Starting /dee2/code/volunteer_pipeline.sh SRR7180149 current disk space = 3057661349888 free memory = 1504243452 SRR7180149 SRAfilesize 0a3004ad7077cc4d4b74ea9a903c2510 SRR7180149.sra SRR7180149.sra file validated SRR7180149 is paired end SRR7180149 is conventional basespace SRR7180149 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180149_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.457 33.0 32.0 34.0 30.0 34.0 2 32.747 33.0 33.0 34.0 31.0 34.0 3 32.5945 33.0 33.0 34.0 31.0 34.0 4 32.37325 33.0 33.0 33.0 31.0 34.0 5 32.98625 33.0 33.0 34.0 33.0 34.0 6 37.2385 38.0 38.0 38.0 36.0 38.0 7 37.525 38.0 38.0 38.0 37.0 38.0 8 37.604 38.0 38.0 38.0 38.0 38.0 9 37.6405 38.0 38.0 38.0 38.0 38.0 10-14 37.700900000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.71065 38.0 38.0 38.0 38.0 38.0 20-24 37.6681 38.0 38.0 38.0 38.0 38.0 25-29 37.6269 38.0 38.0 38.0 38.0 38.0 30-34 37.59005 38.0 38.0 38.0 38.0 38.0 35-39 37.5676 38.0 38.0 38.0 38.0 38.0 40-44 37.490300000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.47895 38.0 38.0 38.0 38.0 38.0 50-54 37.4008 38.0 38.0 38.0 37.8 38.0 55-59 37.39585 38.0 38.0 38.0 37.8 38.0 60-64 37.3678 38.0 38.0 38.0 37.4 38.0 65-69 37.3245 38.0 38.0 38.0 37.2 38.0 70-74 37.32545 38.0 38.0 38.0 37.0 38.0 75-79 37.23515 38.0 38.0 38.0 37.0 38.0 80-84 37.194599999999994 38.0 38.0 38.0 37.0 38.0 85-89 37.150749999999995 38.0 38.0 38.0 36.8 38.0 90-94 37.12025 38.0 38.0 38.0 36.6 38.0 95-99 37.043150000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.8605 38.0 38.0 38.0 36.0 38.0 105-109 36.80805 38.0 38.0 38.0 35.8 38.0 110-114 36.7779 38.0 38.0 38.0 35.4 38.0 115-119 36.684 38.0 38.0 38.0 35.0 38.0 120-124 36.555800000000005 38.0 38.0 38.0 35.0 38.0 125-129 36.407050000000005 38.0 38.0 38.0 34.6 38.0 130-134 36.1862 38.0 38.0 38.0 33.8 38.0 135-139 36.00075 38.0 38.0 38.0 33.2 38.0 140-144 35.7721 38.0 37.4 38.0 33.0 38.0 145-149 35.52095 38.0 36.6 38.0 32.8 38.0 150-151 32.913125 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 2.0 9 3.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 3.0 16 1.0 17 0.0 18 3.0 19 1.0 20 5.0 21 2.0 22 0.0 23 6.0 24 5.0 25 5.0 26 8.0 27 22.0 28 12.0 29 19.0 30 14.0 31 29.0 32 56.0 33 45.0 34 72.0 35 150.0 36 415.0 37 3115.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.92903225806452 14.864516129032257 12.283870967741937 35.92258064516129 2 21.076345431789736 18.197747183979978 35.819774718397994 24.90613266583229 3 18.15 21.325 27.625 32.9 4 20.8 30.0 24.375 24.825 5 20.65 33.25 26.375 19.725 6 18.4 33.675 27.05 20.875 7 14.625 25.05 42.05 18.275 8 16.8 23.9 32.074999999999996 27.224999999999998 9 18.125 24.5 33.074999999999996 24.3 10-14 19.71 29.575000000000003 27.865000000000002 22.85 15-19 19.775000000000002 28.349999999999998 28.415000000000003 23.46 20-24 19.505 29.035 28.560000000000002 22.900000000000002 25-29 19.77 29.715000000000003 27.529999999999998 22.985 30-34 19.994999999999997 28.89 28.325 22.79 35-39 19.81 29.29 28.189999999999998 22.71 40-44 20.4 29.015 27.689999999999998 22.895 45-49 19.695 28.645 28.494999999999997 23.165 50-54 20.200000000000003 29.049999999999997 27.205000000000002 23.544999999999998 55-59 19.7 29.354999999999997 27.750000000000004 23.195 60-64 20.075000000000003 28.444999999999997 28.285 23.195 65-69 20.04 28.49 27.900000000000002 23.57 70-74 19.689999999999998 28.694999999999997 27.765 23.849999999999998 75-79 20.419999999999998 28.134999999999998 27.815 23.630000000000003 80-84 20.265 27.815 28.18 23.74 85-89 20.52 28.525 28.02 22.935 90-94 20.599999999999998 28.89 27.395000000000003 23.115 95-99 20.43 27.98 27.689999999999998 23.9 100-104 20.544999999999998 28.499999999999996 27.935 23.02 105-109 20.580000000000002 28.43 27.265 23.724999999999998 110-114 20.424999999999997 28.645 27.26 23.669999999999998 115-119 20.735 28.515 27.534999999999997 23.215 120-124 20.794999999999998 28.43 26.8 23.974999999999998 125-129 20.225 27.744999999999997 27.794999999999998 24.235 130-134 20.185 28.095 28.12 23.599999999999998 135-139 20.835 27.884999999999998 27.389999999999997 23.89 140-144 21.36 28.01 27.51 23.119999999999997 145-149 21.279999999999998 28.915000000000003 26.47 23.335 150-151 21.331997996995494 28.480220330495744 26.364546820230345 23.823234852278418 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 1.0 12 1.5 13 1.0 14 1.5 15 1.5 16 1.0 17 2.0 18 1.5 19 1.0 20 1.0 21 0.5 22 1.0 23 2.0 24 3.0 25 3.5 26 5.0 27 10.5 28 14.0 29 16.5 30 26.5 31 36.5 32 39.0 33 47.0 34 68.0 35 97.5 36 108.0 37 127.0 38 155.5 39 165.0 40 195.5 41 228.0 42 243.5 43 240.5 44 234.5 45 257.5 46 251.5 47 228.0 48 219.5 49 187.0 50 155.5 51 126.5 52 102.5 53 81.5 54 62.0 55 54.0 56 41.0 57 35.0 58 29.0 59 17.5 60 13.0 61 12.5 62 9.5 63 5.5 64 5.0 65 5.5 66 4.5 67 3.5 68 2.5 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.1624999999999996 0.0 0.0 0.0 0.0 126-127 3.575 0.0 0.0 0.0 0.0 128-129 3.9749999999999996 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCATG 10 0.006836113 144.9625 8 TGGATGT 10 0.006836113 144.9625 9 >>END_MODULE SRR7180149 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180149_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.073 34.0 33.0 34.0 33.0 34.0 2 33.15125 34.0 33.0 34.0 33.0 34.0 3 33.18275 34.0 33.0 34.0 33.0 34.0 4 33.1785 34.0 33.0 34.0 33.0 34.0 5 33.156 34.0 33.0 34.0 33.0 34.0 6 37.25125 38.0 38.0 38.0 38.0 38.0 7 37.2785 38.0 38.0 38.0 38.0 38.0 8 37.26425 38.0 38.0 38.0 38.0 38.0 9 37.308 38.0 38.0 38.0 38.0 38.0 10-14 37.183800000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.15985 38.0 38.0 38.0 37.8 38.0 20-24 37.1386 38.0 38.0 38.0 37.8 38.0 25-29 37.0281 38.0 38.0 38.0 37.8 38.0 30-34 36.993449999999996 38.0 38.0 38.0 37.6 38.0 35-39 36.91674999999999 38.0 38.0 38.0 37.0 38.0 40-44 36.89315 38.0 38.0 38.0 37.0 38.0 45-49 36.949850000000005 38.0 38.0 38.0 37.0 38.0 50-54 36.9728 38.0 38.0 38.0 37.0 38.0 55-59 36.96105 38.0 38.0 38.0 37.0 38.0 60-64 36.84590000000001 38.0 38.0 38.0 37.0 38.0 65-69 36.851200000000006 38.0 38.0 38.0 37.0 38.0 70-74 36.792100000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.762 38.0 38.0 38.0 36.0 38.0 80-84 36.7159 38.0 38.0 38.0 36.0 38.0 85-89 36.6375 38.0 38.0 38.0 36.0 38.0 90-94 36.57255 38.0 38.0 38.0 35.8 38.0 95-99 36.474000000000004 38.0 38.0 38.0 35.2 38.0 100-104 36.33165 38.0 38.0 38.0 34.6 38.0 105-109 36.19805 38.0 38.0 38.0 34.0 38.0 110-114 36.0673 38.0 38.0 38.0 34.0 38.0 115-119 35.96704999999999 38.0 38.0 38.0 34.0 38.0 120-124 35.85055 38.0 38.0 38.0 33.4 38.0 125-129 35.711149999999996 38.0 37.8 38.0 33.0 38.0 130-134 35.4594 38.0 36.8 38.0 31.8 38.0 135-139 35.22115 38.0 36.0 38.0 31.0 38.0 140-144 34.795100000000005 38.0 36.0 38.0 28.6 38.0 145-149 34.36465 38.0 36.0 38.0 27.6 38.0 150-151 30.90575 36.5 29.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 7.0 4 6.0 5 5.0 6 2.0 7 1.0 8 3.0 9 6.0 10 0.0 11 3.0 12 0.0 13 1.0 14 4.0 15 1.0 16 0.0 17 8.0 18 4.0 19 5.0 20 6.0 21 5.0 22 3.0 23 6.0 24 9.0 25 7.0 26 12.0 27 17.0 28 28.0 29 20.0 30 29.0 31 44.0 32 52.0 33 57.0 34 104.0 35 175.0 36 441.0 37 2914.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.3 18.65 17.175 26.875 2 24.525 23.75 33.050000000000004 18.675 3 22.375 25.8 31.0 20.825 4 24.675 32.625 23.775 18.925 5 24.175 35.025 23.549999999999997 17.25 6 19.954988747186796 35.65891472868217 25.156289072268066 19.229807451862964 7 19.325 20.349999999999998 39.225 21.099999999999998 8 20.974999999999998 24.95 27.775 26.3 9 22.95573893473368 26.056514128532132 28.33208302075519 22.655663915978995 10-14 23.80071031964384 28.10264619078585 25.906657996098243 22.18998549347206 15-19 23.60888710968775 27.962369895916733 27.61208967173739 20.816653322658127 20-24 22.8943415122684 28.33249874812218 28.02704056084126 20.74611917876815 25-29 23.786359077231694 27.607823470411237 27.67803410230692 20.92778335005015 30-34 23.191169091821376 28.850978424485703 26.954340190667338 21.00351229302559 35-39 23.65898941241407 28.71192734206433 26.850318631140546 20.778764614381053 40-44 23.209356020679618 28.459569341966574 27.571148923354915 20.759925713998896 45-49 23.662056524353577 27.465423932651834 28.06674684305472 20.80577269993987 50-54 23.074227939336303 28.11452024625857 27.814204915160918 20.997046899244207 55-59 23.733733733733732 27.27727727727728 28.388388388388385 20.6006006006006 60-64 23.193193193193192 27.812812812812815 27.992992992992992 21.001001001001 65-69 23.66866866866867 27.922922922922922 27.98798798798799 20.42042042042042 70-74 23.667100130039014 28.178453536060815 27.418225467640294 20.736220866259877 75-79 23.196959087726317 27.58327498249475 28.258477543262977 20.961288386515957 80-84 23.251975592677805 28.133440032009606 28.173452035610687 20.441132339701912 85-89 23.211963589076724 27.8333500050015 28.50855256576973 20.446133840152044 90-94 22.981149057452875 28.366418320916047 28.361418070903543 20.29101455072754 95-99 23.61 28.465 27.779999999999998 20.145 100-104 24.0 28.225 27.395000000000003 20.380000000000003 105-109 23.71 28.685 27.955000000000002 19.650000000000002 110-114 24.115000000000002 27.82 27.99 20.075000000000003 115-119 24.10120506025301 28.241412070603527 27.536376818840942 20.121006050302515 120-124 23.376168808440422 28.601430071503575 27.626381319065953 20.39601980099005 125-129 24.331216560828043 27.886394319715986 27.461373068653433 20.32101605080254 130-134 24.058608791318697 27.874181127169074 28.179226884032605 19.887983197479624 135-139 24.252425242524254 28.012801280128013 27.917791779177918 19.816981698169815 140-144 24.7962398119906 27.896394819740987 27.471373568678437 19.83599179958998 145-149 25.045 28.23 27.52 19.205 150-151 25.445196889892152 27.56458490092802 27.539503386004515 19.450714823175318 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.0 22 2.0 23 1.5 24 2.0 25 3.0 26 4.5 27 6.0 28 6.5 29 8.5 30 15.0 31 21.5 32 30.0 33 40.5 34 49.0 35 60.0 36 75.0 37 100.0 38 127.0 39 159.5 40 208.0 41 221.0 42 241.5 43 272.5 44 277.0 45 287.0 46 282.0 47 263.0 48 226.5 49 183.5 50 162.5 51 142.0 52 111.5 53 88.0 54 69.0 55 51.5 56 41.5 57 36.5 58 28.0 59 21.5 60 13.5 61 10.5 62 12.0 63 7.0 64 2.5 65 3.0 66 3.0 67 3.5 68 3.0 69 1.5 70 1.5 71 1.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.025 10-14 0.045 15-19 0.08 20-24 0.15 25-29 0.3 30-34 0.35000000000000003 35-39 0.35500000000000004 40-44 0.385 45-49 0.22 50-54 0.105 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.03 75-79 0.03 80-84 0.03 85-89 0.03 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.005 125-129 0.005 130-134 0.015 135-139 0.01 140-144 0.005 145-149 0.0 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11504424778761 98.0 2 0.7332490518331226 1.4500000000000002 3 0.1011378002528445 0.3 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.025284450063211124 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.4625 0.0 0.0 0.0 0.0 120-121 2.7125000000000004 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.65 0.0 0.0 0.0 0.0 128-129 4.0625 0.0 0.0 0.0 0.0 130-131 4.5375 0.0 0.0 0.0 0.0 132-133 5.0625 0.0 0.0 0.0 0.0 134-135 5.6125 0.0 0.0 0.0 0.0 136-137 6.2375 0.0 0.0 0.0 0.0 138-139 6.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTGC 10 0.0068803662 144.65 1 AGAGAGC 10 0.0068803662 144.65 6 GAGAGCA 10 0.0068803662 144.65 7 >>END_MODULE Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra Read 520009 spots for SRR7180149.sra Written 520009 spots for SRR7180149.sra Read 520001 spots for SRR7180149.sra Written 520001 spots for SRR7180149.sra SRR ids: ['SRR7180149.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hsr16u_t SRR7180149.sra spots: 10400028 blocks: [[1, 520001], [520002, 1040002], [1040003, 1560003], [1560004, 2080004], [2080005, 2600005], [2600006, 3120006], [3120007, 3640007], [3640008, 4160008], [4160009, 4680009], [4680010, 5200010], [5200011, 5720011], [5720012, 6240012], [6240013, 6760013], [6760014, 7280014], [7280015, 7800015], [7800016, 8320016], [8320017, 8840017], [8840018, 9360018], [9360019, 9880019], [9880020, 10400028]] SRR7180149 file size 3502527 SRR7180149 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180149 SRR7180149_1.fastq SRR7180149_2.fastq Input file: SRR7180149_1.fastq Paired file: SRR7180149_2.fastq trimmed: SRR7180149-trimmed-pair1.fastq, SRR7180149-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:31:01 2025 >> started Mon Feb 10 23:31:13 2025 >> done (11.709s) 10400028 read pairs processed; of these: 28991 ( 0.28%) short read pairs filtered out after trimming by size control 19658 ( 0.19%) empty read pairs filtered out after trimming by size control 10351379 (99.53%) read pairs available; of these: 3798187 (36.69%) trimmed read pairs available after processing 6553192 (63.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 7 0.00% 21 9 0.00% 22 7 0.00% 23 6 0.00% 24 5 0.00% 25 6 0.00% 26 9 0.00% 27 12 0.00% 28 4 0.00% 29 5 0.00% 30 8 0.00% 31 10 0.00% 32 10 0.00% 33 10 0.00% 34 9 0.00% 35 14 0.00% 36 13 0.00% 37 18 0.00% 38 23 0.00% 39 19 0.00% 40 18 0.00% 41 13 0.00% 42 20 0.00% 43 19 0.00% 44 25 0.00% 45 33 0.00% 46 48 0.00% 47 66 0.00% 48 24 0.00% 49 62 0.00% 50 32 0.00% 51 76 0.00% 52 56 0.00% 53 66 0.00% 54 60 0.00% 55 100 0.00% 56 121 0.00% 57 73 0.00% 58 59 0.00% 59 64 0.00% 60 79 0.00% 61 118 0.00% 62 126 0.00% 63 127 0.00% 64 118 0.00% 65 131 0.00% 66 175 0.00% 67 188 0.00% 68 203 0.00% 69 216 0.00% 70 244 0.00% 71 270 0.00% 72 322 0.00% 73 374 0.00% 74 484 0.00% 75 528 0.01% 76 712 0.01% 77 733 0.01% 78 686 0.01% 79 844 0.01% 80 856 0.01% 81 1025 0.01% 82 1180 0.01% 83 1385 0.01% 84 2586 0.02% 85 3493 0.03% 86 3773 0.04% 87 4470 0.04% 88 4818 0.05% 89 4679 0.05% 90 4990 0.05% 91 5115 0.05% 92 5387 0.05% 93 5663 0.05% 94 5647 0.05% 95 6087 0.06% 96 6216 0.06% 97 6290 0.06% 98 6850 0.07% 99 7145 0.07% 100 7620 0.07% 101 8242 0.08% 102 8830 0.09% 103 9374 0.09% 104 10121 0.10% 105 10504 0.10% 106 11206 0.11% 107 11601 0.11% 108 12320 0.12% 109 12920 0.12% 110 13613 0.13% 111 14525 0.14% 112 15521 0.15% 113 16323 0.16% 114 17748 0.17% 115 18410 0.18% 116 19145 0.18% 117 19653 0.19% 118 20337 0.20% 119 22119 0.21% 120 22582 0.22% 121 23749 0.23% 122 23590 0.23% 123 24669 0.24% 124 25833 0.25% 125 26995 0.26% 126 27495 0.27% 127 28511 0.28% 128 28961 0.28% 129 29873 0.29% 130 31299 0.30% 131 32446 0.31% 132 34263 0.33% 133 35626 0.34% 134 37497 0.36% 135 38709 0.37% 136 40195 0.39% 137 41751 0.40% 138 43521 0.42% 139 45336 0.44% 140 47118 0.46% 141 49666 0.48% 142 53713 0.52% 143 58114 0.56% 144 64850 0.63% 145 72961 0.70% 146 83198 0.80% 147 104632 1.01% 148 148448 1.43% 149 283036 2.73% 150 1813841 17.52% 151 6553192 63.31% 10351379 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=38 prefix-density=0.22 prefix-fanout=2.0 sequence=CCGCACTTGCAGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=220.28 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=19.2 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTT criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=31 prefix-density=0.59 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=35.73 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=11.7 sequence=GAGAAGGCAATGAGAGATGCGATTGATGGAAT SRR7180149 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:33:04 Started mapping on | Feb 10 23:33:04 Finished on | Feb 10 23:35:53 Mapping speed, Million of reads per hour | 220.50 Number of input reads | 10351379 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 8902722 Uniquely mapped reads % | 86.01% Average mapped length | 294.45 Number of splices: Total | 8214201 Number of splices: Annotated (sjdb) | 8014988 Number of splices: GT/AG | 8061138 Number of splices: GC/AG | 114399 Number of splices: AT/AC | 8433 Number of splices: Non-canonical | 30231 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289178 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 52676 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.56% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1181728 1181728 1181728 N_multimapping 289178 289178 289178 N_noFeature 283013 8807488 328017 N_ambiguous 97993 666 47355 UnstrandedReadsAssigned:8521716 PositiveStrandReadsAssigned:94568 NegativeStrandReadsAssigned:8527350 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180149 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180149-trimmed-pair1.fastq SRR7180149-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,351,379 reads, 8,501,736 reads pseudoaligned [quant] estimated average fragment length: 230.177 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7180149.ke.tsv 34699 SRR7180149.se.tsv 87100 total ==> SRR7180149.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.82 1532 90.9997 Potri.005G024800.1.v4.1 1035 805.823 227 29.9319 Potri.004G059700.1.v4.1 961 731.849 7 1.01631 Potri.007G009000.2.v4.1 1416 1186.82 0 0 Potri.003G141000.2.v4.1 2943 2713.82 361.545 14.1556 Potri.016G087400.1.v4.1 270 81.8675 482 625.582 Potri.015G069301.1.v4.1 564 337.758 0 0 Potri.010G195200.1.v4.1 1773 1543.82 659 45.3562 Potri.012G127500.1.v4.1 977 747.833 6892 979.24 ==> SRR7180149.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 317 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 458 SRR7180149 completed mapping pipeline successfully