Starting /dee2/code/volunteer_pipeline.sh SRR7180148 current disk space = 3057579831296 free memory = 1015474236 SRR7180148 SRAfilesize 89b9cef21447c92967c308958a6e5f71 SRR7180148.sra SRR7180148.sra file validated SRR7180148 is paired end SRR7180148 is conventional basespace SRR7180148 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180148_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0885 33.0 33.0 34.0 30.0 34.0 2 32.68275 33.0 33.0 34.0 31.0 34.0 3 32.47525 33.0 33.0 34.0 30.0 34.0 4 32.78975 33.0 33.0 34.0 31.0 34.0 5 32.5525 33.0 33.0 33.0 31.0 34.0 6 37.02 38.0 37.0 38.0 35.0 38.0 7 37.1935 38.0 38.0 38.0 36.0 38.0 8 37.583 38.0 38.0 38.0 37.0 38.0 9 37.66225 38.0 38.0 38.0 38.0 38.0 10-14 37.6933 38.0 38.0 38.0 38.0 38.0 15-19 37.69135 38.0 38.0 38.0 38.0 38.0 20-24 37.671299999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.6904 38.0 38.0 38.0 38.0 38.0 30-34 37.651599999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.605650000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.57565 38.0 38.0 38.0 38.0 38.0 45-49 37.56215 38.0 38.0 38.0 38.0 38.0 50-54 37.5521 38.0 38.0 38.0 38.0 38.0 55-59 37.485949999999995 38.0 38.0 38.0 38.0 38.0 60-64 37.4695 38.0 38.0 38.0 38.0 38.0 65-69 37.406150000000004 38.0 38.0 38.0 37.2 38.0 70-74 37.39765 38.0 38.0 38.0 37.0 38.0 75-79 37.345299999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.32135 38.0 38.0 38.0 37.0 38.0 85-89 37.25359999999999 38.0 38.0 38.0 37.0 38.0 90-94 37.205349999999996 38.0 38.0 38.0 36.8 38.0 95-99 37.12575 38.0 38.0 38.0 36.2 38.0 100-104 37.0664 38.0 38.0 38.0 36.2 38.0 105-109 36.997949999999996 38.0 38.0 38.0 36.0 38.0 110-114 36.8966 38.0 38.0 38.0 35.8 38.0 115-119 36.82015 38.0 38.0 38.0 35.0 38.0 120-124 36.7409 38.0 38.0 38.0 35.0 38.0 125-129 36.55455 38.0 38.0 38.0 34.4 38.0 130-134 36.38455 38.0 38.0 38.0 34.0 38.0 135-139 36.1709 38.0 38.0 38.0 33.8 38.0 140-144 35.932249999999996 38.0 38.0 38.0 33.0 38.0 145-149 35.71894999999999 38.0 36.6 38.0 33.0 38.0 150-151 33.081375 37.0 34.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 2.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 7.0 24 4.0 25 10.0 26 9.0 27 9.0 28 18.0 29 18.0 30 15.0 31 25.0 32 39.0 33 46.0 34 90.0 35 168.0 36 417.0 37 3115.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.94852941176471 14.390756302521007 12.683823529411764 35.976890756302524 2 20.785392696348172 17.358679339669834 36.418209104552275 25.437718859429715 3 18.55 22.1 26.625 32.725 4 21.725 30.3 23.875 24.099999999999998 5 22.650000000000002 32.824999999999996 25.2 19.325 6 18.5 33.475 27.474999999999998 20.549999999999997 7 14.475 23.325000000000003 42.975 19.225 8 17.724999999999998 24.175 31.95 26.150000000000002 9 17.825 23.275000000000002 33.7 25.2 10-14 19.8 28.595 27.555000000000003 24.05 15-19 19.555 29.054999999999996 27.845 23.544999999999998 20-24 19.71 28.575 27.689999999999998 24.025 25-29 19.505 28.52 28.035 23.94 30-34 19.735 28.59 28.18 23.494999999999997 35-39 19.735 27.87 28.515 23.880000000000003 40-44 19.765 28.615000000000002 27.97 23.65 45-49 20.25 27.99 27.834999999999997 23.925 50-54 19.91 28.000000000000004 28.185 23.905 55-59 19.545 28.749999999999996 27.74 23.965 60-64 20.080000000000002 28.165000000000003 27.68 24.075 65-69 20.080000000000002 27.495000000000005 28.43 23.995 70-74 19.869999999999997 27.92 28.43 23.78 75-79 20.13 27.675 28.48 23.715 80-84 20.05 28.52 27.694999999999997 23.735 85-89 20.71 28.42 27.13 23.74 90-94 20.14 27.925 28.389999999999997 23.544999999999998 95-99 20.39 27.944999999999997 27.785 23.880000000000003 100-104 20.035 28.27 27.884999999999998 23.810000000000002 105-109 20.765 27.889999999999997 27.815 23.53 110-114 20.9 28.000000000000004 27.615000000000002 23.485 115-119 20.315 28.16 27.200000000000003 24.325 120-124 20.24 28.26 27.644999999999996 23.855 125-129 20.66 28.084999999999997 27.200000000000003 24.055 130-134 21.315 28.044999999999998 26.85 23.79 135-139 20.315 28.560000000000002 27.005000000000003 24.12 140-144 20.974999999999998 28.09 26.334999999999997 24.6 145-149 21.035 28.110000000000003 26.534999999999997 24.32 150-151 21.28112098085825 27.348930314024773 26.2729888652571 25.096959839859878 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.5 22 2.0 23 1.5 24 1.5 25 2.5 26 5.0 27 5.5 28 5.5 29 12.0 30 16.5 31 22.5 32 31.5 33 48.0 34 54.5 35 66.5 36 97.0 37 110.0 38 131.5 39 160.0 40 187.0 41 219.5 42 249.5 43 277.0 44 284.5 45 262.5 46 264.0 47 264.5 48 233.0 49 201.0 50 171.5 51 149.5 52 120.5 53 84.5 54 61.0 55 51.0 56 38.5 57 30.0 58 20.0 59 10.5 60 6.5 61 4.5 62 4.5 63 6.0 64 5.5 65 4.0 66 3.0 67 2.0 68 2.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.4000000000000004 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.7875 0.0 0.0 0.0 0.0 118-119 4.1 0.0 0.0 0.0 0.0 120-121 4.574999999999999 0.0 0.0 0.0 0.0 122-123 5.3125 0.0 0.0 0.0 0.0 124-125 6.025 0.0 0.0 0.0 0.0 126-127 6.762499999999999 0.0 0.0 0.0 0.0 128-129 7.4125 0.0 0.0 0.0 0.0 130-131 8.1125 0.0 0.0 0.0 0.0 132-133 8.9875 0.0 0.0 0.0 0.0 134-135 9.649999999999999 0.0 0.0 0.0 0.0 136-137 10.3625 0.0 0.0 0.0 0.0 138-139 11.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCATCC 10 0.0068378756 144.95 2 GAAAACC 10 0.0068378756 144.95 145 TGAATTC 10 0.0068378756 144.95 8 >>END_MODULE SRR7180148 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180148_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0495 34.0 33.0 34.0 32.0 34.0 2 33.20925 34.0 33.0 34.0 33.0 34.0 3 33.2665 34.0 33.0 34.0 33.0 34.0 4 33.22875 34.0 33.0 34.0 33.0 34.0 5 33.2585 34.0 33.0 34.0 33.0 34.0 6 37.3115 38.0 38.0 38.0 38.0 38.0 7 37.35325 38.0 38.0 38.0 38.0 38.0 8 37.3585 38.0 38.0 38.0 38.0 38.0 9 37.37125 38.0 38.0 38.0 38.0 38.0 10-14 37.314699999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.2755 38.0 38.0 38.0 38.0 38.0 20-24 37.244749999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.19035 38.0 38.0 38.0 38.0 38.0 30-34 37.129400000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.08005 38.0 38.0 38.0 37.0 38.0 40-44 37.08655 38.0 38.0 38.0 37.2 38.0 45-49 37.1183 38.0 38.0 38.0 37.2 38.0 50-54 37.12865 38.0 38.0 38.0 37.0 38.0 55-59 37.055 38.0 38.0 38.0 37.0 38.0 60-64 37.0164 38.0 38.0 38.0 36.8 38.0 65-69 37.0291 38.0 38.0 38.0 37.0 38.0 70-74 36.9779 38.0 38.0 38.0 36.6 38.0 75-79 36.9782 38.0 38.0 38.0 36.4 38.0 80-84 36.906099999999995 38.0 38.0 38.0 36.4 38.0 85-89 36.87295 38.0 38.0 38.0 36.0 38.0 90-94 36.75575 38.0 38.0 38.0 36.0 38.0 95-99 36.5954 38.0 38.0 38.0 35.8 38.0 100-104 36.54645 38.0 38.0 38.0 35.0 38.0 105-109 36.384550000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.38095 38.0 38.0 38.0 34.6 38.0 115-119 36.180699999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.16619999999999 38.0 38.0 38.0 34.0 38.0 125-129 35.95605 38.0 38.0 38.0 33.6 38.0 130-134 35.7624 38.0 37.4 38.0 32.8 38.0 135-139 35.393150000000006 38.0 36.2 38.0 31.2 38.0 140-144 35.055550000000004 38.0 36.0 38.0 30.6 38.0 145-149 34.700300000000006 38.0 36.0 38.0 29.6 38.0 150-151 30.91275 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 2.0 5 3.0 6 1.0 7 3.0 8 2.0 9 1.0 10 1.0 11 1.0 12 1.0 13 2.0 14 4.0 15 1.0 16 2.0 17 3.0 18 2.0 19 3.0 20 5.0 21 6.0 22 7.0 23 7.0 24 21.0 25 8.0 26 15.0 27 10.0 28 17.0 29 17.0 30 18.0 31 39.0 32 49.0 33 61.0 34 101.0 35 167.0 36 454.0 37 2952.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.9 17.224999999999998 15.825 28.050000000000004 2 23.75 24.25 34.075 17.925 3 21.224999999999998 26.55 31.05 21.175 4 25.224999999999998 32.0 23.775 19.0 5 24.525 34.975 24.125 16.375 6 20.140105078809107 35.001250938203654 25.39404553415061 19.46459844883663 7 19.459729864932466 18.63431715857929 40.09504752376188 21.810905452726363 8 22.15 24.75 27.150000000000002 25.95 9 21.99149362021516 25.719289467100324 27.72079059294471 24.568426319739807 10-14 23.902707572193584 28.78734798058155 25.554276562734596 21.755667884490265 15-19 23.95875050060072 28.604325190228273 26.84721665999199 20.589707649179015 20-24 23.339677451667836 28.26805569468096 27.692076530101172 20.700190323550036 25-29 23.39679358717435 28.401803607214426 27.54008016032064 20.661322645290582 30-34 23.448310438183096 28.717537350847287 27.348841873057257 20.485310337912363 35-39 24.107321965897693 28.430290872617853 26.760280842527585 20.70210631895687 40-44 23.84750438926511 28.90393779784299 27.183345874090797 20.065211938801102 45-49 23.543555577818964 28.332414967690227 27.676200971797826 20.44782848269298 50-54 23.56534802203305 28.938407611417126 26.950425638457688 20.54581872809214 55-59 24.61068549396625 27.925491963346854 27.20945370787642 20.254368834810474 60-64 24.969957941117567 28.324654516322852 27.082916082515524 19.62247146004406 65-69 23.905858788182275 27.971957936905355 27.786680020030047 20.335503254882322 70-74 24.07425940752602 27.867293835068054 27.66212970376301 20.396317053642914 75-79 24.24439551641313 28.112489991993595 27.37189751801441 20.271216973578863 80-84 23.600060051043386 28.09888405144373 27.598458689886403 20.702597207626482 85-89 24.340689586148226 28.033828754441277 27.293199219336433 20.332282440074064 90-94 24.134826965393078 28.290658131626323 27.550510102020404 20.024004800960192 95-99 24.337433743374337 28.32783278327833 26.732673267326735 20.602060206020603 100-104 24.249849969994 28.560712142428486 27.135427085417085 20.054010802160434 105-109 24.75747574757476 28.372837283728376 27.017701770177016 19.851985198519852 110-114 24.682468246824683 28.28282828282828 27.29272927292729 19.741974197419744 115-119 25.196299074768692 28.582145536384097 26.641660415103775 19.579894973743436 120-124 24.411102775693923 28.172043010752688 27.53188297074269 19.884971242810703 125-129 24.65863052068224 28.2798979642875 27.034462061721605 20.027009453308658 130-134 25.408974936214918 28.76081845014758 27.054880184101254 18.775326429536246 135-139 25.622686806041813 28.30849254776433 26.622986896068824 19.44583375012504 140-144 26.117611761176118 28.092809280928094 26.572657265726573 19.216921692169215 145-149 25.814999999999998 28.305000000000003 26.795 19.085 150-151 26.601479252851952 27.842547323555223 26.23793406042372 19.318039363169113 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 1.0 25 0.0 26 0.5 27 2.0 28 3.5 29 7.0 30 9.5 31 8.5 32 11.0 33 22.5 34 38.5 35 54.5 36 75.5 37 106.0 38 136.0 39 165.5 40 199.5 41 230.0 42 246.0 43 275.5 44 285.5 45 286.5 46 285.5 47 263.0 48 255.0 49 216.0 50 167.0 51 135.5 52 114.5 53 95.5 54 73.0 55 60.0 56 49.0 57 34.5 58 21.0 59 11.5 60 9.5 61 9.0 62 5.0 63 5.0 64 6.0 65 3.0 66 0.5 67 1.5 68 1.0 69 0.5 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.05 8 0.0 9 0.075 10-14 0.095 15-19 0.12 20-24 0.16999999999999998 25-29 0.2 30-34 0.27 35-39 0.3 40-44 0.325 45-49 0.185 50-54 0.15 55-59 0.145 60-64 0.13999999999999999 65-69 0.15 70-74 0.08 75-79 0.08 80-84 0.08499999999999999 85-89 0.08499999999999999 90-94 0.02 95-99 0.01 100-104 0.02 105-109 0.01 110-114 0.01 115-119 0.025 120-124 0.025 125-129 0.034999999999999996 130-134 0.055 135-139 0.03 140-144 0.01 145-149 0.0 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.575 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.6125 0.0 0.0 0.0 0.0 116-117 4.012499999999999 0.0 0.0 0.0 0.0 118-119 4.3375 0.0 0.0 0.0 0.0 120-121 4.8125 0.0 0.0 0.0 0.0 122-123 5.5875 0.0 0.0 0.0 0.0 124-125 6.324999999999999 0.0 0.0 0.0 0.0 126-127 7.0625 0.0 0.0 0.0 0.0 128-129 7.65 0.0 0.0 0.0 0.0 130-131 8.3 0.0 0.0 0.0 0.0 132-133 9.2 0.0 0.0 0.0 0.0 134-135 9.8625 0.0 0.0 0.0 0.0 136-137 10.575 0.0 0.0 0.0 0.0 138-139 11.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGCTTT 10 0.006830828 145.0 145 >>END_MODULE Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718165 spots for SRR7180148.sra Written 718165 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra Read 718146 spots for SRR7180148.sra Written 718146 spots for SRR7180148.sra SRR ids: ['SRR7180148.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ra7v99bl SRR7180148.sra spots: 14362939 blocks: [[1, 718146], [718147, 1436292], [1436293, 2154438], [2154439, 2872584], [2872585, 3590730], [3590731, 4308876], [4308877, 5027022], [5027023, 5745168], [5745169, 6463314], [6463315, 7181460], [7181461, 7899606], [7899607, 8617752], [8617753, 9335898], [9335899, 10054044], [10054045, 10772190], [10772191, 11490336], [11490337, 12208482], [12208483, 12926628], [12926629, 13644774], [13644775, 14362939]] SRR7180148 file size 4845428 SRR7180148 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180148 SRR7180148_1.fastq SRR7180148_2.fastq Input file: SRR7180148_1.fastq Paired file: SRR7180148_2.fastq trimmed: SRR7180148-trimmed-pair1.fastq, SRR7180148-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:02:44 2025 >> started Mon Feb 10 23:03:00 2025 >> done (15.558s) 14362939 read pairs processed; of these: 30309 ( 0.21%) short read pairs filtered out after trimming by size control 15915 ( 0.11%) empty read pairs filtered out after trimming by size control 14316715 (99.68%) read pairs available; of these: 5814231 (40.61%) trimmed read pairs available after processing 8502484 (59.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 0 0.00% 21 3 0.00% 22 5 0.00% 23 5 0.00% 24 6 0.00% 25 8 0.00% 26 5 0.00% 27 7 0.00% 28 7 0.00% 29 1 0.00% 30 5 0.00% 31 7 0.00% 32 9 0.00% 33 4 0.00% 34 8 0.00% 35 8 0.00% 36 11 0.00% 37 30 0.00% 38 11 0.00% 39 14 0.00% 40 10 0.00% 41 10 0.00% 42 18 0.00% 43 17 0.00% 44 35 0.00% 45 37 0.00% 46 39 0.00% 47 98 0.00% 48 42 0.00% 49 55 0.00% 50 33 0.00% 51 89 0.00% 52 75 0.00% 53 108 0.00% 54 74 0.00% 55 149 0.00% 56 145 0.00% 57 108 0.00% 58 84 0.00% 59 105 0.00% 60 131 0.00% 61 172 0.00% 62 207 0.00% 63 215 0.00% 64 253 0.00% 65 267 0.00% 66 327 0.00% 67 385 0.00% 68 413 0.00% 69 494 0.00% 70 611 0.00% 71 658 0.00% 72 785 0.01% 73 896 0.01% 74 1004 0.01% 75 1232 0.01% 76 1440 0.01% 77 1655 0.01% 78 1800 0.01% 79 2051 0.01% 80 2283 0.02% 81 2625 0.02% 82 3022 0.02% 83 3477 0.02% 84 4991 0.03% 85 6183 0.04% 86 6811 0.05% 87 7484 0.05% 88 8285 0.06% 89 8578 0.06% 90 9295 0.06% 91 10023 0.07% 92 10711 0.07% 93 11699 0.08% 94 12500 0.09% 95 13564 0.09% 96 14429 0.10% 97 15458 0.11% 98 16563 0.12% 99 17641 0.12% 100 18606 0.13% 101 19700 0.14% 102 20947 0.15% 103 22120 0.15% 104 23595 0.16% 105 25070 0.18% 106 26648 0.19% 107 28090 0.20% 108 29420 0.21% 109 31401 0.22% 110 32314 0.23% 111 34433 0.24% 112 34865 0.24% 113 36398 0.25% 114 37876 0.26% 115 39706 0.28% 116 41810 0.29% 117 42687 0.30% 118 44362 0.31% 119 46932 0.33% 120 48030 0.34% 121 49573 0.35% 122 49661 0.35% 123 51379 0.36% 124 53187 0.37% 125 53410 0.37% 126 55414 0.39% 127 56940 0.40% 128 58508 0.41% 129 59942 0.42% 130 61243 0.43% 131 62219 0.43% 132 64685 0.45% 133 65926 0.46% 134 67720 0.47% 135 69683 0.49% 136 71615 0.50% 137 73047 0.51% 138 75528 0.53% 139 77536 0.54% 140 80377 0.56% 141 83879 0.59% 142 88373 0.62% 143 93052 0.65% 144 101581 0.71% 145 109112 0.76% 146 123709 0.86% 147 150180 1.05% 148 205117 1.43% 149 376460 2.63% 150 2338057 16.33% 151 8502484 59.39% 14316715 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=18 prefix-density=0.32 prefix-fanout=3.1 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=10.60 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=3.0 sequence=TCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=30 prefix-density=0.39 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=51.16 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.8 sequence=GAGAAGGCAATGAGAGATGC SRR7180148 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:03:47 Started mapping on | Feb 10 23:03:47 Finished on | Feb 10 23:05:31 Mapping speed, Million of reads per hour | 495.58 Number of input reads | 14316715 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13387848 Uniquely mapped reads % | 93.51% Average mapped length | 291.18 Number of splices: Total | 12949257 Number of splices: Annotated (sjdb) | 12698905 Number of splices: GT/AG | 12736649 Number of splices: GC/AG | 166175 Number of splices: AT/AC | 10877 Number of splices: Non-canonical | 35556 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340387 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 33080 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 610633 610633 610633 N_multimapping 340387 340387 340387 N_noFeature 351160 13250566 415351 N_ambiguous 140307 765 66769 UnstrandedReadsAssigned:12896381 PositiveStrandReadsAssigned:136517 NegativeStrandReadsAssigned:12905728 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7180148 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180148-trimmed-pair1.fastq SRR7180148-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,316,715 reads, 12,874,438 reads pseudoaligned [quant] estimated average fragment length: 215.975 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7180148.ke.tsv 34699 SRR7180148.se.tsv 87100 total ==> SRR7180148.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.03 928 38.4711 Potri.005G024800.1.v4.1 1035 820.025 149 13.5815 Potri.004G059700.1.v4.1 961 746.032 19 1.90364 Potri.007G009000.2.v4.1 1416 1201.03 0 0 Potri.003G141000.2.v4.1 2943 2728.03 603 16.5218 Potri.016G087400.1.v4.1 270 91.7853 1674 1363.24 Potri.015G069301.1.v4.1 564 351.584 0 0 Potri.010G195200.1.v4.1 1773 1558.03 311.714 14.9544 Potri.012G127500.1.v4.1 977 762.025 6918 678.578 ==> SRR7180148.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 86 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 359 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 165 SRR7180148 completed mapping pipeline successfully