Starting /dee2/code/volunteer_pipeline.sh SRR7230768 current disk space = 3057545056256 free memory = 1142518936 SRR7230768 SRAfilesize f7c4bab0d7b0cee6bec19e42c74839f3 SRR7230768.sra SRR7230768.sra file validated SRR7230768 is paired end SRR7230768 is conventional basespace SRR7230768 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230768_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.49225 34.0 34.0 34.0 33.0 34.0 2 33.54775 34.0 34.0 34.0 33.0 34.0 3 33.60675 34.0 34.0 34.0 33.0 34.0 4 33.508 34.0 34.0 34.0 33.0 34.0 5 33.52075 34.0 34.0 34.0 33.0 34.0 6 37.298 38.0 38.0 38.0 36.0 38.0 7 37.36175 38.0 38.0 38.0 37.0 38.0 8 37.41425 38.0 38.0 38.0 37.0 38.0 9 37.4515 38.0 38.0 38.0 38.0 38.0 10-14 37.415499999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.417199999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.272149999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.03775 38.0 38.0 38.0 36.4 38.0 30-34 36.939550000000004 38.0 38.0 38.0 35.8 38.0 35-39 36.8581 38.0 38.0 38.0 35.8 38.0 40-44 36.583099999999995 38.0 38.0 38.0 34.6 38.0 45-49 36.6083 38.0 37.8 38.0 34.2 38.0 50-54 36.83415000000001 38.0 38.0 38.0 35.6 38.0 55-59 36.9491 38.0 38.0 38.0 35.8 38.0 60-64 36.96455 38.0 38.0 38.0 36.0 38.0 65-69 36.931349999999995 38.0 38.0 38.0 36.0 38.0 70-74 33.26065 38.0 35.2 38.0 15.4 38.0 75-79 33.8762 38.0 36.8 38.0 21.8 38.0 80-84 35.62435 38.0 38.0 38.0 30.4 38.0 85-89 36.4088 38.0 38.0 38.0 35.0 38.0 90-94 36.413650000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.3973 38.0 38.0 38.0 35.0 38.0 100-104 36.251400000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.2139 38.0 38.0 38.0 34.0 38.0 110-114 35.981399999999994 38.0 37.8 38.0 33.4 38.0 115-119 35.1275 38.0 36.2 38.0 28.8 38.0 120-124 35.319199999999995 38.0 36.6 38.0 30.4 38.0 125-129 34.983349999999994 38.0 36.0 38.0 28.6 38.0 130-134 34.6 38.0 35.2 38.0 25.4 38.0 135-139 34.92245 38.0 36.0 38.0 28.4 38.0 140-144 34.14135 38.0 35.2 38.0 24.0 38.0 145-149 33.69615 38.0 33.0 38.0 24.0 38.0 150-151 30.2325 35.5 28.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 1.0 6 1.0 7 1.0 8 0.0 9 2.0 10 2.0 11 1.0 12 6.0 13 3.0 14 1.0 15 6.0 16 6.0 17 2.0 18 17.0 19 11.0 20 7.0 21 3.0 22 11.0 23 10.0 24 13.0 25 16.0 26 18.0 27 15.0 28 19.0 29 34.0 30 50.0 31 57.0 32 74.0 33 115.0 34 238.0 35 380.0 36 781.0 37 2098.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.05 13.950000000000001 11.924999999999999 31.075000000000003 2 20.575 18.375 33.575 27.474999999999998 3 20.125 24.099999999999998 27.375 28.4 4 23.375 30.85 22.675 23.1 5 22.15 33.300000000000004 24.7 19.85 6 18.45 32.75 27.85 20.95 7 14.325 23.325000000000003 43.15 19.2 8 17.65 24.0 30.025000000000002 28.325 9 16.875 24.95 31.75 26.424999999999997 10-14 20.13 29.310000000000002 26.11 24.45 15-19 20.05700570057006 28.437843784378437 27.16271627162716 24.342434243424343 20-24 20.005 28.58 26.97 24.445 25-29 20.485 28.355000000000004 27.11 24.05 30-34 20.32 28.7 26.795 24.185000000000002 35-39 20.044085967636892 27.904413606532742 27.062772406192074 24.988728019638295 40-44 20.560184720409598 27.86366830639494 27.627748218050396 23.948398755145064 45-49 20.482289373624173 28.046828096858118 26.861116670002 24.609765859515708 50-54 20.935000000000002 27.3 27.185 24.58 55-59 20.015 27.985 27.375 24.625 60-64 20.625 27.46 27.625 24.29 65-69 19.99 28.050000000000004 27.29 24.67 70-74 20.383467786495746 28.53353961763731 26.748812023428002 24.334180572438942 75-79 20.48982222460927 27.92308931736398 26.74687147537462 24.84021698265213 80-84 20.180907604251843 28.28597710547833 27.074816026165166 24.45829926410466 85-89 20.601073704279766 27.760774672620542 26.45627414580302 25.18187747729667 90-94 20.495 27.115000000000002 27.505000000000003 24.884999999999998 95-99 20.645 27.91 26.72 24.725 100-104 20.57 28.044999999999998 26.245 25.14 105-109 20.855 27.6 26.939999999999998 24.605 110-114 21.495 27.92 26.085 24.5 115-119 20.935000000000002 28.105000000000004 26.525 24.435000000000002 120-124 21.365000000000002 27.295 25.81 25.53 125-129 21.925 27.125 25.915 25.035 130-134 21.455 28.044999999999998 26.045 24.455 135-139 21.865000000000002 27.83 25.674999999999997 24.63 140-144 21.58 27.785 25.715 24.92 145-149 21.895 27.589999999999996 25.124999999999996 25.39 150-151 21.675 27.650000000000002 25.624999999999996 25.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.0 2 1.0 3 1.0 4 0.5 5 0.0 6 0.5 7 1.0 8 1.0 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 2.5 24 3.0 25 6.5 26 9.0 27 8.0 28 13.5 29 20.5 30 23.5 31 34.0 32 46.5 33 61.5 34 80.0 35 90.0 36 98.0 37 108.0 38 128.5 39 149.5 40 174.5 41 191.5 42 184.5 43 191.0 44 206.5 45 203.5 46 210.5 47 226.5 48 208.0 49 179.0 50 159.5 51 141.0 52 134.0 53 133.0 54 130.0 55 110.5 56 70.5 57 51.0 58 50.5 59 43.0 60 25.5 61 18.0 62 19.0 63 12.0 64 4.0 65 2.0 66 4.0 67 4.0 68 2.5 69 2.0 70 3.0 71 3.5 72 2.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.19499999999999998 40-44 0.38999999999999996 45-49 0.06 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 9.51 75-79 6.905 80-84 2.16 85-89 0.345 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.025 #Duplication Level Percentage of deduplicated Percentage of total 1 96.42199421204946 91.625 2 2.788739805314391 5.3 3 0.3946329913180742 1.125 4 0.2104709287029729 0.8 5 0.10523546435148645 0.5 6 0.052617732175743226 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026308866087871613 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCATCATCTCGTATGC 14 0.35000000000000003 TruSeq Adapter, Index 1 (97% over 37bp) GTCGGTTCGGTCCTCCAGTTAGTGTTACCCAACCTTCAACCTGCCCATGG 6 0.15 No Hit GGCCAACATAGCCTTCTCCGTCCCCCCTTCGCAGTAACACCAAGTACAGG 6 0.15 No Hit GTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGA 5 0.125 No Hit GGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCA 5 0.125 No Hit GCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCATCAGGCAGTTT 5 0.125 No Hit CCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3875 0.0 0.0 0.0 0.0 102-103 1.7374999999999998 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.775 0.0 0.0 0.0 0.0 110-111 3.0999999999999996 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.9625000000000004 0.0 0.0 0.0 0.0 116-117 4.574999999999999 0.0 0.0 0.0 0.0 118-119 5.050000000000001 0.0 0.0 0.0 0.0 120-121 5.6 0.0 0.0 0.0 0.0 122-123 6.199999999999999 0.0 0.0 0.0 0.0 124-125 6.8375 0.0 0.0 0.0 0.0 126-127 7.3125 0.0 0.0 0.0 0.0 128-129 8.075 0.0 0.0 0.0 0.0 130-131 8.775 0.0 0.0 0.0 0.0 132-133 9.35 0.0 0.0 0.0 0.0 134-135 10.1875 0.0 0.0 0.0 0.0 136-137 10.825 0.0 0.0 0.0 0.0 138-139 11.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTCAT 10 0.007139113 142.875 4 >>END_MODULE SRR7230768 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230768_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66275 34.0 33.0 34.0 32.0 34.0 2 32.83125 34.0 33.0 34.0 32.0 34.0 3 32.71375 34.0 33.0 34.0 32.0 34.0 4 32.5775 34.0 33.0 34.0 32.0 34.0 5 32.6225 34.0 33.0 34.0 32.0 34.0 6 36.5615 38.0 38.0 38.0 36.0 38.0 7 36.424 38.0 38.0 38.0 35.0 38.0 8 36.4885 38.0 38.0 38.0 36.0 38.0 9 36.4495 38.0 38.0 38.0 36.0 38.0 10-14 36.1711 38.0 38.0 38.0 33.8 38.0 15-19 36.42125 38.0 38.0 38.0 36.0 38.0 20-24 36.4159 38.0 38.0 38.0 36.2 38.0 25-29 36.4156 38.0 38.0 38.0 36.2 38.0 30-34 36.376 38.0 38.0 38.0 36.0 38.0 35-39 36.189800000000005 38.0 38.0 38.0 35.2 38.0 40-44 36.1931 38.0 38.0 38.0 35.6 38.0 45-49 36.1118 38.0 38.0 38.0 35.0 38.0 50-54 36.19495 38.0 38.0 38.0 35.6 38.0 55-59 35.9769 38.0 38.0 38.0 34.8 38.0 60-64 36.17725 38.0 38.0 38.0 35.6 38.0 65-69 35.9864 38.0 38.0 38.0 34.8 38.0 70-74 35.715199999999996 38.0 38.0 38.0 34.2 38.0 75-79 35.8063 38.0 38.0 38.0 34.4 38.0 80-84 35.7702 38.0 38.0 38.0 34.2 38.0 85-89 35.68335 38.0 38.0 38.0 34.0 38.0 90-94 35.6002 38.0 38.0 38.0 34.0 38.0 95-99 35.44905 38.0 38.0 38.0 33.0 38.0 100-104 35.268600000000006 38.0 38.0 38.0 31.8 38.0 105-109 35.2301 38.0 38.0 38.0 31.6 38.0 110-114 35.12135 38.0 38.0 38.0 31.4 38.0 115-119 34.948499999999996 38.0 38.0 38.0 30.2 38.0 120-124 34.68485 38.0 37.8 38.0 27.6 38.0 125-129 34.580450000000006 38.0 37.0 38.0 27.6 38.0 130-134 34.32255 38.0 36.2 38.0 24.2 38.0 135-139 33.9117 38.0 36.0 38.0 22.2 38.0 140-144 33.37265 38.0 34.4 38.0 15.4 38.0 145-149 31.8938 38.0 32.0 38.0 6.4 38.0 150-151 26.9785 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 25.0 4 7.0 5 8.0 6 6.0 7 8.0 8 5.0 9 5.0 10 8.0 11 16.0 12 6.0 13 9.0 14 6.0 15 12.0 16 17.0 17 17.0 18 8.0 19 5.0 20 7.0 21 12.0 22 14.0 23 8.0 24 14.0 25 16.0 26 18.0 27 16.0 28 21.0 29 31.0 30 30.0 31 30.0 32 62.0 33 79.0 34 113.0 35 168.0 36 436.0 37 2729.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.32511323603422 19.073980875691998 17.01056869652743 21.59033719174635 2 27.200000000000003 23.275000000000002 28.225 21.3 3 23.325000000000003 26.85 28.725 21.099999999999998 4 27.55 32.4 21.05 19.0 5 26.3 34.175 21.525 18.0 6 20.95 34.0 25.025 20.025000000000002 7 21.8 19.975 35.8 22.425 8 23.325000000000003 23.825 26.6 26.25 9 23.225 26.3 26.125 24.349999999999998 10-14 25.205 27.215 25.47 22.11 15-19 25.395 26.465 26.815 21.325 20-24 24.65 27.839999999999996 26.14 21.37 25-29 24.64 28.07 26.215 21.075 30-34 24.935 27.205000000000002 26.895000000000003 20.965 35-39 25.115 27.075 26.5 21.310000000000002 40-44 25.290000000000003 26.995 26.895000000000003 20.82 45-49 25.07389409348229 26.72210811081609 27.213065477681482 20.99093231802014 50-54 24.70576451144388 27.064656683527822 27.670656583362547 20.55892222166575 55-59 24.80176653618388 27.58707216701797 26.864398273612366 20.74676302318579 60-64 24.44 27.05 27.525 20.985 65-69 25.047571357035554 27.30595893840761 26.84026039058588 20.806209313970957 70-74 24.865598151032508 27.85007285333869 26.72963874792745 20.554690247701352 75-79 25.215 26.985 26.740000000000002 21.060000000000002 80-84 25.480000000000004 27.02 26.979999999999997 20.52 85-89 25.0 26.63 27.815 20.555 90-94 24.48 27.55 27.605 20.365 95-99 24.215 27.625 27.47 20.69 100-104 25.635 27.200000000000003 26.729999999999997 20.435 105-109 25.195 27.089999999999996 27.295 20.419999999999998 110-114 25.290000000000003 27.79 27.034999999999997 19.885 115-119 25.264999999999997 28.1 26.724999999999998 19.91 120-124 25.3 27.735 26.915 20.05 125-129 25.674999999999997 27.939999999999998 26.634999999999998 19.75 130-134 26.715 27.43 25.965 19.89 135-139 26.6 28.265 25.509999999999998 19.625 140-144 27.005000000000003 27.49 25.650000000000002 19.855 145-149 26.795 27.855 26.064999999999998 19.285 150-151 27.6375 26.987499999999997 25.7625 19.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.5 18 2.0 19 1.0 20 0.0 21 0.5 22 3.0 23 3.5 24 2.5 25 3.5 26 5.0 27 6.0 28 6.0 29 6.0 30 10.5 31 19.5 32 23.0 33 27.5 34 40.5 35 57.5 36 72.0 37 91.0 38 110.5 39 122.5 40 136.5 41 167.5 42 215.0 43 235.0 44 231.0 45 229.5 46 241.0 47 229.5 48 201.5 49 194.5 50 182.5 51 160.0 52 146.5 53 142.0 54 135.0 55 114.0 56 93.0 57 75.0 58 54.5 59 46.5 60 35.5 61 26.5 62 25.5 63 18.5 64 8.0 65 4.5 66 4.0 67 3.5 68 2.5 69 1.5 70 1.0 71 2.0 72 2.0 73 1.5 74 2.0 75 3.0 76 2.5 77 1.0 78 1.5 79 1.0 80 0.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.19499999999999998 50-54 0.165 55-59 0.37 60-64 0.0 65-69 0.15 70-74 0.485 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.67277966989782 92.25 2 2.6722556981922976 5.1 3 0.39297877914592616 1.125 4 0.052397170552790154 0.2 5 0.13099292638197535 0.625 6 0.026198585276395077 0.15 7 0.0 0.0 8 0.026198585276395077 0.2 9 0.0 0.0 >10 0.026198585276395077 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 14 0.35000000000000003 Illumina Single End PCR Primer 1 (100% over 50bp) CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 8 0.2 No Hit GCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAG 6 0.15 No Hit GCCCGCTCGCCGGAAGACCAAGGGTTCCTGTCCAACGTTAATCGGGGCAG 5 0.125 No Hit GGTGAGTCGACCCCTAAGGCGAGGCCGAAAGGCGTAGTCGATGGGAAACA 5 0.125 No Hit CGGGAACTCAAAGGAGACTGCCAGTGATAAACTGGAGGAAGGTGGGGATG 5 0.125 No Hit GCGACTTATATTCTGTAGCAAGGTTAACCGAATAGGGGAGCCGAAGGGAA 5 0.125 No Hit CAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.9750000000000001 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.3875 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.075 0.0 0.0 0.0 0.0 112-113 3.425 0.0 0.0 0.0 0.0 114-115 3.95 0.0 0.0 0.0 0.0 116-117 4.525 0.0 0.0 0.0 0.0 118-119 5.0875 0.0 0.0 0.0 0.0 120-121 5.65 0.0 0.0 0.0 0.0 122-123 6.2125 0.0 0.0 0.0 0.0 124-125 6.875 0.0 0.0 0.0 0.0 126-127 7.449999999999999 0.0 0.0 0.0 0.0 128-129 8.162500000000001 0.0 0.0 0.0 0.0 130-131 8.8875 0.0 0.0 0.0 0.0 132-133 9.462499999999999 0.0 0.0 0.0 0.0 134-135 10.275 0.0 0.0 0.0 0.0 136-137 10.912500000000001 0.0 0.0 0.0 0.0 138-139 11.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCCAT 10 0.006830828 145.0 9 GTGTAGG 40 0.0076550315 18.125 130-134 AAGAGTG 40 0.0076550315 18.125 4 CGTGTAG 40 0.0076550315 18.125 130-134 >>END_MODULE Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624411 spots for SRR7230768.sra Written 624411 spots for SRR7230768.sra Read 624426 spots for SRR7230768.sra Written 624426 spots for SRR7230768.sra SRR ids: ['SRR7230768.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_03llswhh SRR7230768.sra spots: 12488235 blocks: [[1, 624411], [624412, 1248822], [1248823, 1873233], [1873234, 2497644], [2497645, 3122055], [3122056, 3746466], [3746467, 4370877], [4370878, 4995288], [4995289, 5619699], [5619700, 6244110], [6244111, 6868521], [6868522, 7492932], [7492933, 8117343], [8117344, 8741754], [8741755, 9366165], [9366166, 9990576], [9990577, 10614987], [10614988, 11239398], [11239399, 11863809], [11863810, 12488235]] SRR7230768 file size 4210152 SRR7230768 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230768 SRR7230768_1.fastq SRR7230768_2.fastq Input file: SRR7230768_1.fastq Paired file: SRR7230768_2.fastq trimmed: SRR7230768-trimmed-pair1.fastq, SRR7230768-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:38:26 2025 >> started Mon Feb 10 23:38:39 2025 >> done (13.352s) 12488235 read pairs processed; of these: 60248 ( 0.48%) short read pairs filtered out after trimming by size control 95320 ( 0.76%) empty read pairs filtered out after trimming by size control 12332667 (98.75%) read pairs available; of these: 6267134 (50.82%) trimmed read pairs available after processing 6065533 (49.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 8 0.00% 21 11 0.00% 22 6 0.00% 23 20 0.00% 24 23 0.00% 25 19 0.00% 26 20 0.00% 27 16 0.00% 28 23 0.00% 29 21 0.00% 30 26 0.00% 31 28 0.00% 32 14 0.00% 33 24 0.00% 34 25 0.00% 35 60 0.00% 36 35 0.00% 37 28 0.00% 38 48 0.00% 39 35 0.00% 40 51 0.00% 41 69 0.00% 42 42 0.00% 43 85 0.00% 44 80 0.00% 45 103 0.00% 46 120 0.00% 47 122 0.00% 48 137 0.00% 49 166 0.00% 50 185 0.00% 51 197 0.00% 52 212 0.00% 53 194 0.00% 54 202 0.00% 55 245 0.00% 56 308 0.00% 57 358 0.00% 58 384 0.00% 59 386 0.00% 60 441 0.00% 61 488 0.00% 62 529 0.00% 63 612 0.00% 64 772 0.01% 65 894 0.01% 66 1415 0.01% 67 2397 0.02% 68 5015 0.04% 69 16901 0.14% 70 19853 0.16% 71 6232 0.05% 72 3281 0.03% 73 2867 0.02% 74 2806 0.02% 75 2797 0.02% 76 2882 0.02% 77 3168 0.03% 78 3321 0.03% 79 4078 0.03% 80 4085 0.03% 81 4505 0.04% 82 5276 0.04% 83 6260 0.05% 84 9315 0.08% 85 10866 0.09% 86 11836 0.10% 87 12206 0.10% 88 13171 0.11% 89 13153 0.11% 90 13633 0.11% 91 14611 0.12% 92 14719 0.12% 93 16141 0.13% 94 16719 0.14% 95 17752 0.14% 96 18478 0.15% 97 19223 0.16% 98 19591 0.16% 99 21044 0.17% 100 21999 0.18% 101 22618 0.18% 102 24042 0.19% 103 26053 0.21% 104 28278 0.23% 105 30675 0.25% 106 29144 0.24% 107 29742 0.24% 108 31872 0.26% 109 34769 0.28% 110 34719 0.28% 111 34001 0.28% 112 36652 0.30% 113 39462 0.32% 114 39045 0.32% 115 41298 0.33% 116 41856 0.34% 117 41462 0.34% 118 43325 0.35% 119 43991 0.36% 120 45554 0.37% 121 45627 0.37% 122 47785 0.39% 123 49847 0.40% 124 52195 0.42% 125 52799 0.43% 126 54589 0.44% 127 54964 0.45% 128 56254 0.46% 129 57264 0.46% 130 59294 0.48% 131 59471 0.48% 132 62685 0.51% 133 65512 0.53% 134 67492 0.55% 135 70588 0.57% 136 71467 0.58% 137 75850 0.62% 138 76231 0.62% 139 78016 0.63% 140 79185 0.64% 141 86116 0.70% 142 87668 0.71% 143 94973 0.77% 144 104365 0.85% 145 117484 0.95% 146 136488 1.11% 147 169835 1.38% 148 230599 1.87% 149 422959 3.43% 150 2511491 20.36% 151 6065533 49.18% 12332667 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=19 prefix-density=0.68 prefix-fanout=2.5 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=64.94 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=1.5 sequence=CCTCACGGTTCATTAGTACCGGTTAGCTCAACGCATCGCTGCGCTTACACACCCGGCCTATCAACGTCGTCGTCTTCAACGTTCCTTCAGGACTCTCAAGGAGTCAGGGAGAACTCATCTCGGGGCAAGTTTCGTGCTTAGATGCTTTCAGCACTTATCTCTTCCGCATTTAGCTACCGGGCAGTGCCATTGGCATGACAACCCGAACACCAGTGATGCGTCCACTCCGGTCCTCTCGTACTAGG criterion=sequence-density sequence-density=1.18 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=23 prefix-density=1.21 prefix-fanout=2.0 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=26.15 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.9 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7230768 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:39:32 Started mapping on | Feb 10 23:39:33 Finished on | Feb 10 23:42:49 Mapping speed, Million of reads per hour | 226.52 Number of input reads | 12332667 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 9334916 Uniquely mapped reads % | 75.69% Average mapped length | 289.44 Number of splices: Total | 7364093 Number of splices: Annotated (sjdb) | 7189659 Number of splices: GT/AG | 7202820 Number of splices: GC/AG | 129949 Number of splices: AT/AC | 5632 Number of splices: Non-canonical | 25692 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.03% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386202 % of reads mapped to multiple loci | 3.13% Number of reads mapped to too many loci | 402699 % of reads mapped to too many loci | 3.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.13% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2656107 2656107 2656107 N_multimapping 386202 386202 386202 N_noFeature 332092 9143906 400128 N_ambiguous 196516 783 73120 UnstrandedReadsAssigned:8806308 PositiveStrandReadsAssigned:190227 NegativeStrandReadsAssigned:8861668 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7230768 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230768-trimmed-pair1.fastq SRR7230768-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,332,667 reads, 9,408,446 reads pseudoaligned [quant] estimated average fragment length: 210.934 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR7230768.ke.tsv 34699 SRR7230768.se.tsv 87100 total ==> SRR7230768.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.07 248 12.3779 Potri.005G024800.1.v4.1 1035 825.066 92 10.0625 Potri.004G059700.1.v4.1 961 751.076 3 0.36045 Potri.007G009000.2.v4.1 1416 1206.07 0 0 Potri.003G141000.2.v4.1 2943 2733.07 317 10.4669 Potri.016G087400.1.v4.1 270 92.3468 493.613 482.362 Potri.015G069301.1.v4.1 564 356.608 0 0 Potri.010G195200.1.v4.1 1773 1563.07 11 0.635073 Potri.012G127500.1.v4.1 977 767.071 126 14.8232 ==> SRR7230768.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 266 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 311 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 122 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7230768 completed mapping pipeline successfully