15% 132 37841 0.17% 133 40802 0.18% 134 44175 0.19% 135 47010 0.21% 136 50790 0.22% 137 55329 0.24% 138 61451 0.27% 139 66372 0.29% 140 73188 0.32% 141 82265 0.36% 142 93851 0.41% 143 107806 0.48% 144 128994 0.57% 145 157430 0.69% 146 203158 0.90% 147 279047 1.23% 148 440290 1.94% 149 890847 3.93% 150 4875732 21.50% 151 14340823 63.23% 22680079 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=32 prefix-density=0.33 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=53.61 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=13.9 sequence=TTCTCATCAAGGT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=23 prefix-density=0.45 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=21.36 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=8.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7180146 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:29:52 Started mapping on | Feb 10 23:29:53 Finished on | Feb 10 23:32:12 Mapping speed, Million of reads per hour | 587.40 Number of input reads | 22680079 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21215215 Uniquely mapped reads % | 93.54% Average mapped length | 297.66 Number of splices: Total | 22175681 Number of splices: Annotated (sjdb) | 21840048 Number of splices: GT/AG | 21832469 Number of splices: GC/AG | 279488 Number of splices: AT/AC | 15366 Number of splices: Non-canonical | 48358 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 578105 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 47901 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.65% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 911160 911160 911160 N_multimapping 578105 578105 578105 N_noFeature 392682 21048760 454950 N_ambiguous 207233 1316 102169 UnstrandedReadsAssigned:20615300 PositiveStrandReadsAssigned:165139 NegativeStrandReadsAssigned:20658096 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7180146 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180146-trimmed-pair1.fastq SRR7180146-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,680,079 reads, 20,419,458 reads pseudoaligned [quant] estimated average fragment length: 284.311 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7180146.ke.tsv 34699 SRR7180146.se.tsv 87100 total ==> SRR7180146.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.69 1625 42.609 Potri.005G024800.1.v4.1 1035 751.689 344 20.8156 Potri.004G059700.1.v4.1 961 677.716 93 6.24172 Potri.007G009000.2.v4.1 1416 1132.69 0 0 Potri.003G141000.2.v4.1 2943 2659.69 877.163 15.001 Potri.016G087400.1.v4.1 270 61.5693 1778.2 1313.66 Potri.015G069301.1.v4.1 564 288.204 0 0 Potri.010G195200.1.v4.1 1773 1489.69 545 16.6406 Potri.012G127500.1.v4.1 977 693.706 4184 274.338 ==> SRR7180146.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 577 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 397 SRR7180146 completed mapping pipeline successfully