Starting /dee2/code/volunteer_pipeline.sh SRR7230764 current disk space = 3057474801664 free memory = 1576830932 SRR7230764 SRAfilesize 9a0a883e5f2ac54dbe8339bb9a2dbd46 SRR7230764.sra SRR7230764.sra file validated SRR7230764 is paired end SRR7230764 is conventional basespace SRR7230764 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230764_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28575 34.0 33.0 34.0 33.0 34.0 2 33.3175 34.0 33.0 34.0 33.0 34.0 3 33.39825 34.0 33.0 34.0 33.0 34.0 4 33.30225 34.0 34.0 34.0 33.0 34.0 5 33.25925 34.0 33.0 34.0 33.0 34.0 6 37.0845 38.0 37.0 38.0 36.0 38.0 7 37.39575 38.0 38.0 38.0 37.0 38.0 8 37.4525 38.0 38.0 38.0 37.0 38.0 9 37.432 38.0 38.0 38.0 37.0 38.0 10-14 37.513650000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.361399999999996 38.0 38.0 38.0 37.4 38.0 20-24 37.208000000000006 38.0 38.0 38.0 36.8 38.0 25-29 37.27745 38.0 38.0 38.0 36.8 38.0 30-34 37.3806 38.0 38.0 38.0 37.0 38.0 35-39 37.2452 38.0 38.0 38.0 36.8 38.0 40-44 36.610350000000004 38.0 38.0 38.0 34.4 38.0 45-49 36.99275 38.0 38.0 38.0 36.0 38.0 50-54 37.146 38.0 38.0 38.0 36.4 38.0 55-59 37.052550000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.0949 38.0 38.0 38.0 36.0 38.0 65-69 37.0349 38.0 38.0 38.0 36.0 38.0 70-74 30.246400000000005 38.0 21.0 38.0 15.0 38.0 75-79 31.1291 38.0 30.8 38.0 2.0 38.0 80-84 34.23 38.0 36.4 38.0 24.6 38.0 85-89 35.9582 38.0 37.6 38.0 31.2 38.0 90-94 36.1403 38.0 37.4 38.0 32.8 38.0 95-99 36.223 38.0 38.0 38.0 33.6 38.0 100-104 36.12245 38.0 37.4 38.0 33.0 38.0 105-109 36.156099999999995 38.0 37.6 38.0 33.8 38.0 110-114 34.5289 37.8 34.8 38.0 24.6 38.0 115-119 34.17235 37.6 33.6 38.0 24.4 38.0 120-124 34.839 38.0 35.4 38.0 27.0 38.0 125-129 34.06275 38.0 34.4 38.0 22.2 38.0 130-134 34.2847 38.0 34.6 38.0 24.0 38.0 135-139 33.55675 37.8 33.6 38.0 21.6 38.0 140-144 33.947 38.0 34.2 38.0 23.2 38.0 145-149 33.1641 38.0 33.6 38.0 19.4 38.0 150-151 29.14675 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 5.0 16 1.0 17 2.0 18 2.0 19 6.0 20 8.0 21 8.0 22 9.0 23 12.0 24 15.0 25 30.0 26 26.0 27 38.0 28 51.0 29 49.0 30 63.0 31 98.0 32 122.0 33 212.0 34 325.0 35 493.0 36 882.0 37 1539.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.449999999999996 15.1 10.525 32.925 2 21.075 22.325 34.575 22.025 3 19.075 27.925 25.275 27.725 4 23.150000000000002 33.45 21.224999999999998 22.175 5 19.925 37.974999999999994 24.15 17.95 6 16.625 36.525 26.424999999999997 20.424999999999997 7 13.775 22.425 43.3 20.5 8 17.224999999999998 23.549999999999997 30.85 28.375 9 17.525 23.175 32.4 26.900000000000002 10-14 19.96199619961996 29.57795779577958 26.192619261926193 24.267426742674267 15-19 19.865 28.685 27.744999999999997 23.705000000000002 20-24 20.135 28.715000000000003 27.525 23.625 25-29 20.276082824847457 28.663599079723916 27.74332299689907 23.31699509852956 30-34 19.570978548927446 28.921446072303613 27.67638381919096 23.83119155957798 35-39 20.08301245186778 28.854328149222386 27.914187128069212 23.148472270840625 40-44 19.69241558962028 29.00010019036169 27.792806332030857 23.514677887987176 45-49 20.544999999999998 28.185 27.529999999999998 23.74 50-54 20.07 28.98 27.36 23.59 55-59 19.97799119647859 28.23629451780712 28.256302521008404 23.52941176470588 60-64 20.13103931179354 28.68860658197459 27.59327798339502 23.58707612283685 65-69 20.419083816763354 28.695739147829563 28.020604120824167 22.86457291458292 70-74 20.41929229277751 28.611245758603975 27.59331071255453 23.376151236063986 75-79 20.666705249146364 27.987730771456683 27.84883384455119 23.496730134845766 80-84 20.663211339115716 28.226147662365136 27.46456526338058 23.646075735138567 85-89 20.697299476017736 28.0229746070133 27.690447400241837 23.589278516727127 90-94 20.520130032508128 28.197049262315577 27.646911727931982 23.63590897724431 95-99 20.929185837167434 28.305661132226444 27.40548109621924 23.359671934386878 100-104 20.824164832966595 28.510702140428084 27.850570114022805 22.814562912582517 105-109 20.365 28.54 27.41 23.685000000000002 110-114 20.99209920992099 28.63286328632863 27.39273927392739 22.98229822982298 115-119 21.090272568142034 28.66216554138535 26.971742935733932 23.275818954738682 120-124 21.314102564102562 28.345352564102566 27.30869391025641 23.03185096153846 125-129 20.585 28.860000000000003 26.985 23.57 130-134 21.255 28.26 27.11 23.375 135-139 21.44 28.384999999999998 26.72 23.455000000000002 140-144 21.245 28.455000000000002 27.16 23.14 145-149 21.705426356589147 28.24206051512878 26.106526631657918 23.945986496624155 150-151 21.0125 28.999999999999996 26.375 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 1.0 22 2.0 23 3.0 24 3.5 25 5.5 26 8.0 27 12.0 28 14.0 29 20.5 30 25.0 31 32.5 32 46.0 33 59.0 34 73.5 35 89.0 36 105.5 37 135.5 38 160.5 39 183.0 40 219.5 41 231.5 42 240.0 43 254.0 44 259.0 45 244.0 46 238.0 47 239.5 48 225.5 49 192.0 50 147.5 51 124.5 52 100.0 53 74.0 54 57.5 55 49.5 56 40.5 57 26.5 58 15.5 59 10.5 60 8.5 61 6.0 62 4.5 63 2.5 64 2.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.03 30-34 0.005 35-39 0.015 40-44 0.19 45-49 0.0 50-54 0.0 55-59 0.04 60-64 0.03 65-69 0.02 70-74 17.48 75-79 13.605 80-84 5.46 85-89 0.76 90-94 0.025 95-99 0.02 100-104 0.02 105-109 0.0 110-114 0.01 115-119 0.025 120-124 0.16 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42094662638469 98.725 2 0.4783484390735146 0.95 3 0.0755287009063444 0.22499999999999998 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 1.9875 0.0 0.0 0.0 0.0 112-113 2.225 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.5250000000000004 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.3625 0.0 0.0 0.0 0.0 126-127 4.9125 0.0 0.0 0.0 0.0 128-129 5.525 0.0 0.0 0.0 0.0 130-131 6.1375 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 7.112500000000001 0.0 0.0 0.0 0.0 136-137 7.65 0.0 0.0 0.0 0.0 138-139 8.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGT 10 0.007416892 141.0625 145 CTGGAAT 10 0.007416892 141.0625 1 >>END_MODULE SRR7230764 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230764_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.881 33.0 33.0 34.0 32.0 34.0 2 32.99275 34.0 33.0 34.0 32.0 34.0 3 32.90625 34.0 33.0 34.0 32.0 34.0 4 32.8775 34.0 33.0 34.0 32.0 34.0 5 32.87125 34.0 33.0 34.0 32.0 34.0 6 36.8565 38.0 38.0 38.0 36.0 38.0 7 36.90875 38.0 38.0 38.0 36.0 38.0 8 36.78425 38.0 38.0 38.0 36.0 38.0 9 36.785 38.0 38.0 38.0 36.0 38.0 10-14 36.84910000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.90875000000001 38.0 38.0 38.0 36.2 38.0 20-24 36.8624 38.0 38.0 38.0 36.6 38.0 25-29 36.8135 38.0 38.0 38.0 36.4 38.0 30-34 36.74115 38.0 38.0 38.0 36.0 38.0 35-39 36.4409 38.0 38.0 38.0 35.0 38.0 40-44 36.224450000000004 38.0 38.0 38.0 33.4 38.0 45-49 36.65650000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.625449999999994 38.0 38.0 38.0 35.6 38.0 55-59 36.0901 38.0 38.0 38.0 33.0 38.0 60-64 36.519999999999996 38.0 38.0 38.0 35.6 38.0 65-69 36.11235 38.0 38.0 38.0 34.0 38.0 70-74 36.0711 38.0 38.0 38.0 33.8 38.0 75-79 36.431 38.0 38.0 38.0 34.6 38.0 80-84 36.35505 38.0 38.0 38.0 34.2 38.0 85-89 36.29805 38.0 38.0 38.0 34.2 38.0 90-94 36.22775 38.0 38.0 38.0 34.0 38.0 95-99 35.6121 38.0 37.4 38.0 30.6 38.0 100-104 35.722249999999995 38.0 37.8 38.0 32.2 38.0 105-109 35.14925 38.0 36.4 38.0 28.2 38.0 110-114 35.45595 38.0 37.0 38.0 30.6 38.0 115-119 35.48015 38.0 37.0 38.0 30.8 38.0 120-124 35.230149999999995 38.0 36.8 38.0 29.8 38.0 125-129 34.8757 38.0 36.0 38.0 28.0 38.0 130-134 34.716049999999996 38.0 36.0 38.0 27.4 38.0 135-139 34.2903 38.0 35.6 38.0 24.4 38.0 140-144 33.671949999999995 38.0 34.2 38.0 20.6 38.0 145-149 32.7414 38.0 33.0 38.0 12.2 38.0 150-151 26.8365 34.5 15.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 7.0 4 5.0 5 3.0 6 2.0 7 2.0 8 2.0 9 2.0 10 3.0 11 1.0 12 6.0 13 3.0 14 5.0 15 8.0 16 5.0 17 4.0 18 6.0 19 9.0 20 8.0 21 8.0 22 10.0 23 11.0 24 16.0 25 18.0 26 30.0 27 35.0 28 25.0 29 46.0 30 62.0 31 73.0 32 83.0 33 108.0 34 142.0 35 275.0 36 535.0 37 2431.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.025 19.3 13.575000000000001 26.1 2 24.4 25.05 32.9 17.65 3 21.099999999999998 28.249999999999996 31.4 19.25 4 25.575 36.525 20.474999999999998 17.424999999999997 5 23.525 38.324999999999996 21.025 17.125 6 18.95 37.574999999999996 23.95 19.525000000000002 7 17.849999999999998 18.5 44.224999999999994 19.425 8 20.825 22.325 28.749999999999996 28.1 9 22.025 24.625 28.549999999999997 24.8 10-14 23.544999999999998 28.28 26.58 21.595 15-19 22.55 27.79 28.355000000000004 21.305 20-24 22.8 28.265 28.23 20.705000000000002 25-29 23.04 28.07 28.03 20.86 30-34 22.400000000000002 27.52 28.939999999999998 21.14 35-39 23.016905071521457 27.773331999599883 28.15344603381014 21.05631689506852 40-44 23.06230623062306 27.912791279127912 27.88278827882788 21.14211421142114 45-49 22.593389008351252 27.934190128519276 27.86918037705656 21.60324048607291 50-54 22.7 28.02 28.01 21.27 55-59 23.197302873245107 28.128616716147537 27.746188295677555 20.927892114929804 60-64 22.958443766564983 28.10921638245737 27.62414362154323 21.308196229434415 65-69 23.02402022756005 27.413400758533502 28.075853350189632 21.486725663716815 70-74 23.003629764065337 27.929017947166766 27.923976608187136 21.14337568058076 75-79 22.89614480724036 28.05140257012851 27.631381569078457 21.42107105355268 80-84 23.348171860151055 27.36957935277347 28.249887460611212 21.03236132646426 85-89 23.31 28.04 27.455000000000002 21.195 90-94 23.345 27.544999999999998 28.439999999999998 20.669999999999998 95-99 23.27 28.32 27.905 20.505000000000003 100-104 23.265 27.865000000000002 27.779999999999998 21.09 105-109 23.93 27.71 28.02 20.34 110-114 23.51 27.57 28.15 20.77 115-119 24.125 27.779999999999998 27.700000000000003 20.395 120-124 23.87 27.855 28.09 20.185 125-129 24.2 28.575 27.055 20.169999999999998 130-134 24.59 27.855 27.555000000000003 20.0 135-139 24.75747574757476 27.792779277927792 27.41774177417742 20.03200320032003 140-144 25.375075015003002 26.8003600720144 27.850570114022805 19.973994798959794 145-149 25.735000000000003 28.07 26.495 19.7 150-151 24.8125 27.787499999999998 27.5125 19.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 2.5 24 2.0 25 4.0 26 7.0 27 7.0 28 8.0 29 11.5 30 17.5 31 23.5 32 34.5 33 41.0 34 44.0 35 63.0 36 82.0 37 98.5 38 120.5 39 158.0 40 197.5 41 223.0 42 256.0 43 273.0 44 284.0 45 286.0 46 263.5 47 238.0 48 219.0 49 203.0 50 165.0 51 138.0 52 122.5 53 97.0 54 81.0 55 63.0 56 42.5 57 33.0 58 25.5 59 17.0 60 12.5 61 7.5 62 7.0 63 7.0 64 3.0 65 2.0 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.01 45-49 0.015 50-54 0.0 55-59 0.635 60-64 0.015 65-69 1.125 70-74 0.8200000000000001 75-79 0.005 80-84 0.034999999999999996 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.02 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34508816120908 98.6 2 0.6045340050377833 1.2 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8999999999999999 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.7000000000000002 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 4.0375 0.0 0.0 0.0 0.0 124-125 4.5125 0.0 0.0 0.0 0.0 126-127 5.074999999999999 0.0 0.0 0.0 0.0 128-129 5.675 0.0 0.0 0.0 0.0 130-131 6.2875 0.0 0.0 0.0 0.0 132-133 6.737500000000001 0.0 0.0 0.0 0.0 134-135 7.1875 0.0 0.0 0.0 0.0 136-137 7.75 0.0 0.0 0.0 0.0 138-139 8.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTAAA 10 0.006830828 145.0 7 >>END_MODULE Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000594 spots for SRR7230764.sra Written 1000594 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra Read 1000593 spots for SRR7230764.sra Written 1000593 spots for SRR7230764.sra SRR ids: ['SRR7230764.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8r7s1vos SRR7230764.sra spots: 20011861 blocks: [[1, 1000593], [1000594, 2001186], [2001187, 3001779], [3001780, 4002372], [4002373, 5002965], [5002966, 6003558], [6003559, 7004151], [7004152, 8004744], [8004745, 9005337], [9005338, 10005930], [10005931, 11006523], [11006524, 12007116], [12007117, 13007709], [13007710, 14008302], [14008303, 15008895], [15008896, 16009488], [16009489, 17010081], [17010082, 18010674], [18010675, 19011267], [19011268, 20011861]] SRR7230764 file size 6759662 SRR7230764 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230764 SRR7230764_1.fastq SRR7230764_2.fastq Input file: SRR7230764_1.fastq Paired file: SRR7230764_2.fastq trimmed: SRR7230764-trimmed-pair1.fastq, SRR7230764-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:09:27 2025 >> started Tue Feb 11 00:09:48 2025 >> done (21.771s) 20011861 read pairs processed; of these: 35238 ( 0.18%) short read pairs filtered out after trimming by size control 24748 ( 0.12%) empty read pairs filtered out after trimming by size control 19951875 (99.70%) read pairs available; of these: 9466685 (47.45%) trimmed read pairs available after processing 10485190 (52.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 5 0.00% 21 3 0.00% 22 8 0.00% 23 6 0.00% 24 9 0.00% 25 3 0.00% 26 6 0.00% 27 11 0.00% 28 8 0.00% 29 3 0.00% 30 10 0.00% 31 17 0.00% 32 8 0.00% 33 8 0.00% 34 17 0.00% 35 14 0.00% 36 14 0.00% 37 20 0.00% 38 17 0.00% 39 29 0.00% 40 26 0.00% 41 45 0.00% 42 31 0.00% 43 42 0.00% 44 46 0.00% 45 45 0.00% 46 55 0.00% 47 73 0.00% 48 76 0.00% 49 87 0.00% 50 109 0.00% 51 102 0.00% 52 136 0.00% 53 121 0.00% 54 156 0.00% 55 174 0.00% 56 185 0.00% 57 216 0.00% 58 246 0.00% 59 292 0.00% 60 343 0.00% 61 374 0.00% 62 401 0.00% 63 473 0.00% 64 550 0.00% 65 605 0.00% 66 659 0.00% 67 783 0.00% 68 930 0.00% 69 1559 0.01% 70 1735 0.01% 71 1395 0.01% 72 1394 0.01% 73 1597 0.01% 74 1721 0.01% 75 1979 0.01% 76 2149 0.01% 77 2508 0.01% 78 2815 0.01% 79 3022 0.02% 80 3342 0.02% 81 3833 0.02% 82 4914 0.02% 83 5075 0.03% 84 7115 0.04% 85 8235 0.04% 86 8603 0.04% 87 9231 0.05% 88 10165 0.05% 89 10370 0.05% 90 11131 0.06% 91 11791 0.06% 92 12673 0.06% 93 13552 0.07% 94 14533 0.07% 95 15386 0.08% 96 16472 0.08% 97 17686 0.09% 98 18652 0.09% 99 19635 0.10% 100 20735 0.10% 101 21866 0.11% 102 23552 0.12% 103 24530 0.12% 104 26026 0.13% 105 27424 0.14% 106 28901 0.14% 107 30319 0.15% 108 31000 0.16% 109 33206 0.17% 110 34848 0.17% 111 36431 0.18% 112 37768 0.19% 113 39404 0.20% 114 41012 0.21% 115 42679 0.21% 116 44584 0.22% 117 46318 0.23% 118 48231 0.24% 119 49903 0.25% 120 51358 0.26% 121 53818 0.27% 122 55203 0.28% 123 57955 0.29% 124 59396 0.30% 125 61419 0.31% 126 64038 0.32% 127 66032 0.33% 128 68521 0.34% 129 70922 0.36% 130 73579 0.37% 131 75761 0.38% 132 79061 0.40% 133 83110 0.42% 134 86442 0.43% 135 89768 0.45% 136 93144 0.47% 137 98837 0.50% 138 103603 0.52% 139 108240 0.54% 140 115390 0.58% 141 123193 0.62% 142 134116 0.67% 143 146318 0.73% 144 165507 0.83% 145 189253 0.95% 146 228930 1.15% 147 296043 1.48% 148 425948 2.13% 149 802984 4.02% 150 4398182 22.04% 151 10485190 52.55% 19951875 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=18 prefix-density=0.54 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=296.04 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=7 prefix-density=0.54 prefix-fanout=2.6 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=38.40 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.4 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7230764 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:10:33 Started mapping on | Feb 11 00:10:33 Finished on | Feb 11 00:12:54 Mapping speed, Million of reads per hour | 509.41 Number of input reads | 19951875 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18675651 Uniquely mapped reads % | 93.60% Average mapped length | 292.28 Number of splices: Total | 17930642 Number of splices: Annotated (sjdb) | 17523542 Number of splices: GT/AG | 17584683 Number of splices: GC/AG | 284995 Number of splices: AT/AC | 9974 Number of splices: Non-canonical | 50990 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 491499 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 26347 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 820261 820261 820261 N_multimapping 491499 491499 491499 N_noFeature 714060 18343514 851738 N_ambiguous 338862 1341 143465 UnstrandedReadsAssigned:17622729 PositiveStrandReadsAssigned:330796 NegativeStrandReadsAssigned:17680448 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230764 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230764-trimmed-pair1.fastq SRR7230764-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,951,875 reads, 17,631,624 reads pseudoaligned [quant] estimated average fragment length: 231.278 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR7230764.ke.tsv 34699 SRR7230764.se.tsv 87100 total ==> SRR7230764.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.72 1415 42.5569 Potri.005G024800.1.v4.1 1035 804.722 105 7.01547 Potri.004G059700.1.v4.1 961 730.765 28 2.06012 Potri.007G009000.2.v4.1 1416 1185.72 0 0 Potri.003G141000.2.v4.1 2943 2712.72 836.133 16.5723 Potri.016G087400.1.v4.1 270 86.6761 735 455.933 Potri.015G069301.1.v4.1 564 338.62 0 0 Potri.010G195200.1.v4.1 1773 1542.72 60 2.09111 Potri.012G127500.1.v4.1 977 746.733 83 5.97621 ==> SRR7230764.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 932 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 383 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 113 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7230764 completed mapping pipeline successfully