Starting /dee2/code/volunteer_pipeline.sh SRR7180147 current disk space = 3057553072128 free memory = 1267953276 SRR7180147 SRAfilesize a88aad12041f81eadde85be7dfaea6c7 SRR7180147.sra SRR7180147.sra file validated SRR7180147 is paired end SRR7180147 is conventional basespace SRR7180147 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180147_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.29325 33.0 30.0 33.0 18.0 34.0 2 32.198 33.0 33.0 33.0 28.0 34.0 3 31.62825 33.0 32.0 33.0 27.0 33.0 4 32.37525 33.0 33.0 33.0 31.0 34.0 5 32.914 33.0 33.0 34.0 32.0 34.0 6 36.53575 38.0 37.0 38.0 34.0 38.0 7 37.26475 38.0 38.0 38.0 36.0 38.0 8 37.483 38.0 38.0 38.0 37.0 38.0 9 37.60125 38.0 38.0 38.0 37.0 38.0 10-14 37.576750000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.5811 38.0 38.0 38.0 38.0 38.0 20-24 37.601699999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.5793 38.0 38.0 38.0 38.0 38.0 30-34 37.5824 38.0 38.0 38.0 38.0 38.0 35-39 37.5048 38.0 38.0 38.0 37.8 38.0 40-44 37.49835 38.0 38.0 38.0 38.0 38.0 45-49 37.4831 38.0 38.0 38.0 37.2 38.0 50-54 37.444 38.0 38.0 38.0 37.2 38.0 55-59 37.33915 38.0 38.0 38.0 37.0 38.0 60-64 37.27839999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.273250000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.24249999999999 38.0 38.0 38.0 36.8 38.0 75-79 37.229549999999996 38.0 38.0 38.0 36.6 38.0 80-84 37.13965 38.0 38.0 38.0 36.2 38.0 85-89 37.076049999999995 38.0 38.0 38.0 36.0 38.0 90-94 37.02075000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.96685000000001 38.0 38.0 38.0 35.8 38.0 100-104 36.77419999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.736450000000005 38.0 38.0 38.0 35.0 38.0 110-114 36.583 38.0 38.0 38.0 34.4 38.0 115-119 36.534749999999995 38.0 38.0 38.0 34.2 38.0 120-124 36.40955 38.0 38.0 38.0 34.0 38.0 125-129 36.1266 38.0 37.6 38.0 33.6 38.0 130-134 35.93705 38.0 37.4 38.0 33.0 38.0 135-139 35.78490000000001 38.0 36.6 38.0 32.6 38.0 140-144 35.64975 38.0 36.0 38.0 32.8 38.0 145-149 35.189949999999996 38.0 36.0 38.0 31.0 38.0 150-151 32.14975 36.5 32.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 0.0 18 4.0 19 0.0 20 1.0 21 0.0 22 3.0 23 6.0 24 6.0 25 8.0 26 11.0 27 10.0 28 15.0 29 27.0 30 26.0 31 36.0 32 60.0 33 79.0 34 109.0 35 189.0 36 549.0 37 2854.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.868686868686865 13.689526847421584 13.290802764486976 36.15098351940457 2 21.5 19.650000000000002 37.8 21.05 3 18.625 27.224999999999998 27.525 26.625 4 21.675 34.65 22.275 21.4 5 21.15 34.949999999999996 24.8 19.1 6 16.975 34.65 27.150000000000002 21.224999999999998 7 14.45 21.525 44.0 20.025000000000002 8 17.224999999999998 21.55 31.825 29.4 9 17.7 22.3 32.75 27.250000000000004 10-14 20.195 28.384999999999998 27.175 24.245 15-19 19.41 28.12 28.225 24.245 20-24 19.74 28.335 28.32 23.605 25-29 19.67 28.27 28.110000000000003 23.95 30-34 18.935 29.265 27.425 24.375 35-39 19.28 28.59 28.4 23.73 40-44 19.805 28.325 28.08 23.79 45-49 19.675 28.595 28.345 23.385 50-54 19.98 28.645 27.92 23.455000000000002 55-59 19.82 28.360000000000003 28.34 23.48 60-64 20.244999999999997 27.860000000000003 27.79 24.104999999999997 65-69 20.080000000000002 28.384999999999998 27.74 23.794999999999998 70-74 19.495 28.315 28.325 23.865 75-79 20.47 27.76 27.99 23.78 80-84 19.925 27.76 28.76 23.555 85-89 19.81 28.49 28.060000000000002 23.64 90-94 20.474999999999998 27.994999999999997 27.905 23.625 95-99 20.330000000000002 27.32 28.53 23.82 100-104 20.380000000000003 27.91 28.060000000000002 23.65 105-109 20.335 28.525 28.005000000000003 23.135 110-114 20.27 28.065 28.384999999999998 23.28 115-119 20.5 28.310000000000002 28.09 23.1 120-124 20.61 27.76 27.584999999999997 24.044999999999998 125-129 21.005 28.305000000000003 27.55 23.14 130-134 20.815 27.589999999999996 27.625 23.97 135-139 21.310000000000002 27.839999999999996 27.169999999999998 23.68 140-144 20.97 28.09 27.284999999999997 23.655 145-149 21.584999999999997 28.299999999999997 26.665 23.45 150-151 20.375 27.925 27.6875 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.0 23 0.5 24 1.0 25 3.0 26 3.5 27 5.5 28 12.5 29 12.5 30 12.0 31 15.0 32 24.5 33 33.5 34 45.5 35 69.0 36 85.5 37 112.5 38 142.5 39 164.0 40 195.0 41 234.5 42 275.0 43 294.0 44 301.0 45 294.0 46 282.0 47 270.5 48 229.5 49 192.5 50 163.0 51 135.0 52 115.5 53 77.5 54 47.5 55 40.5 56 27.5 57 17.5 58 15.5 59 13.5 60 10.5 61 5.0 62 3.0 63 3.0 64 2.0 65 2.0 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.949999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.3624999999999998 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.8625 0.0 0.0 0.0 0.0 126-127 4.2 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.125 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.0375 0.0 0.0 0.0 0.0 136-137 6.487500000000001 0.0 0.0 0.0 0.0 138-139 7.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCCAA 10 0.006843168 144.91249 5 ACATTAA 10 0.006843168 144.91249 4 >>END_MODULE SRR7180147 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180147_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9875 33.0 33.0 34.0 32.0 34.0 2 33.05325 34.0 33.0 34.0 32.0 34.0 3 33.18225 34.0 33.0 34.0 33.0 34.0 4 33.10925 34.0 33.0 34.0 33.0 34.0 5 33.0515 34.0 33.0 34.0 33.0 34.0 6 37.31525 38.0 38.0 38.0 37.0 38.0 7 37.24725 38.0 38.0 38.0 37.0 38.0 8 37.1915 38.0 38.0 38.0 37.0 38.0 9 37.249 38.0 38.0 38.0 37.0 38.0 10-14 37.32775 38.0 38.0 38.0 37.2 38.0 15-19 37.2743 38.0 38.0 38.0 37.0 38.0 20-24 37.27075 38.0 38.0 38.0 37.0 38.0 25-29 37.1533 38.0 38.0 38.0 37.0 38.0 30-34 37.1205 38.0 38.0 38.0 37.0 38.0 35-39 37.080200000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.06585 38.0 38.0 38.0 37.0 38.0 45-49 37.157799999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.13005 38.0 38.0 38.0 36.8 38.0 55-59 37.11155 38.0 38.0 38.0 37.0 38.0 60-64 37.0613 38.0 38.0 38.0 36.4 38.0 65-69 36.98285 38.0 38.0 38.0 36.2 38.0 70-74 36.96005 38.0 38.0 38.0 36.0 38.0 75-79 36.95720000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.90545 38.0 38.0 38.0 36.0 38.0 85-89 36.80105 38.0 38.0 38.0 35.6 38.0 90-94 36.75940000000001 38.0 38.0 38.0 35.8 38.0 95-99 36.680350000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.56609999999999 38.0 38.0 38.0 34.8 38.0 105-109 36.36105 38.0 38.0 38.0 34.2 38.0 110-114 36.3688 38.0 38.0 38.0 34.0 38.0 115-119 36.26375 38.0 38.0 38.0 34.0 38.0 120-124 36.0736 38.0 37.8 38.0 33.6 38.0 125-129 35.859 38.0 37.0 38.0 33.0 38.0 130-134 35.50625 38.0 36.2 38.0 31.4 38.0 135-139 35.29045 38.0 36.0 38.0 30.6 38.0 140-144 35.148649999999996 38.0 36.0 38.0 31.0 38.0 145-149 34.53295 38.0 35.4 38.0 27.4 38.0 150-151 31.3 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 0.0 5 4.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 3.0 12 2.0 13 1.0 14 3.0 15 1.0 16 1.0 17 4.0 18 6.0 19 3.0 20 2.0 21 5.0 22 7.0 23 6.0 24 7.0 25 7.0 26 11.0 27 19.0 28 23.0 29 24.0 30 38.0 31 45.0 32 59.0 33 78.0 34 107.0 35 226.0 36 481.0 37 2817.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.1 16.1 18.575 28.225 2 24.375 22.95 34.599999999999994 18.075 3 21.725 25.900000000000002 32.15 20.225 4 23.35 33.95 22.25 20.45 5 24.275 35.975 22.375 17.375 6 18.45 37.6 23.674999999999997 20.275000000000002 7 19.125 17.175 42.699999999999996 21.0 8 20.7 24.224999999999998 26.775 28.299999999999997 9 22.3 25.924999999999997 28.95 22.825 10-14 23.765 28.27 25.945 22.02 15-19 22.706135306765336 28.31641582079104 27.75638781939097 21.221061053052654 20-24 23.050372667700465 28.908008603871743 27.20724325946676 20.834375468961035 25-29 22.425274120062085 28.548540529715115 27.787513142742704 21.238672207480096 30-34 22.609262229350442 28.708901363271856 27.51102646351243 21.170809943865276 35-39 23.09120096317849 28.6344938296378 27.325173071134746 20.949132136048963 40-44 22.757133543954666 28.709693596108522 27.50112832856928 21.032044531367532 45-49 23.336002402161945 28.355519967971176 27.384646181563404 20.923831448303474 50-54 23.236971091327398 28.723617085125536 27.348204461338398 20.691207362208665 55-59 23.137313731373137 27.92279227922792 28.027802780278027 20.912091209120913 60-64 22.86114305715286 28.056402820141006 28.271413570678533 20.811040552027603 65-69 23.58617930896545 28.126406320316015 27.43637181859093 20.85104255212761 70-74 23.785 28.634999999999998 27.189999999999998 20.39 75-79 23.49 28.660000000000004 27.529999999999998 20.32 80-84 24.195 28.194999999999997 27.615000000000002 19.994999999999997 85-89 23.68618430921546 28.291414570728534 27.951397569878495 20.07100355017751 90-94 23.494999999999997 28.38 27.655 20.47 95-99 23.16 28.439999999999998 27.515 20.885 100-104 23.905 28.744999999999997 26.900000000000002 20.45 105-109 23.51 28.585 28.105000000000004 19.8 110-114 24.060000000000002 27.615000000000002 27.505000000000003 20.82 115-119 23.995 28.144999999999996 27.765 20.095 120-124 23.785 28.24 27.99 19.985 125-129 24.11 28.645 26.950000000000003 20.294999999999998 130-134 24.490000000000002 28.155 27.41 19.945 135-139 24.43 28.325 27.46 19.785 140-144 24.815 28.62 26.775 19.79 145-149 24.735 28.51 27.21 19.545 150-151 25.568892223055762 29.044761190297574 26.806701675418854 18.579644911227806 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 2.0 28 3.5 29 5.0 30 6.5 31 10.5 32 16.0 33 24.0 34 45.0 35 60.0 36 81.0 37 110.5 38 123.0 39 156.5 40 189.5 41 230.5 42 292.5 43 315.5 44 300.5 45 303.0 46 299.5 47 262.5 48 237.0 49 206.5 50 163.5 51 137.5 52 116.0 53 87.0 54 63.0 55 45.0 56 29.0 57 21.0 58 16.5 59 9.5 60 6.0 61 6.0 62 5.0 63 3.5 64 2.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.045 25-29 0.135 30-34 0.24 35-39 0.33 40-44 0.295 45-49 0.09 50-54 0.03 55-59 0.01 60-64 0.005 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77415307402761 99.4 2 0.20075282308657463 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02509410288582183 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.0875 0.0 0.0 0.0 0.0 122-123 3.4125 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.225 0.0 0.0 0.0 0.0 128-129 4.675000000000001 0.0 0.0 0.0 0.0 130-131 5.125 0.0 0.0 0.0 0.0 132-133 5.6 0.0 0.0 0.0 0.0 134-135 6.0625 0.0 0.0 0.0 0.0 136-137 6.5 0.0 0.0 0.0 0.0 138-139 7.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGAA 10 0.006830828 145.0 145 >>END_MODULE Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966072 spots for SRR7180147.sra Written 966072 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra Read 966063 spots for SRR7180147.sra Written 966063 spots for SRR7180147.sra SRR ids: ['SRR7180147.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5uamflux SRR7180147.sra spots: 19321269 blocks: [[1, 966063], [966064, 1932126], [1932127, 2898189], [2898190, 3864252], [3864253, 4830315], [4830316, 5796378], [5796379, 6762441], [6762442, 7728504], [7728505, 8694567], [8694568, 9660630], [9660631, 10626693], [10626694, 11592756], [11592757, 12558819], [12558820, 13524882], [13524883, 14490945], [14490946, 15457008], [15457009, 16423071], [16423072, 17389134], [17389135, 18355197], [18355198, 19321269]] SRR7180147 file size 6525643 SRR7180147 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180147 SRR7180147_1.fastq SRR7180147_2.fastq Input file: SRR7180147_1.fastq Paired file: SRR7180147_2.fastq trimmed: SRR7180147-trimmed-pair1.fastq, SRR7180147-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:07:53 2025 >> started Mon Feb 10 23:08:16 2025 >> done (22.969s) 19321269 read pairs processed; of these: 20595 ( 0.11%) short read pairs filtered out after trimming by size control 15328 ( 0.08%) empty read pairs filtered out after trimming by size control 19285346 (99.81%) read pairs available; of these: 7079473 (36.71%) trimmed read pairs available after processing 12205873 (63.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 4 0.00% 22 4 0.00% 23 1 0.00% 24 2 0.00% 25 8 0.00% 26 4 0.00% 27 8 0.00% 28 1 0.00% 29 4 0.00% 30 5 0.00% 31 4 0.00% 32 3 0.00% 33 5 0.00% 34 5 0.00% 35 8 0.00% 36 8 0.00% 37 4 0.00% 38 3 0.00% 39 10 0.00% 40 5 0.00% 41 11 0.00% 42 6 0.00% 43 4 0.00% 44 2 0.00% 45 12 0.00% 46 19 0.00% 47 18 0.00% 48 17 0.00% 49 24 0.00% 50 21 0.00% 51 24 0.00% 52 33 0.00% 53 32 0.00% 54 49 0.00% 55 37 0.00% 56 46 0.00% 57 50 0.00% 58 75 0.00% 59 81 0.00% 60 98 0.00% 61 97 0.00% 62 94 0.00% 63 137 0.00% 64 156 0.00% 65 175 0.00% 66 169 0.00% 67 240 0.00% 68 273 0.00% 69 324 0.00% 70 384 0.00% 71 432 0.00% 72 543 0.00% 73 598 0.00% 74 685 0.00% 75 749 0.00% 76 969 0.01% 77 982 0.01% 78 1182 0.01% 79 1253 0.01% 80 1580 0.01% 81 1719 0.01% 82 1937 0.01% 83 2300 0.01% 84 3285 0.02% 85 4161 0.02% 86 4653 0.02% 87 5129 0.03% 88 5494 0.03% 89 5749 0.03% 90 6186 0.03% 91 6738 0.03% 92 7146 0.04% 93 7645 0.04% 94 8616 0.04% 95 9111 0.05% 96 9651 0.05% 97 10489 0.05% 98 11229 0.06% 99 11740 0.06% 100 12911 0.07% 101 13493 0.07% 102 14444 0.07% 103 15765 0.08% 104 16508 0.09% 105 17905 0.09% 106 19020 0.10% 107 19876 0.10% 108 21020 0.11% 109 22369 0.12% 110 23355 0.12% 111 24561 0.13% 112 26003 0.13% 113 26768 0.14% 114 28686 0.15% 115 30020 0.16% 116 31765 0.16% 117 33094 0.17% 118 34955 0.18% 119 37144 0.19% 120 39441 0.20% 121 39774 0.21% 122 40445 0.21% 123 42253 0.22% 124 43815 0.23% 125 45501 0.24% 126 47658 0.25% 127 49736 0.26% 128 50773 0.26% 129 53058 0.28% 130 55294 0.29% 131 57751 0.30% 132 59808 0.31% 133 62677 0.32% 134 65517 0.34% 135 68215 0.35% 136 71439 0.37% 137 74565 0.39% 138 78688 0.41% 139 83621 0.43% 140 88156 0.46% 141 94537 0.49% 142 101912 0.53% 143 110896 0.58% 144 125579 0.65% 145 141058 0.73% 146 167968 0.87% 147 216451 1.12% 148 316244 1.64% 149 590189 3.06% 150 3392030 17.59% 151 12205873 63.29% 19285346 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=25 prefix-density=0.27 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=9.50 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=5.2 sequence=GTGATGGTCTTTCC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=23 prefix-density=0.36 prefix-fanout=2.3 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=69.75 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.0 sequence=CTCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACATTGGTGCAAATCCTTCAGCTGAAGGAGGTGATGAGGATG SRR7180147 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:09:04 Started mapping on | Feb 10 23:09:04 Finished on | Feb 10 23:11:01 Mapping speed, Million of reads per hour | 593.40 Number of input reads | 19285346 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18170942 Uniquely mapped reads % | 94.22% Average mapped length | 294.93 Number of splices: Total | 18189983 Number of splices: Annotated (sjdb) | 17883033 Number of splices: GT/AG | 17908262 Number of splices: GC/AG | 222427 Number of splices: AT/AC | 14444 Number of splices: Non-canonical | 44850 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 467199 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 42678 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 666371 666371 666371 N_multimapping 467199 467199 467199 N_noFeature 395096 18011150 471064 N_ambiguous 178749 1115 94150 UnstrandedReadsAssigned:17597097 PositiveStrandReadsAssigned:158677 NegativeStrandReadsAssigned:17605728 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180147 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180147-trimmed-pair1.fastq SRR7180147-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,285,346 reads, 17,474,317 reads pseudoaligned [quant] estimated average fragment length: 238.107 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR7180147.ke.tsv 34699 SRR7180147.se.tsv 87100 total ==> SRR7180147.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.89 1573 51.886 Potri.005G024800.1.v4.1 1035 797.893 467 34.382 Potri.004G059700.1.v4.1 961 723.91 65 5.27458 Potri.007G009000.2.v4.1 1416 1178.89 0 0 Potri.003G141000.2.v4.1 2943 2705.89 653.176 14.1801 Potri.016G087400.1.v4.1 270 81.8243 1063 763.151 Potri.015G069301.1.v4.1 564 330.918 0 0 Potri.010G195200.1.v4.1 1773 1535.89 405 15.4901 Potri.012G127500.1.v4.1 977 739.905 6724 533.84 ==> SRR7180147.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 471 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 384 SRR7180147 completed mapping pipeline successfully