Starting /dee2/code/volunteer_pipeline.sh SRR7230769 current disk space = 3057467576320 free memory = 1151564532 SRR7230769 SRAfilesize 14b16971b15b17344a55a0e682648891 SRR7230769.sra SRR7230769.sra file validated SRR7230769 is paired end SRR7230769 is conventional basespace SRR7230769 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230769_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.42275 34.0 33.0 34.0 33.0 34.0 2 33.49675 34.0 34.0 34.0 33.0 34.0 3 33.47225 34.0 34.0 34.0 33.0 34.0 4 33.45275 34.0 34.0 34.0 33.0 34.0 5 33.4835 34.0 34.0 34.0 33.0 34.0 6 37.21125 38.0 38.0 38.0 36.0 38.0 7 37.50825 38.0 38.0 38.0 37.0 38.0 8 37.5835 38.0 38.0 38.0 38.0 38.0 9 37.63875 38.0 38.0 38.0 38.0 38.0 10-14 37.640699999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.317 38.0 38.0 38.0 37.0 38.0 20-24 37.57895 38.0 38.0 38.0 38.0 38.0 25-29 37.581199999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.5407 38.0 38.0 38.0 38.0 38.0 35-39 37.2324 38.0 38.0 38.0 37.2 38.0 40-44 36.869299999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.9312 38.0 38.0 38.0 36.0 38.0 50-54 36.74395 38.0 37.8 38.0 34.8 38.0 55-59 37.278150000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.317099999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.2833 38.0 38.0 38.0 37.0 38.0 70-74 32.667899999999996 38.0 26.8 38.0 15.8 38.0 75-79 33.115700000000004 38.0 36.2 38.0 13.8 38.0 80-84 35.2832 38.0 38.0 38.0 29.2 38.0 85-89 36.2269 38.0 38.0 38.0 33.8 38.0 90-94 36.533699999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.53625 38.0 38.0 38.0 34.8 38.0 100-104 35.64 38.0 36.8 38.0 29.6 38.0 105-109 36.19465 38.0 37.6 38.0 33.4 38.0 110-114 35.901300000000006 38.0 37.2 38.0 32.2 38.0 115-119 36.18045000000001 38.0 37.8 38.0 33.6 38.0 120-124 35.331399999999995 38.0 36.0 38.0 29.0 38.0 125-129 35.37415 38.0 36.2 38.0 30.0 38.0 130-134 34.86165 38.0 35.6 38.0 25.8 38.0 135-139 35.0935 38.0 35.4 38.0 29.0 38.0 140-144 34.515299999999996 38.0 35.0 38.0 25.6 38.0 145-149 33.713499999999996 38.0 34.2 38.0 22.4 38.0 150-151 30.21675 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 1.0 11 0.0 12 4.0 13 0.0 14 1.0 15 3.0 16 0.0 17 0.0 18 7.0 19 7.0 20 3.0 21 3.0 22 5.0 23 12.0 24 14.0 25 16.0 26 16.0 27 23.0 28 31.0 29 46.0 30 46.0 31 68.0 32 88.0 33 162.0 34 227.0 35 346.0 36 735.0 37 2134.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.15 15.0 10.45 29.4 2 21.7 18.75 33.900000000000006 25.650000000000002 3 19.8 25.95 26.8 27.450000000000003 4 23.625 33.275 21.55 21.55 5 22.15 37.05 22.675 18.125 6 17.588191143357516 34.95121341005754 26.09457092819615 21.36602451838879 7 14.725 24.349999999999998 42.475 18.45 8 16.725 23.3 31.924999999999997 28.050000000000004 9 18.175 22.7 32.725 26.400000000000002 10-14 19.715 30.06 26.105 24.12 15-19 20.355 28.265 27.334999999999997 24.044999999999998 20-24 20.44 28.439999999999998 27.694999999999997 23.425 25-29 19.855 29.14 27.425 23.580000000000002 30-34 19.905 28.415000000000003 27.625 24.055 35-39 19.922911348050256 28.652950893527557 27.606747759923913 23.81738999849827 40-44 19.848248831717 28.777448369428672 27.506155469574395 23.868147329279935 45-49 20.538215286114443 28.421368547418968 27.71608643457383 23.324329731892757 50-54 19.759999999999998 28.705000000000002 28.005000000000003 23.53 55-59 19.86897379475895 28.410682136427283 27.845569113822766 23.874774954991 60-64 20.369999999999997 28.64 27.425 23.565 65-69 20.560000000000002 28.665000000000003 26.93 23.845 70-74 19.834663948813773 28.10146650812525 27.9542494762471 24.109620066813882 75-79 20.804108908157065 27.55840282763572 28.430993538410558 23.206494725796652 80-84 20.173389399366663 28.0745470591289 28.04339926283549 23.70866427866895 85-89 20.550644102045972 28.072745642839102 27.58777469057843 23.788835564536498 90-94 20.895 28.025 27.275 23.805 95-99 20.126006300315016 27.881394069703486 27.83139156957848 24.16120806040302 100-104 20.793317326930772 28.581432573029215 27.260904361744696 23.364345738295317 105-109 20.33313325330132 28.761504601840738 26.96078431372549 23.944577831132452 110-114 21.02210221022102 27.93779377937794 27.437743774377438 23.602360236023603 115-119 21.49214921492149 27.527752775277527 27.217721772177217 23.762376237623762 120-124 21.15 28.005000000000003 26.735 24.11 125-129 21.436077057793344 28.116087065298974 26.52489367025269 23.92294220665499 130-134 21.073200060123256 28.568565559396763 26.850042587303975 23.50819179317601 135-139 21.070267566891722 28.182045511377847 26.571642910727682 24.17604401100275 140-144 21.214242848569715 28.160632126425284 26.64532906581316 23.979795959191836 145-149 21.30171594376907 28.43063685026765 26.3344839661814 23.93316323978188 150-151 20.64266066516629 28.032008002000502 27.00675168792198 24.318579644911228 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 0.5 22 2.5 23 3.0 24 3.5 25 5.0 26 8.0 27 12.0 28 15.5 29 19.5 30 26.5 31 37.5 32 41.0 33 59.5 34 81.5 35 90.0 36 106.0 37 133.0 38 162.5 39 177.0 40 182.5 41 205.5 42 229.5 43 247.5 44 248.0 45 234.5 46 224.5 47 216.0 48 202.5 49 176.5 50 159.5 51 137.5 52 113.5 53 90.0 54 70.0 55 59.5 56 46.0 57 40.0 58 37.5 59 24.5 60 16.5 61 11.5 62 5.5 63 5.5 64 4.5 65 3.5 66 3.0 67 2.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.11499999999999999 40-44 0.49500000000000005 45-49 0.04 50-54 0.0 55-59 0.02 60-64 0.0 65-69 0.0 70-74 11.695 75-79 9.465 80-84 3.685 85-89 1.0250000000000001 90-94 0.0 95-99 0.005 100-104 0.04 105-109 0.04 110-114 0.01 115-119 0.01 120-124 0.0 125-129 0.075 130-134 0.20500000000000002 135-139 0.025 140-144 0.02 145-149 0.055 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16561314791403 98.05 2 0.7332490518331226 1.4500000000000002 3 0.05056890012642225 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025284450063211124 0.15 7 0.0 0.0 8 0.025284450063211124 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 8 0.2 TruSeq Adapter, Index 9 (100% over 50bp) GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.6875 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.675 0.0 0.0 0.0 0.0 118-119 4.15 0.0 0.0 0.0 0.0 120-121 4.55 0.0 0.0 0.0 0.0 122-123 5.025 0.0 0.0 0.0 0.0 124-125 5.525 0.0 0.0 0.0 0.0 126-127 5.975 0.0 0.0 0.0 0.0 128-129 6.4375 0.0 0.0 0.0 0.0 130-131 6.9 0.0 0.0 0.0 0.0 132-133 7.3125 0.0 0.0 0.0 0.0 134-135 7.775 0.0 0.0 0.0 0.0 136-137 8.2625 0.0 0.0 0.0 0.0 138-139 8.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACCTT 10 0.0072200205 142.33751 8 >>END_MODULE SRR7230769 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230769_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88225 34.0 33.0 34.0 32.0 34.0 2 32.9685 34.0 33.0 34.0 32.0 34.0 3 32.98925 34.0 33.0 34.0 32.0 34.0 4 32.9575 34.0 33.0 34.0 33.0 34.0 5 32.95725 34.0 33.0 34.0 33.0 34.0 6 37.00775 38.0 38.0 38.0 37.0 38.0 7 37.02325 38.0 38.0 38.0 37.0 38.0 8 36.94925 38.0 38.0 38.0 37.0 38.0 9 36.97225 38.0 38.0 38.0 37.0 38.0 10-14 36.90605 38.0 38.0 38.0 36.8 38.0 15-19 36.9345 38.0 38.0 38.0 37.0 38.0 20-24 36.93645 38.0 38.0 38.0 37.0 38.0 25-29 36.92139999999999 38.0 38.0 38.0 37.0 38.0 30-34 36.84985 38.0 38.0 38.0 37.0 38.0 35-39 36.724149999999995 38.0 38.0 38.0 36.8 38.0 40-44 36.6874 38.0 38.0 38.0 36.6 38.0 45-49 36.72235 38.0 38.0 38.0 36.8 38.0 50-54 36.747949999999996 38.0 38.0 38.0 36.8 38.0 55-59 36.457899999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.64534999999999 38.0 38.0 38.0 36.2 38.0 65-69 36.4854 38.0 38.0 38.0 35.8 38.0 70-74 36.21945 38.0 38.0 38.0 34.8 38.0 75-79 36.427800000000005 38.0 38.0 38.0 35.6 38.0 80-84 36.39635 38.0 38.0 38.0 35.8 38.0 85-89 36.412800000000004 38.0 38.0 38.0 35.6 38.0 90-94 36.374700000000004 38.0 38.0 38.0 35.2 38.0 95-99 36.27575 38.0 38.0 38.0 35.2 38.0 100-104 36.0655 38.0 38.0 38.0 34.0 38.0 105-109 35.8724 38.0 38.0 38.0 33.6 38.0 110-114 35.903499999999994 38.0 38.0 38.0 34.0 38.0 115-119 35.829699999999995 38.0 38.0 38.0 33.8 38.0 120-124 35.54 38.0 38.0 38.0 32.4 38.0 125-129 35.30865 38.0 37.4 38.0 31.0 38.0 130-134 35.16215 38.0 37.2 38.0 30.6 38.0 135-139 34.58285 38.0 36.0 38.0 27.0 38.0 140-144 34.07735 38.0 35.8 38.0 23.8 38.0 145-149 32.9652 38.0 33.8 38.0 16.0 38.0 150-151 27.629624999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 7.0 4 5.0 5 5.0 6 4.0 7 3.0 8 3.0 9 0.0 10 7.0 11 1.0 12 4.0 13 6.0 14 6.0 15 11.0 16 9.0 17 5.0 18 6.0 19 6.0 20 8.0 21 8.0 22 9.0 23 18.0 24 14.0 25 14.0 26 17.0 27 25.0 28 23.0 29 18.0 30 29.0 31 54.0 32 57.0 33 64.0 34 131.0 35 204.0 36 443.0 37 2763.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.73091364205256 19.474342928660825 13.867334167709636 21.927409261576972 2 26.926926926926924 25.100100100100097 30.630630630630627 17.34234234234234 3 22.375 28.349999999999998 30.675 18.6 4 26.05 34.050000000000004 21.85 18.05 5 24.55 37.025000000000006 21.125 17.299999999999997 6 19.375 37.275000000000006 22.925 20.424999999999997 7 19.45 20.225 39.975 20.349999999999998 8 21.175 23.225 28.849999999999998 26.75 9 22.125 24.5 27.825 25.55 10-14 24.10102525631408 28.37209302325581 26.186546636659163 21.340335083770942 15-19 23.778566785017752 27.97919687953193 27.59913987098065 20.64309646446967 20-24 23.331999599879964 27.86335900770231 27.57827348204461 21.226367910373114 25-29 23.336668334167083 28.179089544772385 27.098549274637318 21.38569284642321 30-34 23.086926077823346 28.188456536961088 27.463238971691506 21.261378413524056 35-39 23.354012407444465 27.676605963578147 27.301380828497095 21.66800080048029 40-44 23.103086080128044 28.204871705096785 27.239533836842895 21.452508377932276 45-49 23.5947745132389 27.51889483958156 28.094499224185395 20.791831422994143 50-54 22.484851519855773 27.522660123190946 28.223746807551702 21.76874154940157 55-59 23.126101182985153 27.540901082305563 27.69695444248679 21.6360432922225 60-64 23.202204961162614 27.31145076421949 28.123277374091703 21.363066900526185 65-69 23.486524537409494 27.97164119066774 28.167739340305715 20.374094931617055 70-74 23.75157153633392 27.38244908222278 27.49308524013075 21.37289414131255 75-79 23.209283713485394 27.230892356942775 28.171268507402964 21.388555422168867 80-84 23.915221966128872 27.31235594748973 27.422587433610584 21.34983465277082 85-89 23.452345234523452 27.562756275627564 28.107810781078108 20.877087708770876 90-94 23.713299654879208 27.654679137698196 27.854749162206772 20.777272045215824 95-99 23.664465786314526 27.606042416966787 27.536014405762305 21.19347739095638 100-104 23.891194559727985 26.976348817440872 28.651432571628582 20.48102405120256 105-109 23.826191309565477 27.891394569728483 27.591379568978446 20.691034551727586 110-114 23.811430287258535 27.51476328695826 27.74997497747973 20.923831448303474 115-119 23.963387185514932 27.859750912819486 27.734707147501624 20.44215475416396 120-124 23.84619230961548 27.91639581979099 27.771388569428474 20.46602330116506 125-129 25.224999999999998 27.3 27.315 20.16 130-134 25.526276313815693 27.536376818840942 26.95134756737837 19.985999299965 135-139 24.684368737474948 27.48496993987976 27.885771543086175 19.94488977955912 140-144 25.016250812540626 27.60138006900345 27.101355067753385 20.281014050702534 145-149 25.93629681484074 27.541377068853446 26.73133656682834 19.790989549477477 150-151 25.874999999999996 27.8125 26.8625 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 1.0 17 2.5 18 2.0 19 0.5 20 1.0 21 2.0 22 2.5 23 2.5 24 2.0 25 2.0 26 4.0 27 7.0 28 7.0 29 7.5 30 15.0 31 22.0 32 26.5 33 42.0 34 58.5 35 74.0 36 85.5 37 94.5 38 117.0 39 141.0 40 158.5 41 190.0 42 237.0 43 264.0 44 269.0 45 267.0 46 256.5 47 245.5 48 219.0 49 190.0 50 171.5 51 159.0 52 135.5 53 111.0 54 98.0 55 73.0 56 52.5 57 40.5 58 29.5 59 25.0 60 24.5 61 15.5 62 11.5 63 9.5 64 6.0 65 4.0 66 1.5 67 2.5 68 2.0 69 1.0 70 2.0 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.025 15-19 0.015 20-24 0.03 25-29 0.05 30-34 0.03 35-39 0.06 40-44 0.034999999999999996 45-49 0.105 50-54 0.155 55-59 0.675 60-64 0.22499999999999998 65-69 0.5599999999999999 70-74 0.575 75-79 0.04 80-84 0.21 85-89 0.01 90-94 0.034999999999999996 95-99 0.04 100-104 0.005 105-109 0.005 110-114 0.09 115-119 0.034999999999999996 120-124 0.005 125-129 0.0 130-134 0.005 135-139 0.2 140-144 0.005 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31921331316188 98.475 2 0.5799293998991427 1.15 3 0.07564296520423601 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.02521432173474534 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.35 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.25 0.0 0.0 0.0 0.0 116-117 3.6875 0.0 0.0 0.0 0.0 118-119 4.15 0.0 0.0 0.0 0.0 120-121 4.612500000000001 0.0 0.0 0.0 0.0 122-123 5.15 0.0 0.0 0.0 0.0 124-125 5.675000000000001 0.0 0.0 0.0 0.0 126-127 6.175 0.0 0.0 0.0 0.0 128-129 6.6875 0.0 0.0 0.0 0.0 130-131 7.175 0.0 0.0 0.0 0.0 132-133 7.6375 0.0 0.0 0.0 0.0 134-135 8.1625 0.0 0.0 0.0 0.0 136-137 8.6125 0.0 0.0 0.0 0.0 138-139 9.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGTCC 10 0.006830828 145.0 3 >>END_MODULE Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704860 spots for SRR7230769.sra Written 704860 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra Read 704859 spots for SRR7230769.sra Written 704859 spots for SRR7230769.sra SRR ids: ['SRR7230769.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lzz16em_ SRR7230769.sra spots: 14097181 blocks: [[1, 704859], [704860, 1409718], [1409719, 2114577], [2114578, 2819436], [2819437, 3524295], [3524296, 4229154], [4229155, 4934013], [4934014, 5638872], [5638873, 6343731], [6343732, 7048590], [7048591, 7753449], [7753450, 8458308], [8458309, 9163167], [9163168, 9868026], [9868027, 10572885], [10572886, 11277744], [11277745, 11982603], [11982604, 12687462], [12687463, 13392321], [13392322, 14097181]] SRR7230769 file size 4755371 SRR7230769 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230769 SRR7230769_1.fastq SRR7230769_2.fastq Input file: SRR7230769_1.fastq Paired file: SRR7230769_2.fastq trimmed: SRR7230769-trimmed-pair1.fastq, SRR7230769-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:44:01 2025 >> started Mon Feb 10 23:44:19 2025 >> done (17.804s) 14097181 read pairs processed; of these: 27468 ( 0.19%) short read pairs filtered out after trimming by size control 58825 ( 0.42%) empty read pairs filtered out after trimming by size control 14010888 (99.39%) read pairs available; of these: 6253870 (44.64%) trimmed read pairs available after processing 7757018 (55.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 6 0.00% 21 4 0.00% 22 6 0.00% 23 8 0.00% 24 9 0.00% 25 7 0.00% 26 5 0.00% 27 8 0.00% 28 7 0.00% 29 17 0.00% 30 14 0.00% 31 12 0.00% 32 8 0.00% 33 12 0.00% 34 6 0.00% 35 13 0.00% 36 17 0.00% 37 17 0.00% 38 24 0.00% 39 24 0.00% 40 14 0.00% 41 31 0.00% 42 34 0.00% 43 42 0.00% 44 45 0.00% 45 57 0.00% 46 82 0.00% 47 88 0.00% 48 96 0.00% 49 107 0.00% 50 118 0.00% 51 120 0.00% 52 119 0.00% 53 150 0.00% 54 135 0.00% 55 157 0.00% 56 196 0.00% 57 252 0.00% 58 293 0.00% 59 288 0.00% 60 336 0.00% 61 348 0.00% 62 362 0.00% 63 413 0.00% 64 435 0.00% 65 488 0.00% 66 646 0.00% 67 742 0.01% 68 865 0.01% 69 2249 0.02% 70 2567 0.02% 71 1533 0.01% 72 1481 0.01% 73 1522 0.01% 74 1609 0.01% 75 1730 0.01% 76 1926 0.01% 77 2071 0.01% 78 2380 0.02% 79 2691 0.02% 80 3148 0.02% 81 3890 0.03% 82 3856 0.03% 83 4291 0.03% 84 6413 0.05% 85 6927 0.05% 86 7306 0.05% 87 7969 0.06% 88 8460 0.06% 89 8958 0.06% 90 9344 0.07% 91 10016 0.07% 92 10568 0.08% 93 11416 0.08% 94 11853 0.08% 95 12651 0.09% 96 13638 0.10% 97 14114 0.10% 98 14761 0.11% 99 15982 0.11% 100 16802 0.12% 101 17358 0.12% 102 18494 0.13% 103 19421 0.14% 104 20549 0.15% 105 21596 0.15% 106 22572 0.16% 107 23363 0.17% 108 24263 0.17% 109 25860 0.18% 110 26472 0.19% 111 28105 0.20% 112 28868 0.21% 113 30049 0.21% 114 31099 0.22% 115 32572 0.23% 116 33701 0.24% 117 34574 0.25% 118 35833 0.26% 119 36507 0.26% 120 38617 0.28% 121 39982 0.29% 122 40888 0.29% 123 42702 0.30% 124 44026 0.31% 125 45311 0.32% 126 46991 0.34% 127 48524 0.35% 128 50486 0.36% 129 52230 0.37% 130 53177 0.38% 131 54399 0.39% 132 56440 0.40% 133 58750 0.42% 134 60196 0.43% 135 63475 0.45% 136 64931 0.46% 137 68150 0.49% 138 70239 0.50% 139 73365 0.52% 140 76301 0.54% 141 81495 0.58% 142 86259 0.62% 143 93147 0.66% 144 103168 0.74% 145 116925 0.83% 146 136321 0.97% 147 173067 1.24% 148 243055 1.73% 149 455884 3.25% 150 2872699 20.50% 151 7757018 55.36% 14010888 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=17 prefix-density=0.65 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=10.26 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.6 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=17 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=88.34 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCT SRR7230769 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:45:08 Started mapping on | Feb 10 23:45:08 Finished on | Feb 10 23:46:52 Mapping speed, Million of reads per hour | 484.99 Number of input reads | 14010888 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12862876 Uniquely mapped reads % | 91.81% Average mapped length | 292.00 Number of splices: Total | 12102572 Number of splices: Annotated (sjdb) | 11856487 Number of splices: GT/AG | 11860593 Number of splices: GC/AG | 206737 Number of splices: AT/AC | 7025 Number of splices: Non-canonical | 28217 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.46 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329251 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 175259 % of reads mapped to too many loci | 1.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 847591 847591 847591 N_multimapping 329251 329251 329251 N_noFeature 481636 12646970 561000 N_ambiguous 220264 779 83282 UnstrandedReadsAssigned:12160976 PositiveStrandReadsAssigned:215127 NegativeStrandReadsAssigned:12218594 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230769 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230769-trimmed-pair1.fastq SRR7230769-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,010,888 reads, 12,376,705 reads pseudoaligned [quant] estimated average fragment length: 223.792 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR7230769.ke.tsv 34699 SRR7230769.se.tsv 87100 total ==> SRR7230769.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.21 497 20.8677 Potri.005G024800.1.v4.1 1035 812.208 67 6.21786 Potri.004G059700.1.v4.1 961 738.213 8 0.816849 Potri.007G009000.2.v4.1 1416 1193.21 0 0 Potri.003G141000.2.v4.1 2943 2720.21 467 12.9404 Potri.016G087400.1.v4.1 270 87.8529 588 504.493 Potri.015G069301.1.v4.1 564 344.188 0 0 Potri.010G195200.1.v4.1 1773 1550.21 11 0.534855 Potri.012G127500.1.v4.1 977 754.208 167 16.6901 ==> SRR7230769.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 925 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 32 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 99 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7230769 completed mapping pipeline successfully