Starting /dee2/code/volunteer_pipeline.sh SRR7230770 current disk space = 3057429450752 free memory = 1579201016 SRR7230770 SRAfilesize a430ba8c165135bfe38c2b7c53f10f42 SRR7230770.sra SRR7230770.sra file validated SRR7230770 is paired end SRR7230770 is conventional basespace SRR7230770 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230770_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.333 34.0 33.0 34.0 33.0 34.0 2 33.40825 34.0 33.0 34.0 33.0 34.0 3 33.4125 34.0 33.0 34.0 33.0 34.0 4 33.333 34.0 33.0 34.0 33.0 34.0 5 33.30375 34.0 33.0 34.0 33.0 34.0 6 37.14725 38.0 38.0 38.0 36.0 38.0 7 37.4265 38.0 38.0 38.0 37.0 38.0 8 37.25825 38.0 38.0 38.0 37.0 38.0 9 37.405 38.0 38.0 38.0 37.0 38.0 10-14 37.49325 38.0 38.0 38.0 38.0 38.0 15-19 37.41175 38.0 38.0 38.0 37.4 38.0 20-24 37.5264 38.0 38.0 38.0 38.0 38.0 25-29 37.3903 38.0 38.0 38.0 37.4 38.0 30-34 37.25055 38.0 38.0 38.0 37.0 38.0 35-39 37.16865 38.0 38.0 38.0 36.6 38.0 40-44 36.7384 38.0 38.0 38.0 35.0 38.0 45-49 37.094100000000005 38.0 38.0 38.0 35.8 38.0 50-54 37.1604 38.0 38.0 38.0 36.2 38.0 55-59 37.1503 38.0 38.0 38.0 36.2 38.0 60-64 37.026149999999994 38.0 38.0 38.0 36.0 38.0 65-69 37.04975 38.0 38.0 38.0 36.0 38.0 70-74 30.948699999999995 38.0 21.6 38.0 15.4 38.0 75-79 32.01545 38.0 32.8 38.0 4.8 38.0 80-84 34.7344 38.0 37.0 38.0 27.4 38.0 85-89 35.96665 38.0 38.0 38.0 32.0 38.0 90-94 36.17885 38.0 37.4 38.0 33.4 38.0 95-99 36.319649999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.1889 38.0 37.8 38.0 33.6 38.0 105-109 35.52915 38.0 36.4 38.0 29.6 38.0 110-114 35.717699999999994 38.0 36.4 38.0 31.4 38.0 115-119 35.695 38.0 36.8 38.0 30.6 38.0 120-124 35.38935 38.0 36.0 38.0 30.0 38.0 125-129 34.5988 38.0 35.0 38.0 24.4 38.0 130-134 34.80985 38.0 35.0 38.0 27.4 38.0 135-139 34.818200000000004 38.0 35.0 38.0 28.0 38.0 140-144 34.4379 38.0 35.0 38.0 26.0 38.0 145-149 33.48525 38.0 33.4 38.0 21.8 38.0 150-151 30.193375 35.5 28.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 0.0 17 2.0 18 4.0 19 5.0 20 3.0 21 8.0 22 7.0 23 11.0 24 15.0 25 20.0 26 26.0 27 25.0 28 41.0 29 45.0 30 74.0 31 71.0 32 119.0 33 151.0 34 291.0 35 470.0 36 810.0 37 1796.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.025 14.899999999999999 10.975 41.099999999999994 2 21.349999999999998 21.6 36.75 20.3 3 19.925 27.200000000000003 25.650000000000002 27.224999999999998 4 23.200000000000003 34.449999999999996 20.95 21.4 5 20.225 38.324999999999996 24.3 17.150000000000002 6 16.0 37.275000000000006 25.624999999999996 21.099999999999998 7 13.575000000000001 22.575 44.5 19.35 8 18.775 20.599999999999998 31.924999999999997 28.7 9 16.3 23.65 34.2 25.85 10-14 19.869999999999997 28.95 26.565 24.615000000000002 15-19 19.895 28.255000000000003 27.900000000000002 23.95 20-24 19.545 29.12 27.994999999999997 23.34 25-29 20.025000000000002 28.705000000000002 27.825 23.445 30-34 20.04 28.68 27.63 23.65 35-39 19.435 29.575000000000003 27.284999999999997 23.705000000000002 40-44 19.906967438603512 28.499974991246933 28.044815685489922 23.54824188465963 45-49 20.345 27.87 28.15 23.635 50-54 20.1 28.535 27.750000000000004 23.615 55-59 19.66 28.59 28.16 23.59 60-64 20.063009451417713 27.804170625593837 28.454268140221036 23.678551782767414 65-69 19.735 28.73 27.834999999999997 23.7 70-74 19.978638818014595 28.623983860440276 27.94754643090251 23.449830890642616 75-79 20.464457660719344 28.178986122911358 27.975077881619935 23.38147833474936 80-84 20.10895186213399 28.26462731129852 27.87701010947567 23.749410717091823 85-89 20.49192772913609 28.59456450225214 27.86578268130978 23.04772508730199 90-94 20.768806695734977 28.7124743146394 27.42945922918859 23.089259760437027 95-99 20.56865395204485 27.837012564449115 28.2124443109576 23.38188917254843 100-104 20.64541992383243 28.55281619563039 27.741030266586492 23.06073361395069 105-109 20.427256353812286 28.31699019411647 28.16690014008405 23.088853311987194 110-114 20.768115217282592 28.46927039055858 27.62414362154323 23.138470770615594 115-119 21.25952667468913 28.99618933012435 26.76995587645407 22.97432811873245 120-124 20.750452079566003 28.365481213582477 27.335744424352022 23.548322282499498 125-129 20.39 28.13 27.384999999999998 24.095 130-134 20.974999999999998 28.775000000000002 26.82 23.43 135-139 20.75 28.744999999999997 26.77 23.735 140-144 21.455 28.77 26.745 23.03 145-149 20.68810096153846 28.60576923076923 26.65264423076923 24.053485576923077 150-151 20.255063765941486 28.54463615903976 26.44411102775694 24.756189047261813 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.0 21 0.0 22 0.5 23 2.5 24 3.0 25 4.5 26 8.5 27 11.0 28 12.0 29 21.0 30 33.5 31 44.5 32 51.0 33 59.0 34 81.0 35 107.0 36 122.0 37 134.5 38 165.0 39 196.0 40 213.0 41 226.5 42 242.0 43 260.0 44 256.0 45 246.5 46 235.0 47 211.0 48 190.5 49 164.5 50 141.0 51 114.5 52 90.0 53 78.0 54 64.0 55 48.5 56 40.5 57 32.0 58 23.0 59 17.0 60 13.0 61 9.5 62 5.5 63 4.5 64 3.0 65 3.5 66 4.5 67 1.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.034999999999999996 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.015 65-69 0.0 70-74 15.735 75-79 11.725 80-84 4.545 85-89 1.205 90-94 0.23500000000000001 95-99 0.11499999999999999 100-104 0.22 105-109 0.06 110-114 0.015 115-119 0.27999999999999997 120-124 0.45999999999999996 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.16 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.175 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.1500000000000004 0.0 0.0 0.0 0.0 118-119 2.4 0.0 0.0 0.0 0.0 120-121 2.7375 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.9875 0.0 0.0 0.0 0.0 128-129 4.362500000000001 0.0 0.0 0.0 0.0 130-131 4.825 0.0 0.0 0.0 0.0 132-133 5.325 0.0 0.0 0.0 0.0 134-135 5.7375 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGACA 10 0.007616912 139.8125 1 >>END_MODULE SRR7230770 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230770_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42975 33.0 33.0 34.0 32.0 34.0 2 32.91575 34.0 33.0 34.0 32.0 34.0 3 32.99725 34.0 33.0 34.0 32.0 34.0 4 32.9145 34.0 33.0 34.0 32.0 34.0 5 32.9475 34.0 33.0 34.0 32.0 34.0 6 37.11425 38.0 38.0 38.0 37.0 38.0 7 37.07075 38.0 38.0 38.0 37.0 38.0 8 37.04625 38.0 38.0 38.0 37.0 38.0 9 37.0025 38.0 38.0 38.0 37.0 38.0 10-14 36.77475 38.0 38.0 38.0 35.6 38.0 15-19 37.024899999999995 38.0 38.0 38.0 37.0 38.0 20-24 36.95315000000001 38.0 38.0 38.0 36.8 38.0 25-29 36.873200000000004 38.0 38.0 38.0 36.6 38.0 30-34 36.89685 38.0 38.0 38.0 36.8 38.0 35-39 36.60655 38.0 38.0 38.0 35.6 38.0 40-44 36.28965 38.0 38.0 38.0 33.8 38.0 45-49 36.58669999999999 38.0 38.0 38.0 35.0 38.0 50-54 36.544599999999996 38.0 37.8 38.0 34.8 38.0 55-59 36.52075 38.0 38.0 38.0 35.2 38.0 60-64 36.697199999999995 38.0 38.0 38.0 35.8 38.0 65-69 36.60735000000001 38.0 38.0 38.0 35.6 38.0 70-74 36.47035 38.0 38.0 38.0 34.8 38.0 75-79 36.56005 38.0 38.0 38.0 35.4 38.0 80-84 36.489 38.0 38.0 38.0 35.2 38.0 85-89 36.48535 38.0 38.0 38.0 35.2 38.0 90-94 36.32045 38.0 38.0 38.0 34.4 38.0 95-99 36.128 38.0 38.0 38.0 33.8 38.0 100-104 35.40005 38.0 37.2 38.0 29.4 38.0 105-109 35.757600000000004 38.0 37.8 38.0 32.4 38.0 110-114 35.773900000000005 38.0 38.0 38.0 32.6 38.0 115-119 35.79105 38.0 38.0 38.0 33.0 38.0 120-124 35.36345 38.0 37.2 38.0 30.4 38.0 125-129 34.96085000000001 38.0 36.2 38.0 28.4 38.0 130-134 34.71 38.0 36.0 38.0 26.8 38.0 135-139 34.409299999999995 38.0 35.6 38.0 25.0 38.0 140-144 34.040350000000004 38.0 34.8 38.0 23.4 38.0 145-149 33.5257 38.0 33.4 38.0 20.2 38.0 150-151 28.83 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 5.0 5 5.0 6 2.0 7 2.0 8 1.0 9 2.0 10 3.0 11 2.0 12 1.0 13 3.0 14 2.0 15 5.0 16 6.0 17 5.0 18 9.0 19 7.0 20 10.0 21 9.0 22 12.0 23 16.0 24 12.0 25 7.0 26 24.0 27 26.0 28 39.0 29 43.0 30 41.0 31 61.0 32 79.0 33 86.0 34 142.0 35 235.0 36 507.0 37 2578.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.22256097560975 18.038617886178862 16.08231707317073 31.656504065040654 2 24.4 24.45 35.575 15.575 3 20.424999999999997 26.775 31.5 21.3 4 23.35 34.775 23.1 18.775 5 23.150000000000002 36.325 22.95 17.575 6 17.4 36.925000000000004 27.1 18.575 7 19.45 17.2 43.475 19.875 8 20.599999999999998 23.35 29.599999999999998 26.450000000000003 9 21.725 24.425 29.825000000000003 24.025 10-14 23.390203632361033 27.9031370390754 26.517236203532295 22.189423125031272 15-19 21.87 27.985 28.955 21.19 20-24 22.700215096793556 28.377769996498426 27.827522385073284 21.094492521634738 25-29 22.73795828539989 27.974791176911918 28.590006502275795 20.697244035412393 30-34 22.92875725435261 27.98178907344407 27.996798078847306 21.092655593356014 35-39 22.930732683170792 27.901975493873472 28.852213053263316 20.315078769692423 40-44 22.926463231615806 27.988994497248626 28.479239619809903 20.605302651325662 45-49 22.917501001201444 27.948538245895072 28.549259110933118 20.584701641970366 50-54 23.196237366156307 27.73941759231462 28.09466626638647 20.9696787751426 55-59 22.789439406843346 27.9645308351285 28.240068132859076 21.00596162516908 60-64 22.9518855656697 27.093127938381517 28.848654596378914 21.10633189956987 65-69 23.016826923076923 28.48056891025641 27.599158653846157 20.90344551282051 70-74 23.372855070288658 27.80029015958777 27.890339686827755 20.936515083295813 75-79 23.615072811890105 28.063854276134713 27.753590551969175 20.567482360006007 80-84 23.450552748736932 27.817517883047373 27.64243909759392 21.08949027062178 85-89 22.5531914893617 27.909887359198997 28.425531914893615 21.111389236545683 90-94 23.19935932729366 27.919315281045098 27.679063016166978 21.202262375494268 95-99 23.39850977646647 27.704155623343503 28.929339400910138 19.96799519927989 100-104 22.923438515777367 27.74916237435615 28.40926138920838 20.9181377206581 105-109 23.704740948189638 27.795559111822364 28.080616123224644 20.419083816763354 110-114 23.294999999999998 28.355000000000004 27.92 20.43 115-119 23.885 28.54 27.529999999999998 20.044999999999998 120-124 23.785946486621658 27.941985496374095 27.93198299574894 20.340085021255312 125-129 23.885302507131062 28.143922333983884 27.66851824050443 20.302256918380625 130-134 24.7 27.560000000000002 27.41 20.330000000000002 135-139 24.10361554233135 28.4142621393209 27.589138370755613 19.89298394759214 140-144 24.893670252689517 28.281210908181137 27.06529897423067 19.759819864898674 145-149 24.80872130819623 28.0892133820073 27.584137620643094 19.51792768915337 150-151 25.403175396924617 27.61595199399925 27.51593949243655 19.46493311663958 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.5 22 1.5 23 3.5 24 6.0 25 5.5 26 5.0 27 7.0 28 8.0 29 16.5 30 18.5 31 22.5 32 39.5 33 45.5 34 58.0 35 76.5 36 92.5 37 111.5 38 129.0 39 146.0 40 181.5 41 225.0 42 248.5 43 263.5 44 273.0 45 275.0 46 263.0 47 240.5 48 225.0 49 205.5 50 168.5 51 139.5 52 106.0 53 82.0 54 74.0 55 57.0 56 46.0 57 33.5 58 24.5 59 19.5 60 12.0 61 10.5 62 12.0 63 6.0 64 1.5 65 2.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.065 15-19 0.0 20-24 0.045 25-29 0.034999999999999996 30-34 0.06 35-39 0.025 40-44 0.05 45-49 0.12 50-54 0.06999999999999999 55-59 0.19499999999999998 60-64 0.03 65-69 0.16 70-74 0.055 75-79 0.08499999999999999 80-84 0.045 85-89 0.125 90-94 0.105 95-99 0.015 100-104 0.015 105-109 0.02 110-114 0.0 115-119 0.0 120-124 0.025 125-129 0.08499999999999999 130-134 0.0 135-139 0.015 140-144 0.075 145-149 0.015 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.4024144869215292 0.8 3 0.1006036217303823 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.075 0.0 0.0 0.0 0.0 128-129 4.45 0.0 0.0 0.0 0.0 130-131 4.9125 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.824999999999999 0.0 0.0 0.0 0.0 136-137 6.3875 0.0 0.0 0.0 0.0 138-139 7.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGGAA 10 0.0069411653 144.225 8 >>END_MODULE Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857619 spots for SRR7230770.sra Written 857619 spots for SRR7230770.sra Read 857626 spots for SRR7230770.sra Written 857626 spots for SRR7230770.sra SRR ids: ['SRR7230770.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x8qumj8z SRR7230770.sra spots: 17152387 blocks: [[1, 857619], [857620, 1715238], [1715239, 2572857], [2572858, 3430476], [3430477, 4288095], [4288096, 5145714], [5145715, 6003333], [6003334, 6860952], [6860953, 7718571], [7718572, 8576190], [8576191, 9433809], [9433810, 10291428], [10291429, 11149047], [11149048, 12006666], [12006667, 12864285], [12864286, 13721904], [13721905, 14579523], [14579524, 15437142], [15437143, 16294761], [16294762, 17152387]] SRR7230770 file size 5790680 SRR7230770 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230770 SRR7230770_1.fastq SRR7230770_2.fastq Input file: SRR7230770_1.fastq Paired file: SRR7230770_2.fastq trimmed: SRR7230770-trimmed-pair1.fastq, SRR7230770-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:49:15 2025 >> started Tue Feb 11 00:49:33 2025 >> done (18.798s) 17152387 read pairs processed; of these: 15385 ( 0.09%) short read pairs filtered out after trimming by size control 12388 ( 0.07%) empty read pairs filtered out after trimming by size control 17124614 (99.84%) read pairs available; of these: 8136678 (47.51%) trimmed read pairs available after processing 8987936 (52.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 3 0.00% 22 3 0.00% 23 1 0.00% 24 5 0.00% 25 2 0.00% 26 3 0.00% 27 4 0.00% 28 2 0.00% 29 4 0.00% 30 11 0.00% 31 8 0.00% 32 12 0.00% 33 13 0.00% 34 9 0.00% 35 13 0.00% 36 11 0.00% 37 17 0.00% 38 22 0.00% 39 23 0.00% 40 22 0.00% 41 27 0.00% 42 16 0.00% 43 33 0.00% 44 26 0.00% 45 36 0.00% 46 37 0.00% 47 33 0.00% 48 43 0.00% 49 49 0.00% 50 65 0.00% 51 95 0.00% 52 95 0.00% 53 103 0.00% 54 88 0.00% 55 102 0.00% 56 116 0.00% 57 173 0.00% 58 160 0.00% 59 214 0.00% 60 260 0.00% 61 242 0.00% 62 291 0.00% 63 304 0.00% 64 409 0.00% 65 393 0.00% 66 434 0.00% 67 608 0.00% 68 872 0.01% 69 1301 0.01% 70 1133 0.01% 71 899 0.01% 72 966 0.01% 73 1113 0.01% 74 1190 0.01% 75 1347 0.01% 76 1451 0.01% 77 1712 0.01% 78 1848 0.01% 79 2056 0.01% 80 2524 0.01% 81 2737 0.02% 82 3200 0.02% 83 3429 0.02% 84 4571 0.03% 85 5361 0.03% 86 5562 0.03% 87 6272 0.04% 88 6491 0.04% 89 6993 0.04% 90 7491 0.04% 91 8106 0.05% 92 8588 0.05% 93 9441 0.06% 94 10351 0.06% 95 10839 0.06% 96 11806 0.07% 97 12571 0.07% 98 12932 0.08% 99 13756 0.08% 100 14653 0.09% 101 15280 0.09% 102 16387 0.10% 103 17498 0.10% 104 18760 0.11% 105 19424 0.11% 106 20670 0.12% 107 21694 0.13% 108 22546 0.13% 109 23574 0.14% 110 24605 0.14% 111 26052 0.15% 112 26986 0.16% 113 28313 0.17% 114 29469 0.17% 115 31348 0.18% 116 32656 0.19% 117 33175 0.19% 118 34933 0.20% 119 35792 0.21% 120 37230 0.22% 121 38837 0.23% 122 40354 0.24% 123 42085 0.25% 124 43632 0.25% 125 45434 0.27% 126 47125 0.28% 127 49071 0.29% 128 50326 0.29% 129 52507 0.31% 130 54925 0.32% 131 56862 0.33% 132 59480 0.35% 133 63011 0.37% 134 65796 0.38% 135 69538 0.41% 136 73417 0.43% 137 77501 0.45% 138 82307 0.48% 139 86594 0.51% 140 91892 0.54% 141 99769 0.58% 142 108632 0.63% 143 122497 0.72% 144 141921 0.83% 145 167191 0.98% 146 212268 1.24% 147 270476 1.58% 148 425462 2.48% 149 796165 4.65% 150 3897002 22.76% 151 8987936 52.49% 17124614 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.41 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=20.87 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.1 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=21 prefix-density=0.48 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=38.95 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.8 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7230770 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:50:36 Started mapping on | Feb 11 00:50:36 Finished on | Feb 11 00:52:25 Mapping speed, Million of reads per hour | 565.58 Number of input reads | 17124614 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 14950126 Uniquely mapped reads % | 87.30% Average mapped length | 290.44 Number of splices: Total | 14613447 Number of splices: Annotated (sjdb) | 14277377 Number of splices: GT/AG | 14337882 Number of splices: GC/AG | 221971 Number of splices: AT/AC | 8132 Number of splices: Non-canonical | 45462 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442058 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 41398 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.79% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1751173 1751173 1751173 N_multimapping 442058 442058 442058 N_noFeature 579883 14713635 685760 N_ambiguous 300197 2329 167833 UnstrandedReadsAssigned:14070046 PositiveStrandReadsAssigned:234162 NegativeStrandReadsAssigned:14096533 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230770 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230770-trimmed-pair1.fastq SRR7230770-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,124,614 reads, 15,221,941 reads pseudoaligned [quant] estimated average fragment length: 240.715 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,024 rounds 52401 SRR7230770.ke.tsv 34699 SRR7230770.se.tsv 87100 total ==> SRR7230770.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.29 973 36.3846 Potri.005G024800.1.v4.1 1035 795.285 171 14.2981 Potri.004G059700.1.v4.1 961 721.347 30 2.76556 Potri.007G009000.2.v4.1 1416 1176.29 0 0 Potri.003G141000.2.v4.1 2943 2703.29 826.347 20.3272 Potri.016G087400.1.v4.1 270 85.3295 939.768 732.365 Potri.015G069301.1.v4.1 564 331.472 0 0 Potri.010G195200.1.v4.1 1773 1533.29 143 6.20182 Potri.012G127500.1.v4.1 977 737.317 91 8.20717 ==> SRR7230770.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1360 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR7230770 completed mapping pipeline successfully