Starting /dee2/code/volunteer_pipeline.sh SRR7230767 current disk space = 3057701453824 free memory = 1013637024 SRR7230767 SRAfilesize 31f92bd09ae7cef2c26f619eb36126ae SRR7230767.sra SRR7230767.sra file validated SRR7230767 is paired end SRR7230767 is conventional basespace SRR7230767 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230767_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.55175 34.0 34.0 34.0 33.0 34.0 2 33.54475 34.0 34.0 34.0 33.0 34.0 3 33.62 34.0 34.0 34.0 33.0 34.0 4 33.58525 34.0 34.0 34.0 33.0 34.0 5 33.5555 34.0 34.0 34.0 33.0 34.0 6 37.31175 38.0 38.0 38.0 36.0 38.0 7 37.43675 38.0 38.0 38.0 37.0 38.0 8 37.54525 38.0 38.0 38.0 38.0 38.0 9 37.552 38.0 38.0 38.0 38.0 38.0 10-14 37.49215 38.0 38.0 38.0 38.0 38.0 15-19 37.4914 38.0 38.0 38.0 38.0 38.0 20-24 37.36385 38.0 38.0 38.0 37.4 38.0 25-29 37.18865000000001 38.0 38.0 38.0 36.8 38.0 30-34 37.0815 38.0 38.0 38.0 36.6 38.0 35-39 37.000800000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.827 38.0 38.0 38.0 35.8 38.0 45-49 36.7954 38.0 37.8 38.0 35.0 38.0 50-54 36.93475 38.0 38.0 38.0 35.8 38.0 55-59 37.08675000000001 38.0 38.0 38.0 36.4 38.0 60-64 37.047000000000004 38.0 38.0 38.0 36.2 38.0 65-69 37.069399999999995 38.0 38.0 38.0 36.4 38.0 70-74 33.56044999999999 38.0 36.2 38.0 15.6 38.0 75-79 34.222500000000004 38.0 37.6 38.0 26.4 38.0 80-84 35.93915 38.0 38.0 38.0 32.4 38.0 85-89 36.8096 38.0 38.0 38.0 35.8 38.0 90-94 36.81935 38.0 38.0 38.0 36.0 38.0 95-99 36.79845 38.0 38.0 38.0 36.0 38.0 100-104 36.5598 38.0 38.0 38.0 35.0 38.0 105-109 36.5384 38.0 38.0 38.0 34.8 38.0 110-114 36.29780000000001 38.0 37.8 38.0 33.4 38.0 115-119 35.50355 38.0 36.8 38.0 30.0 38.0 120-124 35.7988 38.0 37.2 38.0 32.2 38.0 125-129 35.3445 38.0 36.4 38.0 30.2 38.0 130-134 35.030350000000006 38.0 35.6 38.0 28.8 38.0 135-139 35.38100000000001 38.0 36.0 38.0 31.2 38.0 140-144 34.7644 38.0 35.4 38.0 28.4 38.0 145-149 34.3122 38.0 34.8 38.0 27.4 38.0 150-151 30.62675 35.5 29.0 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 5.0 14 3.0 15 0.0 16 5.0 17 2.0 18 10.0 19 6.0 20 6.0 21 6.0 22 5.0 23 12.0 24 7.0 25 11.0 26 10.0 27 11.0 28 16.0 29 39.0 30 29.0 31 56.0 32 80.0 33 125.0 34 219.0 35 336.0 36 777.0 37 2219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.4 14.325 11.25 35.025 2 21.224999999999998 20.45 33.074999999999996 25.25 3 18.075 26.5 26.275 29.15 4 23.200000000000003 31.724999999999998 22.275 22.8 5 22.375 36.75 21.75 19.125 6 16.925 36.825 25.900000000000002 20.349999999999998 7 13.4 24.099999999999998 44.45 18.05 8 17.925 22.425 32.074999999999996 27.575 9 16.975 23.225 33.925 25.874999999999996 10-14 19.55 30.049999999999997 26.740000000000002 23.66 15-19 19.622943441516227 29.55943391508726 27.229084362654397 23.58853828074211 20-24 19.314999999999998 29.09 27.534999999999997 24.060000000000002 25-29 18.985 29.845 27.1 24.07 30-34 19.805 29.439999999999998 27.08 23.674999999999997 35-39 20.072133446876723 29.078795772178527 27.24540399739518 23.603666783549567 40-44 20.132510164131908 29.854941524870753 26.82326958791347 23.189278723083874 45-49 20.10807024565968 28.71366388152299 26.96752889378096 24.210736979036373 50-54 20.095 29.580000000000002 26.779999999999998 23.544999999999998 55-59 20.27 28.439999999999998 27.27 24.02 60-64 19.939999999999998 28.365000000000002 27.750000000000004 23.945 65-69 20.169999999999998 28.915000000000003 26.900000000000002 24.015 70-74 20.26298415492958 29.005281690140844 27.31073943661972 23.42099471830986 75-79 19.632988141868328 28.47024735740731 27.740516177496378 24.156248323227988 80-84 19.70060798038114 28.07949726664282 27.23649925918357 24.983395493792468 85-89 20.21063189568706 28.671013039117355 26.955867602808425 24.162487462387162 90-94 20.11 27.88 27.73 24.279999999999998 95-99 20.65 27.779999999999998 27.215 24.355 100-104 20.794999999999998 28.444999999999997 26.685 24.075 105-109 20.765 28.15 26.63 24.455 110-114 20.905 28.455000000000002 26.72 23.919999999999998 115-119 20.82 28.09 27.075 24.015 120-124 20.78 28.765 25.985000000000003 24.47 125-129 21.36 27.575 26.540000000000003 24.525 130-134 21.005 28.425 26.875 23.695 135-139 21.61 27.6 26.505000000000003 24.285 140-144 21.57 28.275 25.845000000000002 24.310000000000002 145-149 21.345 27.74 25.729999999999997 25.185000000000002 150-151 21.125 28.925 25.7375 24.212500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 2.0 2 2.5 3 1.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 2.0 19 1.5 20 0.5 21 1.5 22 2.0 23 3.0 24 5.0 25 7.5 26 11.0 27 11.5 28 15.5 29 20.5 30 31.0 31 46.5 32 57.5 33 70.5 34 90.0 35 107.0 36 130.5 37 150.5 38 157.5 39 155.0 40 158.0 41 187.5 42 201.0 43 194.0 44 196.5 45 214.0 46 218.0 47 212.5 48 199.5 49 171.5 50 154.5 51 136.0 52 124.5 53 118.0 54 105.0 55 84.5 56 56.0 57 50.0 58 42.0 59 25.0 60 18.5 61 14.5 62 12.0 63 7.5 64 3.0 65 1.5 66 1.0 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.015 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.185 40-44 0.385 45-49 0.065 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 9.120000000000001 75-79 6.815 80-84 2.1350000000000002 85-89 0.3 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.38364779874213 91.95 2 2.908805031446541 5.55 3 0.39308176100628933 1.125 4 0.18343815513626835 0.7000000000000001 5 0.07861635220125787 0.375 6 0.052410901467505246 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGC 6 0.15 TruSeq Adapter, Index 1 (97% over 37bp) CGGGAACGTATTCACCGTGGCATTCTGATCCACGATTACTAGCGATTCCG 5 0.125 No Hit CACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCC 5 0.125 No Hit CAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.8375 0.0 0.0 0.0 0.0 110-111 3.25 0.0 0.0 0.0 0.0 112-113 3.5250000000000004 0.0 0.0 0.0 0.0 114-115 3.825 0.0 0.0 0.0 0.0 116-117 4.0625 0.0 0.0 0.0 0.0 118-119 4.6375 0.0 0.0 0.0 0.0 120-121 5.225 0.0 0.0 0.0 0.0 122-123 5.825 0.0 0.0 0.0 0.0 124-125 6.375 0.0 0.0 0.0 0.0 126-127 7.025 0.0 0.0 0.0 0.0 128-129 7.6875 0.0 0.0 0.0 0.0 130-131 8.425 0.0 0.0 0.0 0.0 132-133 9.2375 0.0 0.0 0.0 0.0 134-135 9.8125 0.0 0.0 0.0 0.0 136-137 10.425 0.0 0.0 0.0 0.0 138-139 11.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCCGT 10 0.007129785 142.9375 145 >>END_MODULE SRR7230767 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230767_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06625 34.0 33.0 34.0 33.0 34.0 2 33.22675 34.0 33.0 34.0 33.0 34.0 3 33.209 34.0 33.0 34.0 33.0 34.0 4 33.194 34.0 33.0 34.0 33.0 34.0 5 33.226 34.0 33.0 34.0 33.0 34.0 6 37.30975 38.0 38.0 38.0 38.0 38.0 7 37.299 38.0 38.0 38.0 38.0 38.0 8 37.2915 38.0 38.0 38.0 38.0 38.0 9 37.241 38.0 38.0 38.0 38.0 38.0 10-14 37.078250000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.257549999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.275349999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.295049999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.29495 38.0 38.0 38.0 38.0 38.0 35-39 37.10575 38.0 38.0 38.0 37.2 38.0 40-44 37.14255 38.0 38.0 38.0 37.4 38.0 45-49 37.073899999999995 38.0 38.0 38.0 37.2 38.0 50-54 37.1513 38.0 38.0 38.0 37.8 38.0 55-59 36.94745 38.0 38.0 38.0 36.8 38.0 60-64 37.1543 38.0 38.0 38.0 37.6 38.0 65-69 37.074349999999995 38.0 38.0 38.0 37.2 38.0 70-74 36.91610000000001 38.0 38.0 38.0 37.0 38.0 75-79 36.95275 38.0 38.0 38.0 37.0 38.0 80-84 36.92535 38.0 38.0 38.0 37.0 38.0 85-89 36.9047 38.0 38.0 38.0 37.0 38.0 90-94 36.81805000000001 38.0 38.0 38.0 36.6 38.0 95-99 36.70185 38.0 38.0 38.0 36.0 38.0 100-104 36.63835 38.0 38.0 38.0 36.0 38.0 105-109 36.476099999999995 38.0 38.0 38.0 35.2 38.0 110-114 36.369749999999996 38.0 38.0 38.0 34.8 38.0 115-119 36.29944999999999 38.0 38.0 38.0 34.4 38.0 120-124 36.0248 38.0 38.0 38.0 34.0 38.0 125-129 35.93445 38.0 38.0 38.0 33.8 38.0 130-134 35.648199999999996 38.0 37.8 38.0 33.0 38.0 135-139 35.45165 38.0 37.6 38.0 31.2 38.0 140-144 34.7933 38.0 36.0 38.0 29.6 38.0 145-149 33.407300000000006 38.0 34.4 38.0 19.8 38.0 150-151 28.619125 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 3.0 5 1.0 6 4.0 7 3.0 8 1.0 9 1.0 10 3.0 11 3.0 12 2.0 13 7.0 14 1.0 15 5.0 16 3.0 17 5.0 18 3.0 19 4.0 20 4.0 21 6.0 22 3.0 23 5.0 24 6.0 25 15.0 26 15.0 27 16.0 28 25.0 29 18.0 30 37.0 31 29.0 32 52.0 33 75.0 34 112.0 35 182.0 36 421.0 37 2921.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.710163111668756 19.372647427854453 14.153074027603513 23.764115432873275 2 27.275 23.799999999999997 30.975 17.95 3 22.925 27.800000000000004 29.375 19.900000000000002 4 26.35 34.025 21.675 17.95 5 25.074999999999996 35.625 21.625 17.675 6 20.474999999999998 36.7 23.400000000000002 19.425 7 20.5 19.425 39.525 20.549999999999997 8 22.55 23.5 27.250000000000004 26.700000000000003 9 23.325000000000003 23.875 27.275 25.525 10-14 24.645 28.804999999999996 25.165 21.385 15-19 24.709999999999997 26.97 27.405 20.915 20-24 25.045 27.339999999999996 26.77 20.845 25-29 24.04 28.084999999999997 26.86 21.015 30-34 24.445 27.82 27.229999999999997 20.505000000000003 35-39 24.310000000000002 27.589999999999996 26.790000000000003 21.310000000000002 40-44 25.15 27.575 26.974999999999998 20.3 45-49 24.548139988985128 27.33189806238422 27.071546587893657 21.048415360736993 50-54 23.688426111333598 27.182619142971564 27.873448137765315 21.255506607929515 55-59 23.964126459241445 27.92224059321609 27.305977253369406 20.807655694173054 60-64 24.62 27.32 27.045 21.015 65-69 24.540767806196506 27.54392111717303 27.739126082386505 20.176184994243958 70-74 24.625106575053916 26.761622949997495 27.854957620743264 20.758312854205325 75-79 24.310000000000002 27.92 27.365000000000002 20.405 80-84 24.25 27.46 27.650000000000002 20.64 85-89 24.89 27.105 27.544999999999998 20.46 90-94 24.215 27.644999999999996 27.74 20.4 95-99 24.66 27.705000000000002 27.134999999999998 20.5 100-104 24.495 27.935 26.919999999999998 20.65 105-109 24.66 27.689999999999998 27.279999999999998 20.369999999999997 110-114 24.26 27.73 27.83 20.18 115-119 25.155 27.889999999999997 27.99 18.965 120-124 24.715 27.66 27.505000000000003 20.119999999999997 125-129 24.555 28.01 27.79 19.645000000000003 130-134 25.779999999999998 27.41 26.875 19.935 135-139 26.145000000000003 27.310000000000002 26.91 19.634999999999998 140-144 26.115 27.22 26.875 19.79 145-149 26.355 27.955000000000002 26.479999999999997 19.21 150-151 27.1625 28.287499999999998 25.724999999999998 18.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 0.0 25 1.5 26 2.5 27 2.5 28 6.0 29 8.5 30 11.0 31 19.5 32 24.0 33 28.0 34 44.5 35 63.0 36 78.5 37 106.0 38 131.5 39 140.5 40 160.5 41 181.0 42 211.0 43 244.0 44 245.0 45 238.0 46 237.5 47 230.5 48 219.0 49 203.0 50 180.5 51 153.0 52 142.0 53 145.5 54 144.0 55 109.5 56 68.0 57 51.5 58 38.5 59 34.0 60 22.5 61 19.0 62 20.0 63 12.0 64 5.0 65 1.0 66 0.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.135 50-54 0.12 55-59 0.20500000000000002 60-64 0.0 65-69 0.105 70-74 0.305 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 96.23627809722947 92.05 2 3.2671197072660743 6.25 3 0.39205436487192885 1.125 4 0.026136957658128592 0.1 5 0.026136957658128592 0.125 6 0.026136957658128592 0.15 7 0.0 0.0 8 0.026136957658128592 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 8 0.2 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.4874999999999998 0.0 0.0 0.0 0.0 100-101 1.6124999999999998 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.5875 0.0 0.0 0.0 0.0 108-109 3.0375 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 3.7750000000000004 0.0 0.0 0.0 0.0 114-115 4.0875 0.0 0.0 0.0 0.0 116-117 4.375 0.0 0.0 0.0 0.0 118-119 4.9125 0.0 0.0 0.0 0.0 120-121 5.525 0.0 0.0 0.0 0.0 122-123 6.175000000000001 0.0 0.0 0.0 0.0 124-125 6.6875 0.0 0.0 0.0 0.0 126-127 7.3375 0.0 0.0 0.0 0.0 128-129 7.9750000000000005 0.0 0.0 0.0 0.0 130-131 8.7 0.0 0.0 0.0 0.0 132-133 9.524999999999999 0.0 0.0 0.0 0.0 134-135 10.1125 0.0 0.0 0.0 0.0 136-137 10.675 0.0 0.0 0.0 0.0 138-139 11.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGATTT 10 0.0068892627 144.5875 3 >>END_MODULE Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572134 spots for SRR7230767.sra Written 572134 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra Read 572119 spots for SRR7230767.sra Written 572119 spots for SRR7230767.sra SRR ids: ['SRR7230767.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bjcfuv8w SRR7230767.sra spots: 11442395 blocks: [[1, 572119], [572120, 1144238], [1144239, 1716357], [1716358, 2288476], [2288477, 2860595], [2860596, 3432714], [3432715, 4004833], [4004834, 4576952], [4576953, 5149071], [5149072, 5721190], [5721191, 6293309], [6293310, 6865428], [6865429, 7437547], [7437548, 8009666], [8009667, 8581785], [8581786, 9153904], [9153905, 9726023], [9726024, 10298142], [10298143, 10870261], [10870262, 11442395]] SRR7230767 file size 3855751 SRR7230767 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230767 SRR7230767_1.fastq SRR7230767_2.fastq Input file: SRR7230767_1.fastq Paired file: SRR7230767_2.fastq trimmed: SRR7230767-trimmed-pair1.fastq, SRR7230767-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:29:17 2025 >> started Mon Feb 10 23:29:29 2025 >> done (11.854s) 11442395 read pairs processed; of these: 17109 ( 0.15%) short read pairs filtered out after trimming by size control 29835 ( 0.26%) empty read pairs filtered out after trimming by size control 11395451 (99.59%) read pairs available; of these: 5373215 (47.15%) trimmed read pairs available after processing 6022236 (52.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 3 0.00% 21 6 0.00% 22 10 0.00% 23 12 0.00% 24 8 0.00% 25 4 0.00% 26 12 0.00% 27 14 0.00% 28 10 0.00% 29 10 0.00% 30 13 0.00% 31 11 0.00% 32 21 0.00% 33 16 0.00% 34 23 0.00% 35 35 0.00% 36 20 0.00% 37 23 0.00% 38 24 0.00% 39 25 0.00% 40 28 0.00% 41 30 0.00% 42 51 0.00% 43 36 0.00% 44 51 0.00% 45 58 0.00% 46 75 0.00% 47 70 0.00% 48 76 0.00% 49 99 0.00% 50 115 0.00% 51 112 0.00% 52 139 0.00% 53 118 0.00% 54 164 0.00% 55 150 0.00% 56 181 0.00% 57 241 0.00% 58 276 0.00% 59 294 0.00% 60 304 0.00% 61 322 0.00% 62 407 0.00% 63 443 0.00% 64 490 0.00% 65 606 0.01% 66 744 0.01% 67 946 0.01% 68 1597 0.01% 69 6883 0.06% 70 8463 0.07% 71 3107 0.03% 72 1809 0.02% 73 1756 0.02% 74 1739 0.02% 75 1879 0.02% 76 1955 0.02% 77 2044 0.02% 78 2363 0.02% 79 2728 0.02% 80 2994 0.03% 81 3278 0.03% 82 3622 0.03% 83 4164 0.04% 84 5779 0.05% 85 6294 0.06% 86 7208 0.06% 87 7426 0.07% 88 8180 0.07% 89 8616 0.08% 90 9080 0.08% 91 9540 0.08% 92 9963 0.09% 93 11221 0.10% 94 11409 0.10% 95 12473 0.11% 96 13126 0.12% 97 13811 0.12% 98 14089 0.12% 99 15591 0.14% 100 16541 0.15% 101 16896 0.15% 102 17691 0.16% 103 19047 0.17% 104 20808 0.18% 105 22583 0.20% 106 22308 0.20% 107 22562 0.20% 108 24332 0.21% 109 26999 0.24% 110 27443 0.24% 111 27509 0.24% 112 28300 0.25% 113 30991 0.27% 114 31169 0.27% 115 32788 0.29% 116 33313 0.29% 117 33198 0.29% 118 34722 0.30% 119 36067 0.32% 120 37597 0.33% 121 38308 0.34% 122 39944 0.35% 123 41298 0.36% 124 42851 0.38% 125 43265 0.38% 126 44568 0.39% 127 45443 0.40% 128 46402 0.41% 129 47899 0.42% 130 49617 0.44% 131 50699 0.44% 132 52509 0.46% 133 54760 0.48% 134 56756 0.50% 135 58641 0.51% 136 59855 0.53% 137 62731 0.55% 138 64291 0.56% 139 66352 0.58% 140 67876 0.60% 141 73218 0.64% 142 75680 0.66% 143 81033 0.71% 144 88916 0.78% 145 98520 0.86% 146 114563 1.01% 147 141500 1.24% 148 192879 1.69% 149 359756 3.16% 150 2329098 20.44% 151 6022236 52.85% 11395451 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=46 prefix-density=0.21 prefix-fanout=2.0 sequence=GTACAGCCTTCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=98.36 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=7.3 sequence=CTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTAC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=29 prefix-density=0.91 prefix-fanout=2.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=45.69 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.6 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT SRR7230767 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:30:44 Started mapping on | Feb 10 23:30:44 Finished on | Feb 10 23:33:51 Mapping speed, Million of reads per hour | 219.38 Number of input reads | 11395451 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 9263289 Uniquely mapped reads % | 81.29% Average mapped length | 291.12 Number of splices: Total | 7289901 Number of splices: Annotated (sjdb) | 7118741 Number of splices: GT/AG | 7139188 Number of splices: GC/AG | 122325 Number of splices: AT/AC | 4627 Number of splices: Non-canonical | 23761 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.67 Insertion rate per base | 0.03% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 301523 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 196869 % of reads mapped to too many loci | 1.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.93% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1846680 1846680 1846680 N_multimapping 301523 301523 301523 N_noFeature 316832 8996052 398030 N_ambiguous 255313 871 68842 UnstrandedReadsAssigned:8691144 PositiveStrandReadsAssigned:266366 NegativeStrandReadsAssigned:8796417 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7230767 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230767-trimmed-pair1.fastq SRR7230767-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,395,451 reads, 8,905,560 reads pseudoaligned [quant] estimated average fragment length: 214.031 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 SRR7230767.ke.tsv 34699 SRR7230767.se.tsv 87100 total ==> SRR7230767.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.97 607 28.6457 Potri.005G024800.1.v4.1 1035 821.969 168 17.4098 Potri.004G059700.1.v4.1 961 747.98 8 0.911048 Potri.007G009000.2.v4.1 1416 1202.97 0 0 Potri.003G141000.2.v4.1 2943 2729.97 408 12.7304 Potri.016G087400.1.v4.1 270 90.4702 378.258 356.142 Potri.015G069301.1.v4.1 564 353.203 0 0 Potri.010G195200.1.v4.1 1773 1559.97 76 4.14991 Potri.012G127500.1.v4.1 977 763.98 70 7.80472 ==> SRR7230767.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1016 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 0 SRR7230767 completed mapping pipeline successfully